Team:TU Darmstadt/Project/Metabolism/Materials
From 2012.igem.org
(Difference between revisions)
(→Equipment) |
|||
Line 343: | Line 343: | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 1 |
| Antarctic Phosphatase | | Antarctic Phosphatase | ||
| NEB | | NEB | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 2 |
| BsaI | | BsaI | ||
| NEB | | NEB | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 3 |
| EcoRI-HF | | EcoRI-HF | ||
| NEB | | NEB | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 4 |
| Phusion® High-Fidelity DNA Polymerase | | Phusion® High-Fidelity DNA Polymerase | ||
| NEB | | NEB | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 5 |
| PstI-HF | | PstI-HF | ||
| NEB | | NEB | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 6 |
| SpeI-HF | | SpeI-HF | ||
| NEB | | NEB | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 7 |
| T4 DNA Ligase | | T4 DNA Ligase | ||
| NEB | | NEB | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 8 |
| Taq DNA Polymerase with ThermoPol Buffer | | Taq DNA Polymerase with ThermoPol Buffer | ||
| NEB | | NEB | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 9 |
| XbaI | | XbaI | ||
| NEB | | NEB | ||
Line 788: | Line 788: | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 1 |
| PureYield™ Plasmid Miniprep System | | PureYield™ Plasmid Miniprep System | ||
| Promega | | Promega | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 2 |
| PureYield™ Plasmid Midiprep System | | PureYield™ Plasmid Midiprep System | ||
| Promega | | Promega | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 3 |
| Wizard® SV Gel and PCR Clean-Up System | | Wizard® SV Gel and PCR Clean-Up System | ||
| Promega | | Promega | ||
Line 813: | Line 813: | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 1 |
| epT.I.P.S.® Box pipette tips 0.1–20 µL | | epT.I.P.S.® Box pipette tips 0.1–20 µL | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 2 |
| epT.I.P.S.® Box pipette tips 10–200 µL | | epT.I.P.S.® Box pipette tips 10–200 µL | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 3 |
| epT.I.P.S.® Box pipette tips 100–1000 µL | | epT.I.P.S.® Box pipette tips 100–1000 µL | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 4 |
| epT.I.P.S.® Bulk pipette tips 0.1–20 µL | | epT.I.P.S.® Bulk pipette tips 0.1–20 µL | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 5 |
| epT.I.P.S.® Bulk pipette tips 10–200 µL | | epT.I.P.S.® Bulk pipette tips 10–200 µL | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 6 |
| epT.I.P.S.® Bulk pipette tips 100–1000 µL | | epT.I.P.S.® Bulk pipette tips 100–1000 µL | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 7 |
| PCR Tubes 0.2 mL | | PCR Tubes 0.2 mL | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 8 |
| PCR Tube Strips 0.2 mL | | PCR Tube Strips 0.2 mL | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 9 |
| Safe-Lock Tubes (1.5 mL) | | Safe-Lock Tubes (1.5 mL) | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 10 |
| Safe-Lock Tubes (2 mL) | | Safe-Lock Tubes (2 mL) | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 11 |
| Rotilabo®-syringe filters | | Rotilabo®-syringe filters | ||
| Carl Roth GmbH | | Carl Roth GmbH | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 12 |
| NORM-Ject Syringes | | NORM-Ject Syringes | ||
| Henke/Sass/Wolf | | Henke/Sass/Wolf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 13 |
| Multiply®-PCR-tubes 0.2 mL | | Multiply®-PCR-tubes 0.2 mL | ||
| Sarstedt | | Sarstedt | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 14 |
| VWR® Pipet Tips (Standard Tips, 0.1–20 µL) | | VWR® Pipet Tips (Standard Tips, 0.1–20 µL) | ||
| VWR | | VWR | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 15 |
| VWR® Pipet Tips (Standard Tips, 10–200 µL) | | VWR® Pipet Tips (Standard Tips, 10–200 µL) | ||
| VWR | | VWR | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 16 |
| VWR® Pipet Tips (Standard Tips, 100-1000 µL) | | VWR® Pipet Tips (Standard Tips, 100-1000 µL) | ||
| VWR | | VWR | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 17 |
| VWR® Powder-Free Nitrile Examination Gloves | | VWR® Powder-Free Nitrile Examination Gloves | ||
| VWR | | VWR | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 18 |
| Eco-friendly centrifuge tubes (15 mL, unsterile) | | Eco-friendly centrifuge tubes (15 mL, unsterile) | ||
| Carl Roth GmbH | | Carl Roth GmbH | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 19 |
| 50 mL Centrifuge tubes, sterile | | 50 mL Centrifuge tubes, sterile | ||
| Greiner bio-one | | Greiner bio-one | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 20 |
| Sekuroka®-disposal bags | | Sekuroka®-disposal bags | ||
| Carl Roth GmbH | | Carl Roth GmbH | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 21 |
| Rotiprotect®-nitrile gloves, unpowdered | | Rotiprotect®-nitrile gloves, unpowdered | ||
| Carl Roth GmbH | | Carl Roth GmbH | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 22 |
| UV-cuvettes PLASTIBRAND® (Micro z = 8,5 mm) | | UV-cuvettes PLASTIBRAND® (Micro z = 8,5 mm) | ||
| Brand GmbH & Co. KG | | Brand GmbH & Co. KG | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 23 |
| Parafilm® M | | Parafilm® M | ||
| Pechiney Plastic Packaging | | Pechiney Plastic Packaging | ||
Line 938: | Line 938: | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 1 |
| Mastercycler personal (Thermocycler) | | Mastercycler personal (Thermocycler) | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 2 |
| Heraeus Pico Microcentrifuge | | Heraeus Pico Microcentrifuge | ||
| Thermo Scientific | | Thermo Scientific | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 3 |
| Multifuge® 1S-R | | Multifuge® 1S-R | ||
| Thermo Scientific | | Thermo Scientific | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 4 |
| VX-150 Autoclave | | VX-150 Autoclave | ||
| Systec | | Systec | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 5 |
| Uni-Drybath Thermoshaker | | Uni-Drybath Thermoshaker | ||
| Universal Labortechnik | | Universal Labortechnik | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 6 |
| Vortex Genie 2 | | Vortex Genie 2 | ||
| Scientific Industries | | Scientific Industries | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 7 |
| Universal Centrifuge | | Universal Centrifuge | ||
| Sigma Laborzentrifugen | | Sigma Laborzentrifugen | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 8 |
| Dark Hood DH-40 with control panel and display | | Dark Hood DH-40 with control panel and display | ||
| Biostep | | Biostep | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 9 |
| BioMate 3S Spectrophotometer | | BioMate 3S Spectrophotometer | ||
| Thermo Scientific | | Thermo Scientific | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 10 |
| GENESYS 10S UV-Vis | | GENESYS 10S UV-Vis | ||
| Thermo Scientific | | Thermo Scientific | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 11 |
| Heraeus LaminAir HA 2448 GS | | Heraeus LaminAir HA 2448 GS | ||
| Heraeus | | Heraeus | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="30" | 12 |
| Signature™ Ergonomic High Performance Single-Channel Variable Volume Pipettors 10 µL | | Signature™ Ergonomic High Performance Single-Channel Variable Volume Pipettors 10 µL | ||
| VWR | | VWR | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="30" | 13 |
| Signature™ Ergonomic High Performance Single-Channel Variable Volume Pipettors 100 µL | | Signature™ Ergonomic High Performance Single-Channel Variable Volume Pipettors 100 µL | ||
| VWR | | VWR | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="30" | 14 |
| Signature™ Ergonomic High Performance Single-Channel Variable Volume Pipettors 1000 µL | | Signature™ Ergonomic High Performance Single-Channel Variable Volume Pipettors 1000 µL | ||
| VWR | | VWR | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 15 |
| Research® plus, adjustable pipette 0.5 - 10 µL | | Research® plus, adjustable pipette 0.5 - 10 µL | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 16 |
| Research® plus, adjustable pipette 10 - 100 µL | | Research® plus, adjustable pipette 10 - 100 µL | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 17 |
| Research® plus, adjustable pipette 100 – 1000 µL | | Research® plus, adjustable pipette 100 – 1000 µL | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 18 |
| Research® plus, adjustable pipette 10 - 200 µL | | Research® plus, adjustable pipette 10 - 200 µL | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 19 |
| Research® plus, adjustable pipette 0.5 - 20 µL | | Research® plus, adjustable pipette 0.5 - 20 µL | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 20 |
| Reference, adjustable pipette 0.5 – 10 µL | | Reference, adjustable pipette 0.5 – 10 µL | ||
| Eppendorf | | Eppendorf | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 21 |
| M-Prove Balances | | M-Prove Balances | ||
| Sartorius | | Sartorius | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 22 |
| M-Power Balances | | M-Power Balances | ||
| Sartorius | | Sartorius | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 23 |
| Owl Series EasyCast™ Horizontal Mini-Gel Systems | | Owl Series EasyCast™ Horizontal Mini-Gel Systems | ||
| VWR | | VWR | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 24 |
| Owl Series Horizontal Gel Systems | | Owl Series Horizontal Gel Systems | ||
| VWR | | VWR | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 25 |
| Owl Series Dual Gel Vertical Electrophoresis System | | Owl Series Dual Gel Vertical Electrophoresis System | ||
| VWR | | VWR | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 26 |
| Power Supplies 250V | | Power Supplies 250V | ||
| VWR | | VWR | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 27 |
- | | Incubation/Inactivation Water Bath | + | | Incubation/Inactivation Water Bath 1008 |
| Gesellschaft für Labortechnik | | Gesellschaft für Labortechnik | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 28 |
| Lab-Shaker LSR-V | | Lab-Shaker LSR-V | ||
| Adolf Kühner AG | | Adolf Kühner AG | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 29 |
| MR Hei-Mix S | | MR Hei-Mix S | ||
| Heidolph | | Heidolph | ||
|- style="font-size:11pt" align="center" | |- style="font-size:11pt" align="center" | ||
- | |style="font-weight:bold" align=" | + | |style="font-weight:bold" align="center" height="15" | 30 |
| FE20 – FiveEasy™ pH | | FE20 – FiveEasy™ pH | ||
| Mettler Toledo | | Mettler Toledo | ||
|} | |} |
Revision as of 10:53, 23 September 2012
Materials
Contents |
Primer
No. | Name | 5´-->3´ |
1 | tphA2-l-F | TCATGCTTGCATCTCCTGTC |
2 | tphA2-l-Prefix | GAATTCGCGGCCGCTTCTAGATGCAAGAATCCATCATCCAGTGGC |
3 | tphA1-Suffix_R | CTGCAGCGGCCGCTACTAGTACTAATGGTTGCCAGTCGGGTCTG |
4 | tphA3-Suffix_R | CTGCAGCGGCCGCTACTAGTATCATAGCGGCAATGACATCAGCGTG |
5 | tphA3-Prefix_F | GAATTCGCGGCCGCTTCTAGATGATCCATGAAATTCAAATCGCGG |
6 | tphA1-l-R | CTAATGGTTGCCAGTCGGGT |
7 | tphA1-l-PstI(99)-F | CATGGTCTCCTCCAGGCCGGCATCGAGCT |
8 | tphA1-l-Prefix | GAATTCGCGGCCGCTTCTAGATGAACCACCAGATCCATATCCACG |
9 | tphA3-l-F | TCATAGCGGCAATGACATCA |
10 | tphA3-l-Prefix | GAATTCGCGGCCGCTTCTAGAGATGATCCATGAAATTCAAATCGC |
11 | Prefix | GAATTCGCGGCCGCTTCTAGAG |
12 | tphB-l-F | TCAGACCGGTTGGGCTCCGA |
13 | tphB-l-Prefix | GAATTCGCGGCCGCTTCTAGAGATGACAATAGTGCACCGTAGATT |
14 | tphA2-l-R | ATGCAAGAATCCATCATCCAG |
15 | tphA1-l-R | ATGAACCACCAGATCCATATC |
16 | tphA1-l-PstI(99)-R | CATGGTCTCCTGGAGGGCTGCATCCAGTAC |
17 | tphA3-l-R | ATGATCCATGAAATTCAAAT |
18 | Suffix | CTGCAGCGGCCGCTACTAGTA |
19 | tphB-l-Suffix-R | CTGCAGCGGCCGCTACTAGTATCAGACCGGTTGGGCTCCGAGTA |
20 | EcoRIGFxa-tphA1 | TTCTGGAATTCGGGTATTGAAGGAAGAATGAACCACCAGATCCATAT |
21 | EcoRIGFxa-tphA2 | TTCTGGAATTCGGGTATTGAAGGAAGAATGCAAGAATCCATCATCCA |
22 | EcoRIGFxa-tphA3 | TTCTGGAATTCGGGTATTGAAGGAAGAATGATCCATGAAATTCAAAT |
23 | EcoRIGFxa-tphB | TTCTGGAATTCGGGTATTGAAGGAAGAATGACAATAGTGCACCGTAG |
24 | EcoRIGFxa-aroY | TTCTGGAATTCGGGTATTGAAGGAAGAATGACAGCGCCTATCCAG |
25 | RBS-tphA1 | TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGAACCACCAGATCCATAT |
26 | RBS-tphA2 | TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGCAAGAATCCATCATCCA |
27 | RBS-tphA3 | TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGATCCATGAAATTCAAAT |
28 | RBS-tphB | TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGACAATAGTGCACCGTAG |
29 | RBS-aroY | TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGACAGCGCCTATCCAG |
30 | VF2 | TGCCACCTGACGTCTAAGAA |
31 | VR | ATTACCGCCTTTGAGTGAGC |
32 | pPR-IBA2 rev | TAGTTATTGCTCAGCGGTGG |
33 | pPR-IBA2 for | TAATACGACTCACTATAGGG |
Plasmids
No. | Name | Sequence |
1 | pSB1C3 | [http://partsregistry.org/Part:pSB1C3 Get] |
2 | pSB1AK3 | [http://partsregistry.org/Part:pSB1AK3 Get] |
3 | BBa_J61002 | [http://partsregistry.org/Part:BBa_J61002 Get] |
4 | pSB1A2 | [http://partsregistry.org/Part:pSB1A2 Get] |
5 | pPR-IBA2 | [http://www.iba-lifesciences.com/isotope/2/2-1391-000-Sequence-pPR-IBA2.txt Get] |
Biobricks from the registry
No. | Name | Platte | Well | Resistence | Plasmid backbone |
1 | BBa_K316003 | 4 | 15C | C | pSB1C3 |
2 | BBa_J23100 | 1 | 18C | A | BBa_J61002 |
3 | BBa_B0015 | 1 | 23L | A und K | pSB1AK3 |
4 | BBa_J61101 | 1 | 5L | A | pSB1A2 |
Bacteria
Species | Strain | Genotype | DSM-No. |
Escherichia coli | DH5α | F- endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17(rK- mK+), λ– | 6897 |
Escherichia coli | MG1655 | F- λ- ilvG- rfb-50 rph-1 | 18039 |
Escherichia coli | BL21(DE3)pLysS | F- ompT gal dcm lon hsdSB(rB- mB-) λ(DE3) pLysS(cmR) | none |
Comamonas testosteroni | Kf-1 | - | 14576 |
Enzymes
No. | Enzyme | Supplier |
1 | Antarctic Phosphatase | NEB |
2 | BsaI | NEB |
3 | EcoRI-HF | NEB |
4 | Phusion® High-Fidelity DNA Polymerase | NEB |
5 | PstI-HF | NEB |
6 | SpeI-HF | NEB |
7 | T4 DNA Ligase | NEB |
8 | Taq DNA Polymerase with ThermoPol Buffer | NEB |
9 | XbaI | NEB |
Chemicals
No. | Name | Firma | Order-ID |
1 | Terephthalat | Sigma-Aldrich | 185361-500G |
2 | Acetic acid | Roth | 6755.1 |
3 | Methanol | Roth | CP43.1 |
4 | Coomassie Brilliant Blue R-250 | Roth | 9598.1 |
5 | Trypton | Roth | 8952.1 |
6 | Ethylene glycol | Roth | 9516.1 |
7 | 3,4-Dihydroxybenzoic acid | Sigma-Aldrich | 37580-25G-F |
8 | Catechol | Sigma-Aldrich | C9510-100G |
9 | Isopropyl β-D-1-thiogalactopyranoside | Roth | CN08.1 |
10 | Tetramethylethylenediamine | Roth | 2367.3 |
11 | Ammonium persulfate | Roth | 9592.3 |
12 | Bromophenol blue | Roth | A512.1 |
13 | Glucose | Roth | X997.1 |
14 | Calcium chloride | Roth | CN92.1 |
15 | Dithiothreitol | Roth | 6908.1 |
16 | Sodium carbonate | Roth | 8563.1 |
17 | Phenylmethanesulfonylfluoride | Roth | 6367.1 |
18 | NADH-Disodium | Roth | AE12.1 |
19 | Nicotinamide adenine dinucleotide | Roth | AE11.1 |
20 | orthophosphoric acid 85% | Roth | 9079.1 |
21 | Trichloroacetic acid | Roth | 8789.2 |
22 | Quick-Load® 100 bp DNA Ladder | NEB Biolabs | N0467S |
23 | Phenol | AppliChem | A4458.0250 |
24 | Dimethyl sulfoxide | AppliChem | A1584.0100 |
25 | Methylene blue | AppliChem | A4084.0025 |
26 | Magnesium sulfate | AppliChem | A6287.0250 |
27 | Cetrimonium bromide | AppliChem | A0805.0100 |
28 | Tetramethylethylenediamine | AppliChem | A1148.0025 |
29 | Urea | AppliChem | A5470.0500 |
30 | Tween20 | AppliChem | A1389.0500 |
31 | Protein Marker III (6,5-200) | AppliChem | A4402.0001 |
32 | Thiamine hydrochloride | AppliChem | A09955.0050 |
33 | Triton X-100 | AppliChem | A1388.0500 |
34 | DNA-Dye NonTox | AppliChem | A9555.1000 |
35 | Agarose | Roth | 3810.2 |
36 | Ethanol 96 % | Roth | T171.4 |
37 | Ethylenediaminetetraacetic acid | Roth | X986.2 |
38 | Ethanol | Roth | P076.1 |
39 | Tetracycline hydrochloride | Roth | 237.1 |
40 | D-Desthiobiotin 10x Buffer E | iba | 2-1000-025 |
41 | 2-(4-Hydroxyphenylazo)benzoic acid | Sigma-Aldrich | H5126-5G |
42 | 10 mM dNTP-Mix | Roth | L785.2 |
43 | Hydrochloric acid | Roth | 9277.1 |
44 | Acrylamid - Bis (37,5:1) | Roth | 3029.1 |
45 | Ammonium acetate | Roth | 7869.2 |
46 | Agar-Agar | Roth | 5210.3 |
47 | Chloroform | Roth | 4423.1 |
48 | Glycine | Roth | 3790.2 |
49 | Dipotassium phosphate | Roth | T875.1 |
50 | Sodium chloride | Roth | 9265.1 |
51 | Yeast extract | Roth | 2363.2 |
52 | Monopotassium phosphate | Roth | P018.1 |
53 | Glycerine | Roth | 3783.1 |
54 | Sodium hydroxide | Roth | P031.1 |
55 | Tris-Base | Roth | AE15.2 |
56 | Isopropyl alcohol | Roth | CP41.3 |
57 | Isoamyl alcohol | Roth | T870.1 |
58 | Acetonitrile | Roth | 7330.2 |
59 | Acetone | Roth | 5025.5 |
60 | Chloramphenicol | Roth | 3886.2 |
61 | Ampicillin | Roth | K029.1 |
62 | Kanamycin | Roth | T832.1 |
63 | Sodium dodecyl sulfate | Roth | 5136.1 |
Kits
No. | Kit | Supplier |
1 | PureYield™ Plasmid Miniprep System | Promega |
2 | PureYield™ Plasmid Midiprep System | Promega |
3 | Wizard® SV Gel and PCR Clean-Up System | Promega |
Consumabels
No. | Article | Supplier |
1 | epT.I.P.S.® Box pipette tips 0.1–20 µL | Eppendorf |
2 | epT.I.P.S.® Box pipette tips 10–200 µL | Eppendorf |
3 | epT.I.P.S.® Box pipette tips 100–1000 µL | Eppendorf |
4 | epT.I.P.S.® Bulk pipette tips 0.1–20 µL | Eppendorf |
5 | epT.I.P.S.® Bulk pipette tips 10–200 µL | Eppendorf |
6 | epT.I.P.S.® Bulk pipette tips 100–1000 µL | Eppendorf |
7 | PCR Tubes 0.2 mL | Eppendorf |
8 | PCR Tube Strips 0.2 mL | Eppendorf |
9 | Safe-Lock Tubes (1.5 mL) | Eppendorf |
10 | Safe-Lock Tubes (2 mL) | Eppendorf |
11 | Rotilabo®-syringe filters | Carl Roth GmbH |
12 | NORM-Ject Syringes | Henke/Sass/Wolf |
13 | Multiply®-PCR-tubes 0.2 mL | Sarstedt |
14 | VWR® Pipet Tips (Standard Tips, 0.1–20 µL) | VWR |
15 | VWR® Pipet Tips (Standard Tips, 10–200 µL) | VWR |
16 | VWR® Pipet Tips (Standard Tips, 100-1000 µL) | VWR |
17 | VWR® Powder-Free Nitrile Examination Gloves | VWR |
18 | Eco-friendly centrifuge tubes (15 mL, unsterile) | Carl Roth GmbH |
19 | 50 mL Centrifuge tubes, sterile | Greiner bio-one |
20 | Sekuroka®-disposal bags | Carl Roth GmbH |
21 | Rotiprotect®-nitrile gloves, unpowdered | Carl Roth GmbH |
22 | UV-cuvettes PLASTIBRAND® (Micro z = 8,5 mm) | Brand GmbH & Co. KG |
23 | Parafilm® M | Pechiney Plastic Packaging |
Equipment
No. | Equipment | Supplier |
1 | Mastercycler personal (Thermocycler) | Eppendorf |
2 | Heraeus Pico Microcentrifuge | Thermo Scientific |
3 | Multifuge® 1S-R | Thermo Scientific |
4 | VX-150 Autoclave | Systec |
5 | Uni-Drybath Thermoshaker | Universal Labortechnik |
6 | Vortex Genie 2 | Scientific Industries |
7 | Universal Centrifuge | Sigma Laborzentrifugen |
8 | Dark Hood DH-40 with control panel and display | Biostep |
9 | BioMate 3S Spectrophotometer | Thermo Scientific |
10 | GENESYS 10S UV-Vis | Thermo Scientific |
11 | Heraeus LaminAir HA 2448 GS | Heraeus |
12 | Signature™ Ergonomic High Performance Single-Channel Variable Volume Pipettors 10 µL | VWR |
13 | Signature™ Ergonomic High Performance Single-Channel Variable Volume Pipettors 100 µL | VWR |
14 | Signature™ Ergonomic High Performance Single-Channel Variable Volume Pipettors 1000 µL | VWR |
15 | Research® plus, adjustable pipette 0.5 - 10 µL | Eppendorf |
16 | Research® plus, adjustable pipette 10 - 100 µL | Eppendorf |
17 | Research® plus, adjustable pipette 100 – 1000 µL | Eppendorf |
18 | Research® plus, adjustable pipette 10 - 200 µL | Eppendorf |
19 | Research® plus, adjustable pipette 0.5 - 20 µL | Eppendorf |
20 | Reference, adjustable pipette 0.5 – 10 µL | Eppendorf |
21 | M-Prove Balances | Sartorius |
22 | M-Power Balances | Sartorius |
23 | Owl Series EasyCast™ Horizontal Mini-Gel Systems | VWR |
24 | Owl Series Horizontal Gel Systems | VWR |
25 | Owl Series Dual Gel Vertical Electrophoresis System | VWR |
26 | Power Supplies 250V | VWR |
27 | Incubation/Inactivation Water Bath 1008 | Gesellschaft für Labortechnik |
28 | Lab-Shaker LSR-V | Adolf Kühner AG |
29 | MR Hei-Mix S | Heidolph |
30 | FE20 – FiveEasy™ pH | Mettler Toledo |