"
Team:Stanford-Brown/Biomining/Harvesting
From 2012.igem.org
(→Harvesting) |
(→Harvesting) |
||
| Line 65: | Line 65: | ||
Undergoing metal-binding assays now and flagella imaging on SEM. | Undergoing metal-binding assays now and flagella imaging on SEM. | ||
| + | |||
| + | '''Flagella Removal Protocol''' | ||
| + | Procedure from Westerlund-Wikstrom Paper Cited | ||
| + | |||
| + | For large scale removal and purification of the flagella, we hoped to adopt the purification method stated in the paper entitled “Functional expression of adhesive peptides on flagellin”. The method outlined involved four steps: | ||
| + | |||
| + | 1. Shearing of flagella from bacteria | ||
| + | 2. Separating the cells from flagella | ||
| + | 3. Purifying the flagella | ||
| + | 4. Detection of the flagella | ||
| + | |||
| + | In the first step, agar plates of the bacteria were collected in Tris-HCL buffer. The cells then had their flagella sheared off by a Turrax homogenizer at 20,000 r.p.m. The next step included pelleting the cells, and re-centrifuging the supernatant to ensure that all residual bacterium were removed. The supernatant, which contained the flagella, was then ultracentrifuged to form a pellet which was reconstituted in 1ml 10mM Tris-HCL and 0.5% deoxycholate. The third step then involved purifying the flagella. This was accomplished by isopycnic ultracentrifugation in a 10-60% sucrose gradient in Tris-DOC. The complete conditions for ultracentrifugation are outlined within the article. Concentrated light was then used to illuminate and detect the flagella, which were then collected and dialysed against Tris and distilled water. | ||
| + | |||
| + | Once the flagella have been collected, we would need to separate the metal ions for collection and use. The purified intact flagella (complete with metal binding peptides and metal ions) would be collected on Gelman cellulose acetate filters. The Tris-DOC buffer would be washed through with 0.5M KCL. The filter and flagella were then immersed in 5M urea - 0.05M KCL for half an hour at 26 C. At this point, the filaments (flagellin) dissociated while the hook-basal body complexes that make up the rest of the flagella were eluted. | ||
'''CITATIONS''' | '''CITATIONS''' | ||
| Line 74: | Line 88: | ||
Kouichi Kuroda and Mitsuyoshi Ueda. ''Molecular design of the microbial cell surface toward the recovery of metal ions.'' Current Opinion in Biotechnology 2011, 22:427–433 | Kouichi Kuroda and Mitsuyoshi Ueda. ''Molecular design of the microbial cell surface toward the recovery of metal ions.'' Current Opinion in Biotechnology 2011, 22:427–433 | ||
| + | |||
| + | Benita Westerlund-Wikstro ̈m, Jarna Tanskanen, Ritva Virkola, Jo ̈rg Hacker, Martin Lindberg, Mikael Skurnik and Timo K.Korhonen. ''Functional expression of adhesive peptides on flagellin'' (Section - Purification of Chimeric Flagella) Protein Engineering vol.10 no.11 pp.1319-1326, 1997 | ||
Revision as of 02:34, 3 October 2012
Harvesting
The FliC gene codes for flagellin, a protein that arranges itself in a hollow cylinder to form the filament of a bacterial flagellum. The N and C termini of flagellin and alpha-helices flanking the termini form the inner core of the filament cylinder (Bergman). The central portion, or “dispensable region,” forms the outer surface of the filament, and is highly variable.
iGEM Team Slovenia 2008 used the FliC gene to design a chimeric fusion protein expressing the antigenic segment of H. pylori on E. coli flagella ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K133038 BBa_K133038]). Our team wanted to use the same flagellar expression mechanism to express metal binding sequences, and our part is an improvement on the Slovenian biobrick. In the process, we designed the FliC gene with a multiple cloning site (MCS) in the dispensable region so that any iGEM team can insert a protein to be expressed in the dispensable region.
Engineered MCS FliC:
Biobricks used:
[http://partsregistry.org/Part:BBa_J23100 Promoter J23100],
[http://partsregistry.org/Part:BBa_B0030 RBS B0030],
[http://partsregistry.org/Part:BBa_B0015 Terminator B0015]
We inserted the following metal-binding sequences into the FliC disposable region:
"HTTC" (Cu+2)
HNLGMNHDLQGERPYVTEGC -->CATAACCTGGGCATGAACCATGATCTGCAGGGCGAACGCCCGTATGTGACCGAAGGCTGC
"HypB1" (Cu+1)
CTTCGCG -->TGCACCACCTGCGGCTGCGGC
"HypB2" (Cu+1)
MCTTCGCGEG -->ATGTGCACCACCTGCGGCTGCGGCGAAGGC
HTTC4 - inserted fully
HTTC6 - close to perfect insertion (couple of bases off)
HTTC8 - inserted fully
HTTC9 - inserted fully
HTTC10 - close to perfect insertion
HypB14 - inserted fully
HypB24 - inserted fully
HypB24 - inserted fully
Undergoing metal-binding assays now and flagella imaging on SEM.
Flagella Removal Protocol
Procedure from Westerlund-Wikstrom Paper Cited
For large scale removal and purification of the flagella, we hoped to adopt the purification method stated in the paper entitled “Functional expression of adhesive peptides on flagellin”. The method outlined involved four steps:
1. Shearing of flagella from bacteria 2. Separating the cells from flagella 3. Purifying the flagella 4. Detection of the flagella
In the first step, agar plates of the bacteria were collected in Tris-HCL buffer. The cells then had their flagella sheared off by a Turrax homogenizer at 20,000 r.p.m. The next step included pelleting the cells, and re-centrifuging the supernatant to ensure that all residual bacterium were removed. The supernatant, which contained the flagella, was then ultracentrifuged to form a pellet which was reconstituted in 1ml 10mM Tris-HCL and 0.5% deoxycholate. The third step then involved purifying the flagella. This was accomplished by isopycnic ultracentrifugation in a 10-60% sucrose gradient in Tris-DOC. The complete conditions for ultracentrifugation are outlined within the article. Concentrated light was then used to illuminate and detect the flagella, which were then collected and dialysed against Tris and distilled water.
Once the flagella have been collected, we would need to separate the metal ions for collection and use. The purified intact flagella (complete with metal binding peptides and metal ions) would be collected on Gelman cellulose acetate filters. The Tris-DOC buffer would be washed through with 0.5M KCL. The filter and flagella were then immersed in 5M urea - 0.05M KCL for half an hour at 26 C. At this point, the filaments (flagellin) dissociated while the hook-basal body complexes that make up the rest of the flagella were eluted.
CITATIONS
Molly A. Bergman,Lisa A. Cummings,Robert C. Alaniz,Laura Mayeda,Ivana Fellnerova,Brad T. Cookson. CD4+-T-Cell Responses Generated during Murine Salmonella enterica Serovar Typhimurium Infection Are Directed towards Multiple Epitopes within the Natural Antigen FliC. 2005 Infect Immun. 73(11): 7226–7235
E.Coli FliC gene: http://biocyc.org/ECOLI/sequence-rc?type=GENE&object=EG10321
Kouichi Kuroda and Mitsuyoshi Ueda. Molecular design of the microbial cell surface toward the recovery of metal ions. Current Opinion in Biotechnology 2011, 22:427–433
Benita Westerlund-Wikstro ̈m, Jarna Tanskanen, Ritva Virkola, Jo ̈rg Hacker, Martin Lindberg, Mikael Skurnik and Timo K.Korhonen. Functional expression of adhesive peptides on flagellin (Section - Purification of Chimeric Flagella) Protein Engineering vol.10 no.11 pp.1319-1326, 1997
