"
Alternative selectable and counter-selectable markers:
Levansucrase (sacB)
Background
SacB is the levansucrase enzyme from Bacillus subtilis (Gay, Coq, Strinmetz, Ferrari, & Hoch, 1983) which converts sucrose into fructose polymers which are lethal to Esherichia coli (French & Kowal, 2010). This part was deposited into the Registry by Team Edinburgh 2010 and can be used as a counter selectable marker (French & Kowal, 2010). Our aim is to improve the part by assessing its counter selection efficiency.
Cloning
The plac-RFP fragment was obtained from the standard BioBrick plasmid and inserted in front of the sacB BioBrick. Method. The construct was confirmed with sequencing.
PCR of pSB1K3 plasmid (Kanamycin resistance) with psBNX3 insF2 forward primer (specific for BioBrick prefix) and dsred r2 reverse primer (specific for RFP) was prepared in order to obtain the plac-RFP fragment.
Figure 1: DNA gel of the PCR product from pSB1K3 amplification with primers specific to the BioBrick prefix and RFP. The band is abound 1 kb which corresponds to the expected size of plac-RFP.
Close the plasmid.
The plac-RFP PCR product was purified and digested with EcoRI HQ and SpeI. The sacB BioBrick deposited in 2010 (French & Kowal, 2010) was digested with EcoRI and XbaI. These were ligated together after purification. E.coli cells were transformed with the ligation. The red transformants were minipreped, digested with EcoRI HQ in order to linearise them and with EcoRI HQ and PstI in order to check the size of the insert.
Figure 2: DNA gel of miniprepped red clones of linearized plac-RFP-SacB ligation transformants. The band is around 4.5 kb which corresponds to pSB1C3 (2kb)+ +
Figure 3: The same clones were digested with EcoRI HQ and PstI to check the size of the insert. The band is around 2.5 kb which corresponds to SacB (1.5 kb)+ plac-rfp (1kb).
Close the method.
Sequencing results
Forward primer:
Ctttaaaaaaaatcccttagctttcgctaaggtgatttctggaattcgcggccgcttctagagcaatac
gcaaaccgtttcaccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactgga
aagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacact
ttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagataaaga
ggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcttatgga
aggttccgttaactgtcactagttcgaaatcgaaggtgaatgtgaaggtcgtccgtactaaggtaccca
gactgctaaactgaaagttactaaag
Reverse primer:
aggggccttaaacataaacttttcggttttagaaaagggcagggtggtgacaccttgcccttttttgcc
ggactgcagctactagtaatttatttgttaactgttaattgtccttgttcaaggatgctgtctttgaca
acagatgttttcttgcctttgatgttcagcaggaagcttggcgcaaacgttgattgtttgtctgcgtaa
aatcctctgtttgtcatatagcttgtaatcacgacattgtttcctttcgcttgaggtacagcgaagtgt
gagtaattaaaggttacatcgttaggatcaagatccatttttaacacatggcctgttttgttcagcggc
ttgtatgggccatttaaagaattagaaactttaccaagcatgttaatatcgttagacttatttccgtca
atccttatttttgatccgcgggagtcatttaacaggtaccatttgccgttcattttattttcgttcgcg
cgtctatttctttttgttactttgttttatgcaatcacgttttcattccttttttaattttgtatcatcgt
Close the sequencing results.
The idea of placing sacB under the control of the lac promoter is to create kanamycin-independent control. Moreover, by changing the IPTG levels, the level of selection can be controlled.
RFP is added to ensure that cells which have lost the cassette (should be white because of loss of RFP) can be distinguished from cells which have lost SacB function (should be red as RFP is still present). This would allow us to assess the counter-selection efficiency of SacB.
We also prepared a Kan-plac-RFP-sacB selection-counterselection cassette.
Characterisation
The growth of SacB (bottom) and a control (top) were tested by adding 1.3 g solid sucrose plus 0.5 ml sterile water into a well in the middle of the plate.
Figure 1: A quick test of SacB transformants' growth in the presence of sucrose. The growth of SacB (bottom) is inhibited near the well in comparison to the control (top).
Conclusion:
We prepared a plac-RFP-SacB construct which can be used for assessing counter-selection efficiency. (BBa_K917002)
We placed sacB under the lac promoter which allows IPTG dependent control rather than kanamycin dependent control and IPTG concentration-dependent control of the levels of selection.
We added RFP to allow distinguishing loss of the counter-selection cassette form loss of SacB fuction.
We prepared and characterized a Kan-plac-RFP-sacB selection-counterselection cassette (BBa_K917010)
Methods (expand)
Inserting gene into a biobrick vecor: Cloning a PCR product into a biobrick vector protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:bbcloning) however NEB buffers were used.
DNA gel preparation: Analysing DNA by gel electrophoresis protocol on OpanWetWare (http://openwetware.org/wiki/Cfrench:AGE) however 0.5*TAE rather than 1*TAE was used.
Colony PCR screen: Screening colonies by PCR protocol on OpenWetWare http://openwetware.org/wiki/Cfrench:PCRScreening
Transformations: Preparing and using compenent E.coli cells protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:compcellprep1)
PCR reactions : Cloning parts by PCR with Kod polymerase protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:KodPCR)
Minipreps : Plasmid DNA minipreps from Escerichia coli JM109 and similar strains protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:minipreps1)
Digests to linearise the DNA frangment/determine size of insert: Analytical restriction digests protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:restriction1)
DNA purification: Purifying a PCR product from solution protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:DNAPurification1) however 165 ul NaI, 5 ul glass beads,180 ul wash buffer and 10 ul EB were used.
DNA preparation for sequencing: 2.5 ul miniprepped DNA, 2 ul water and 1 ul forward primer ( specific for biobrick prefix) or reverse primer (specific for biobrick suffix)
Nitroreductase activity assay: Overnight liquid cultures of nitroreductase strains were centrifuged at 10000 rpm for 5 mins to pellet the cells. The cells were then resuspended in 250 ul PBS and 1 ul DTT to ensure that cellular proteins are not oxidized. The solution was sonicated 6* (10 s sonication+20 s rest). The supernatant was separated from the pellet by centrifugation and used for the NADH-dependent nitroreductase activity assay.
To assess background activity NADH (5 ul) and bacterial supernatant (5 ul) were added to 0.8 ml PBS and mixed. OD340 was measured for 1 minute. DNBA(5 ul) was added to the same cuvette to start the reaction and change in OD340 was monitored for 1 minute. DMSO(5 ul) was used a control (DNBA is dissolved in DMSO)
The protein concentration of each of the supernants was estimated by by Bradford protein assay using the Pierce reagent protocol on OpenWetWare(http://openwetware.org/wiki/Cfrench:ProteinAssay)
Close methods.
French, C., & Kowal, M. (2010, 09 24). B. subtilis levansucrase. Lethal to E.coli in presence of sucrose. Retrieved 2012, from Registry of standard biological parts: http://partsregistry.org/Part:BBa_K322921
Gay, P., Coq, D. l., Strinmetz, M., Ferrari, E., & Hoch, J. A. (1983). Cloning Structural Gene SacB, which Codes for Exoenzyme Levansucrase of Bacillus subtilis: Expression of the Gene in Esherichia coli. Journal of Bacteriology , 1424-1431.
Jahreis, K., Bentler, L., Bockmann, J., Hans, S., Meyer, A., Siepelmeyer, J., et al. (2002). Adaptation of sucrose metabolism in the Escherichia coli Wild-Type Strain EC31132. Journal of Bacteriology, 5307-5316.
Keuning, S., Janssen, D. B., & Witholt, B. (1985). Purification and Characterisation of Hyrdrolytic Haloalkane Dehalogenase from Xanthobacter autotrophicus GJ10. Journal of Bacteriology, 635-639.
Naested, H., Fennema, M., Hao, L., Andersen, M., Janssen, D. B., & Mundy, J. (1999). A bacterial haloalkane dehalogenase gene as a negative selectable marker in Arabidopsis. The Plant Journal, 571-576.
Nicklin, C. E., & Bruce, N. C. (1998). Aerobic degradation of 2,4,6-Trinitrotoluene by Enterobacter cloaceae PB2 and by Pentaerythritol tetranitrate reductase. Applied and environmental microbiology , 2864-2868.
Nillius, D., Muller, J., & Muller, N. (2011). Nitroreductase (GlNR1) increases susceptibility of Giardia lamblia and Escherichia coli to nitro drugs. Journal of antimicrobial chemotherapy, 1029-1035.
Kang et al. (2009). "Levan: Applications and Perspectives". Microbial Production of Biopolymers and Polymer Precursors. Caister Academic Press
Dahech, I, Belghith, K. S., Hamden, K., Feki, A., Belghith, H. and Mejdoub, H. (2011) Antidiabetic activity of levan polysaccharide in alloxan-induced diabetic rats. International Journal of Biological Macromolecules 49(4):742-746
Close cited works.
