Team:Westminster/Journal

• Home
• Team
• Project
  • Overview
  • The Problem
  • Experiments
  • Protocols
  • Results
  • Safety
  • Journal
• Parts
• Modeling
• Outreach
• Judging Criteria
• Attributions

May 14

Westminster iGEM 2012 ideas storm meeting. Ideas discussed include

1. Engineering postmodification of GFP as a detection system

2.  Engineering bacteria monolayers

3.  Engineering for reduced senescence

4.  Synthetic epigenetic regulator

5. Bio sensing

6. Synthetic telomeric expansion

7. Generics or Antibody production

8. Biomagnetism

9. HIV prevention based on receptor affinity

10. Exosome delivery systems

11. Ortogonal rhibosome

May 16

Westminster iGEM 2012 ideas storm meeting. Discussion about recruiting more members to the team.

May 21

Advertising poster made and put up around Cavendish campus inviting student to attend the next iGEM meeting.

May 23

Westminster iGEM 2012 ideas storm meeting. Criteria for assessing proposed project ideas discussed. Criteria will include:  Feasibility, WoWfactor, Application, Impact and Relevance to synthetic biology

May 25

Presentation of project ideas by individuals to the group.

May 30

Evaluation of ideas presented.

June 1

Two more possible project ideas brought forward.

1. Idea for detection of proliferating bacterial cells. After more research and discussion it was found that the complexity of cell surface ligands of Gram Negative bacteria may mean that the project is not likely to be feasible.

2.  Designing  bacteria which dissolve chewing gum on pavements raised by Silvia. This idea is to be explored further.

June 6

More work being done on the chewing gum idea. Additionally, other members of the team have been reading more about the iGEM competition and biobrick assembly.

June 16

Identification of key resources still required. Need to narrow down idea for the group, and get a few more students involved. Need to get some financial support.

June 30

Project discussions.

July 2

Identification of main projects to focus on – The chewing gum idea. Also the possibility of doing radic’s tattoo idea.

July 4

Developing the chewing gum idea has continued. A number of important factors need to be determined.

1. Researching the composition of gum.

2. Assessing whether the chewing gum idea is feasible as a synthetic biology project.

3. Looking for parts in the iGEM registry and determining other components required.

July 9

Update on progress in developing the chewing gum idea. A lab experiment has been designed to determine if the bubble gum idea would work.

July 13

R.I.P. chewing gum idea! Lab experiment showed that the idea required  more of a chemical solution rather than biological.

New idea of Cancer stem cells (CSC) was raised.   http://www.bbc.co.uk/news/health-19083685

Although the existence of CSC was introduced more than 40 years ago, it has only been in the last 10 years that the identification of Aldehyde dehydrogenase (ALDH) as a biomarker of CSC has allowed for these cells to be detected and isolated. The project proposal is therefore to create molecular constructs for the detection, isolation and destruction of Cancer stem cells.

2 days to deadline for project proposals!

July 15

Cancer stem cell idea voted as the Westminster iGEM project and submitted to iGEM.

July 17

Task plan generated. Research started by a number of team members. Group members also continued researching building biobricks.

July 20

Identification of the four ALDH isoforms which will be used in the project.

ALDH1A1 –ALDH-1 family

 ALDH1A3 – ALDH-1 family

 ALDH3A1 – AHDH 3 family

 ALDH2 – to be used as control

We need to identify the promoters for each of the isoforms.

July 22

Research into Cre-lox technology. Continued research on the project and search for ALDH promoter sequences.

Hima has looked at ALDH2 promoter sequence and has identified a 903bp sequence. A commercial sequence has also been found which has identical sequence to the PUBMED identified sequence.

http://www.ncbi.nlm.nih.gov/gene/217

Additionally, a PstI site has been identified in the promoter region. This will need to be removed by site directed mutagenesis.

July 23

Further feedback on ALDH promoters. Karin had found the promoter for ALDH1A1. There seems to be a number of restriction sites in the promoter. The gene codes in the reverse direction. This is important when designing primers.

http://www.ncbi.nlm.nih.gov/gene/216

Silvia has looked at ALDH3A1. Promoter region has been identified and primers designed incorporating prefix and suffix biobrick regions.

http://www.ncbi.nlm.nih.gov/gene/218

Proposed Promoter Sequence: (position -19649444 to -19648446) = 998bp

Forward-Primer: TGAACTTCTGACCTCAGGTGA

Reverse-Primer:  CGGCCTCGCTGATCTTGC

July 24

Further work on primer design. Clarification of prefix and suffix regions for building biobricks. ALDH3A1 further analysed, EcoR1 and 2 PstI sites identified.

July 25

Need to review ALDH1A1 promoter region. Short video provided by Mark on using NCBI to find promoter regions has been useful to the group.  ALDH1A1 promoter region corrected by Karin.http://www.ncbi.nlm.nih.gov/gene/216   75569370 to -75568234 on negative strand.

Additionally, a search for biobrick parts begun. List of parts required has been drawn up and assigned to members.

July 27

Primers designed for ALDH1A1.

Forward-Primer                         CATCATATGACTTTTTTCAAC    

Reverse-Primer            TTCTGATTCGGCTCCTGGAA

More research on the Cre-lox system done. A means of switching on and off may be required. Parts for the cre-lox system sought from the parts registry.

Mammalian parts identified from 2011 DTU-Denmark iGEM team. These are not standard assembly parts. Need to make a decision on how these will be used, ie. do we go down the PlugnPlay assembly route. It may be necessary as standard mammalian parts have not been located in the registry. Clarification on using PlugnPlay has been sought from IGEM on assembly rules.

July 29

Continued  investigation into PlugnPlay assembly.

July 30

Registered for iGEM UK Team Hangout. 

Karin identified EcoR1 as the only illegal site in ALDH1A1 promoter sequence.

July 31

Following iGEM response a decision to use PlugnPlay assembly has been taken. BUT parts will have to be made standard for submitting to the iGEM registry.  In particular, it will still be necessary to remove illegal sites from promoter regions.

August 1

Project has been further defined and some new roles delegated. Discussion on mutagenisis and removing illegal sites from the promoter region.

August 2

Promoter sequence of ALDH1A3 determined and primers designed.

http://www.ncbi.nlm.nih.gov/gene/220

Promoter sequence checked against commercially available sequences. No illegal sites found in the promoter region.

August 3

Search for antibiotic resistance gene for mammalian cells in the biobrick registry. Search for backbone for mammalian expression continues.

August 4

More discussion on the use of PlugnPlay. Using PlugnPlay means that we could test the un-mutated promoters, but would have to do the mutation to conform to parts standards. It remains uncertain how mutagenisis will affect the promoter activity.

August 5

Possible backbone identified.

ALDH2 promoter sequence determined and PstI site has been found. Primer for amplification of the promoter region have been designed. There is a suggestion that it may be possible to omit the region containing the PstI site. This needs to be looked at further.

 http://www.ncbi.nlm.nih.gov/gene/217.

More work on the Cre-lox system reported. More work presented on identifying biobrick parts. Backbone and fluorescent parts looked at.

Consolidation of progress and identification of next steps for the project.

August 7

Received very useful information from DTU regarding their use of PlugnPlay:

“Response from DTU:
Thank you for your interest in using our assembly system.

The Plug'n'Play system was created in hope that iGEM would see that they needed to change their assembly standard and the RFC-10, and that it did but it is a slow process. Most of our parts did therefore not comply with the RFC-10 and iGEM did not accept them. However, we had to apply the RFC-10 to a least one part to be regarded for the gold medal. Three parts was done with the RFC-10 and with the backbone of the shipping plasmid pSB1C3 with chloramphenicol resistance and holding the restriction site of the iGEM assembly standard (BBa_K678002). …”

August 8

Some discrepancy found in Primers designed for some of the ALDH promoter amplifications when final product size was compared to commercial sequences. Primers have therefore been re-designed.

Design for parts assembly begun, experiments 1 and 2.

Experiment 1

1.ALDH promoter

2.Yeast Kozak sequence (Ribosome Binding Site) BBa_K165002

3.mRFP ORF (protein coding domain)

4. Eukaryotic Terminator

5.Hygromycin resistance cassette

6.Plasmid backbone with chloramphenicol  resistance

Experiment 2

1.ALDH promoter

2.Yeast Kozak sequence (Ribosome Binding Site) BBa_K165002

3.Puromycin ORF (protein coding domain)

4. Eukaryotic Terminator

5.Hygromycin resistance cassette

6.Plasmid backbone with chloramphenicol  resistance

August 9

Design for assembly of parts begun for experiment 3.

August 10

It has been brought to attention that direction of promoter sequences needs to be confirmed prior to primers being ordered.

ALDH Promoters as they appear on their respective genes:

1. ALDH1A1 is on the negative strand
2. ALDH3A1 is on the negative strand
3. ALDH1A3 is on the positive strand

4. ALDH2 is on the positive strand

August 11

More research into USER cloning and drawing up of parts list. More research into mutagenisis of illegal sites.

Parts identified thus far:

Experiment 1

1.     ALDH promoter

2.     Yeast Kozak sequence (Ribosome Binding Site) BBa_K165002

3.     mRFP Open Reading Frame (protein coding domain) BBa_E1010 (RFC10 compatible)

4.     Eukaryotic Terminator BBa_J52016

5.     Hygromycin resistance cassette for selection in mammalian cells  DTU Part:BBa_K678021 (NOT RFC10 compatible)

6.     Plasmid backbone with chloramphenicol  resistance pSB1C3 (RFC10 compatible)**

Experiment 2

1.     ALDH promoter

2.     Yeast Kozak sequence (Ribosome Binding Site) BBa_K165002

3.     Puromycin ORF (protein coding domain) BBa_J96012 (RFC10 compatible)

4.     Eukaryotic Terminator BBa_J52016

5.     Hygromycin resistance cassette for selection in mammalian cells  DTU Part:BBa_K678021 (NOT RFC10 compatible)

6.     Plasmid backbone with chloramphenicol  resistance pSB1C3 (RFC10 compatible)**

August 11

Parts identified for experiment 3

Experiment 3

1.     Doxycycline-inducible mammalian promoter BBa_K415506 (NOT RFC10 compatible)***

2.     Cre recombinase ORF BBa_J61047 (RFC10 compatible)*

3.     Eukaryotic Terminator BBa_J52016

4.     ALDH promoter

5.     Lox 66 BBa_I718016 (RFC10 compatible)*

6.     Yeast Kozak sequence (Ribosome Binding Site) BBa_K165002

7.     Puromycin ORF (protein coding domain) BBa_J96012 (RFC10 compatible)

8.     Eukaryotic Terminator BBa_J52016

9.     Lox 71 BBa_I718017 (RFC10 compatible)*

10.  Yeast Kozak sequence (Ribosome Binding Site) BBa_K165002

11.  mRFP Open Reading Frame (protein coding domain) BBa_E1010 (RFC10 compatible)

12.  Eukaryotic Terminator BBa_J52016

13.  Hygromycin resistance cassette for selection in mammalian cells  DTU Part:BBa_K678021 (NOT RFC10 compatible)

14.  Plasmid backbone with chloramphenicol  resistance pSB1C3 (RFC10 compatible)**

*The cre-recombinase and the two Lox sites are compatible: see them in BBa_K318030 the Lock Cassette which is compatible with BBa_K318000 the Key Cassette.

August 16

Consolidation of results. Update of parts list.

August 17

Attendance and presentation at the iGEM UK Hangout at GOOGLE Campus. We had the opportunity to learn a lot from the other teams and returned from the meet newly inspired. We have a lot of work ahead of us.

August 19

Push forward with finding sponsorship. Closer look at judging criteria, we want to aim high – Reach for GOLD!

Consolidation of Team name – iSTEM, and further development on team identity and designing the team logo.

New roles taken up by team members.

August 23

Looked into promotion ideas and the team decided that a promotional video is required.  Time was spent putting forward ideas for the video.  

Push forward with finding funding and identification of possible sponsors. We also had a discussion about Human Practice.

Protocols for the lab are being put together.

August 24

Team photo’s taken in Regent Park.

More ideas for video have been put forward and the team had further discussion about Human Practice and how to proceed.

T-shirt design was discussed discussed and a few concepts derived.

Big push for each of the team members to deliver results is now on.

August 25

Started to draw up the list for reagents and consumables needed in the Lab and filling the order forms.

August 26

Team photo’s and profile pics selected. Karin has been looking into the safety and ethics part of the project.

August 27

Today we did filming for a promotional video. The footage needs to be edited. The search continues to find a sponsor for the Regional Jamoree. Requests have been sent to 10 companies, so fingers crossed. It is a bit late in the shedual to apply for funding, but we are hopeful. We are looking to interview a number of University lecturers involved in Cancer research. First set of primers has been ordered!

August 30

Went through the work flow for lab experiments. Determined the next steps required to complete the assembly parts list. The designing of the plugnplay primers was explained and this work needs to be done soon so that primers can be ordered. This was recorded.

Passaging of our two cell lines was done (by Andy). This is in preparation for optimisation of the transfection reagent which is going to be used for the transfections. A recording to the passaging of the cells was made.

Action Points:

Need to create a TICK list

Need to delegate wiki and computer work

Need to finalise parts list – we are obtaining parts from DTU 2011 iGEM team.

Need to design fusion primers and get them ordered

Need to look into mutagenisis and design all the required primers and get them ordered ASAP

September 1

We have come across the Eukaryotic promoter Database!! They have the ALDH isoforms which we are using in our project. Further investigation has revealed that the promoter sequences on the site have been tested. This is encouraging news. Analysis of our own selected sequences and that of EPD show that ALDH1A1, ALDH2 and ALDH1A3 have significant overlap. We have designed new primers for ALDH1A1 avoid the restriction site. Also, ALDH3A1 has multiple promoter regions. We have therefore selected one of the EPD promoter sequences and designed new primers. Work continues on designing primers for plug-n-play.

September 3

We have moved into the Lab!! But  we are still waiting for primers. Work on wiki design and logo continues. Parts required from Serano have been identified, now it’s just a matter of getting them from Barcelona!Hopefully DTU parts will be sent tomorrow. Still waiting for primers.

September 5

The survey has been finalised and is to be posted soon. An interview with Dr Miriam Dwek has been organised and all in the team are looking forward to this. Andy has begun transfection optimisation using PEI. Traven and visa requirements are being sorted. Two team members attended the Societies of Westminster first meetup of the year. This was a great opportunity to introduce iGEM to other student groups in the university. We received great advice from all the groups and look forward to interacting with them over the year.

September 6

Deadline!! on  7^th. We finally got conformation on the iGEM definition of BSc vs MSc students. Safety questions are answered and now just need to work out how to get them onto the wiki. We have not been able to find outside funding and the University  has generously sponsored the Registration fee for Amsterdam. Amsterdam, here we come!!

September 7

Deadline! Fees (tick), Safety (tick), Judging (tick)

September 10

Been busy… but so much still to do. Still waiting for primers so have been busy designing the lad procedures. We really are pressed for time now, but all in the team are still upbeat and excited to build out BioBricks. Linker primers have been ordered from IDT. Work has begun in preparing for Freshers.

September 11

The interview with Miriam Dwek has gone very well. Primers arrived late this afternoon, so we can start BioBrick building tomorrow.

September 12

It’s all systems go in the lab. First PCR to amplify out biobricks was unsuccessful. The plan is to do a crude extraction of DNA and see if that works.

September 13

We got one!! We have managed to amplify ALDH2 promoter. The rest of the team continues to work on Freshers attendance and other aspects of the project. We now need to start thinking about site directed mutagenisis!!

September 16

Been busy! Did touchdown PCR and got some bands, since then its been PCR-Gel-PCR-Gel-Gel extract-Transform-PCR-Gel…. Love it.

September 19

We’ve been busy. There just isn’t enough time in the day. Freshers at Marylebone was good experience. This is an arts and design campus, so it’s been good practice in trying to engage individuals who are not necessarily interested in science. Lab has had its ups and downs.

September 20

Freshers at Cavendish! What a great day! It’s been just the boost the team has needed. Up to 100 students have signed up the  our mailing list and there has been much enthusiastic interest in iGEM. Still waiting for DTU parts! Unfortunately we really have run out of time. We are all looking forward to testing plug-n-play though!

September 21

DTU parts have arrived. Lots to do now.

September 24

Things have been manic in the lab. Many PCR optimisations later and we are still not satisfied with our amplification of parts using our linker primers. All very frustrating. We have tried Taq to see if  we can at least amplify the parts. Promoter parts are ready for sending and sequencing.