|
|
(48 intermediate revisions not shown) |
Line 1: |
Line 1: |
| + | {{Team:Amsterdam/toolStyleBase}} |
| + | {{Team:Amsterdam/toolStyleSunburst}} |
| + | {{Team:Amsterdam/stylesheet}} |
| + | {{Team:Amsterdam/scripts}} |
| + | {{Team:Amsterdam/Header}} |
| + | {{Team:Amsterdam/Sidebar2}} |
| <html> | | <html> |
- | <head>
| + | <script type='text/javascript' src='/Team:Amsterdam/maarten/slides.min.jquery.js?action=raw'></script> |
- | <script src="//ajax.googleapis.com/ajax/libs/jquery/1.2.3/jquery.min.js"></script>
| + | |
- | <script type='text/javascript'> | + | |
- | function setup(){
| + | |
- | j = 1
| + | |
- | if (j!=0){
| + | |
- | document.write(j)
| + | |
- | }
| + | |
- | }
| + | |
- | </script>
| + | |
- | </head>
| + | |
- | <body>
| + | |
- | <p>
| + | |
- | <form name='plasmidForm' class='rounded'>
| + | |
- | <div class='field'>
| + | |
- | <label for='Plasmid'>Plasmid:</label>
| + | |
- | <textarea type='text' class='input' name='plasmid' id='plasmid'>
| + | |
- | </textarea>
| + | |
- | <p class="hint">Enter your plasmid in fasta or genbank format</p>
| + | |
- | </div>
| + | |
- | <br>
| + | |
- | <div class='field'>
| + | |
- | <label for='sensors'>promoters:</label>
| + | |
- | <textarea type='text' class='input' name='sensors' id='sensors'></textarea>
| + | |
- | <p class="hint">Enter your sensors in fasta or genbank format</p>
| + | |
- | </div>
| + | |
- | <input type='hidden' name='zf' value='>N1|1|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=N1PE3130|Engineered construct|C2H2 (3F)|GGGGTAGAA
| + | |
- | gcgcaggcggcgctggaaccgaaagaaaaaccgtatgcgtgcccggaatgcggcaaaagc
| + | |
- | tttagccagagcagcaacctggtgcgccatcagcgcacccataccggcgaaaaaccgtat
| + | |
- | aaatgcccggaatgcggcaaaagctttagccagagcagcagcctggtgcgccatcagcgc
| + | |
- | acccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagc
| + | |
- | gataaactggtgcgccatcagcgcacccataccggcaaaaaaaccagcggccaggcgggc
| + | |
- | >B3|2|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=B3PE3129|Engineered construct|C2H2 (3F)|GGAGGGGAC
| + | |
- | gcgcaggcggcgctggaaccgaaagaaaaaccgtatgcgtgcccggaatgcggcaaaagc
| + | |
- | tttagcgatccgggcaacctggtgcgccatcagcgcacccataccggcgaaaaaccgtat
| + | |
- | aaatgcccggaatgcggcaaaagctttagccgcagcgataaactggtgcgccatcagcgc
| + | |
- | acccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccagagc
| + | |
- | agccatctggtgcgccatcagcgcacccataccggcaaaaaaaccagcggccaggcgggc
| + | |
- | >Anti-BcrAbl|3|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=ABAE4134|Engineered construct|C2H2 (4F)|GACGCAGAAGCC
| + | |
- | gcggaagaaaaaccgtttcagtgccgcatttgcatgcgcaactttagcgatcgcagcagc
| + | |
- | ctgacccgccatacccgcacccataccggcgaaaaaccgtttcagtgccgcatttgcatg
| + | |
- | cgcaactttagccagggcggcaacctggtgcgccatctgcgcacccataccggcgaaaaa
| + | |
- | ccgtttcagtgccgcatttgcatgcgcaactttagccaggcggcgaccctgcagcgccat
| + | |
- | ctgaaaacccataccggcgaaaaaccgtttcagtgccgcatttgcatgcgcaactttagc
| + | |
- | gatcgcagcaacctggaacgccatacccgcacccataccggcgaaaaactggaacgcccg
| + | |
- | catcgcgat
| + | |
- | >C7-C7|4|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=C72E6127|Engineered construct|C2H2 (2x3F)|GCGTGGGCGGCGTGGGCG
| + | |
- | gaacgcccgtatgcgtgcccggtggaaagctgcgatcgccgctttagcaaaagcgcggat
| + | |
- | ctgaaacgccatattcgcattcataccggccagaaaccgtttcagtgccgcatttgcatg
| + | |
- | cgcaactttagccgcagcgatcatctgaccacccatattcgcacccataccggcgaaaaa
| + | |
- | ccgtttgcgtgcgatatttgcggccgcaaatttgcgcgcagcgatgaacgcaaacgccat
| + | |
- | accaaaattcataccggcgaaaaaccgtatgcgtgcccggtggaaagctgcgatcgccgc
| + | |
- | tttagcaaaagcgcggatctgaaacgccatattcgcattcataccggccagaaaccgttt
| + | |
- | cagtgccgcatttgcatgcgcaactttagccgcagcgatcatctgaccacccatattcgc
| + | |
- | acccataccggcgaaaaaccgtttgcgtgcgatatttgcggccgcaaatttgcgcgcagc
| + | |
- | gatgaacgcaaacgccataccaaaattcatctgcgccagaaagat
| + | |
- | >3x2F ZMS|5|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=ZMSE6114|Engineered construct|C2H2 (3x2F)|GCGGACGCGGCGTGGGCG
| + | |
- | gaacgcccgtatgcgtgcccggtggaaagctgcgatcgccgctttagccgcagcgatgaa
| + | |
- | ctgacccgccatattcgcattcataccggccagaaaccgtttcagtgccgcatttgcatg
| + | |
- | cgcaactttagccgcagcgatcatctgaccacccatattcgcacccataccggcggcgaa
| + | |
- | aaaccgtttgcgtgcgatatttgcggccgcaaatttgcgcgcagcgatgaacgcaaacgc
| + | |
- | cataccaaaattcataccggcgaacgcccgtatgcgtgcccggtggaaagctgcgatcgc
| + | |
- | cgctttagccgcagcgatgaactgacccgccatattcgcattcataccggcggccagaaa
| + | |
- | ccgtttcagtgccgcatttgcatgcgcaactttagcgatcgcagcaacctggaacgccat
| + | |
- | acccgcacccataccggcgaaaaaccgtttgcgtgcgatatttgcggccgcaaatttgcg
| + | |
- | cgcagcgatgaacgcaaacgccataccaaaattcatctgcgccagaaagat
| + | |
- | >268/NRE|6|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=NRCE6113|Engineered construct|C2H2 (2x3F)|AAGGGTTCAGGCGTGGGCG
| + | |
- | gaacgcccgtatgcgtgcccggtggaaagctgcgatcgccgctttagccgcagcgatgaa
| + | |
- | ctgacccgccatattcgcattcataccggccagaaaccgtttcagtgccgcatttgcatg
| + | |
- | cgcaactttagccgcagcgatcatctgaccacccatattcgcacccataccggcgaaaaa
| + | |
- | ccgtttgcgtgcgatatttgcggccgcaaatttgcgcgcagcgatgaacgcaaacgccat
| + | |
- | accaaaattcatctgcgccagaaagatggcgaacgcccgtatgcgtgcccggtggaaagc
| + | |
- | tgcgatcgccgctttagccagagccatgatctgaccaaacatattcgcattcataccggc
| + | |
- | cagaaaccgtttcagtgccgcatttgcatgcgcaactttagcgatagcagcaaactgagc
| + | |
- | cgccatattcgcacccataccggcgaaaaaccgtttgcgtgcgatatttgcggccgcaaa
| + | |
- | tttgcgcgcccggataaccgcaccgcgcataccaaaattcatctgcgccagaaagat
| + | |
- | >Sp1C-C7|7|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=SC7E6128|Engineered construct|C2H2 (2x3F)|GCGTGGGCGGGGGCGGGG
| + | |
- | gatccgggcaaaaaaaaacagcatatttgccatattcagggctgcggcaaagtgtatggc
| + | |
- | aaaaccagccatctgcgcgcgcatctgcgctggcataccggcgaacgcccgtttatgtgc
| + | |
- | acctggagctattgcggcaaacgctttacccgcagcgatgaactgcagcgccataaacgc
| + | |
- | acccataccggcgaaaaaaaatttgcgtgcccggaatgcccgaaacgctttatgcgcagc
| + | |
- | gatcatctgagcaaacatattaaaacccataccggcgaaaaaccgtatgcgtgcccggtg
| + | |
- | gaaagctgcgatcgccgctttagcaaaagcgcggatctgaaacgccatattcgcattcat
| + | |
- | accggccagaaaccgtttcagtgccgcatttgcatgcgcaactttagccgcagcgatcat
| + | |
- | ctgaccacccatattcgcacccataccggcgaaaaaccgtttgcgtgcgatatttgcggc
| + | |
- | cgcaaatttgcgcgcagcgatgaacgcaaacgccataccaaaattcatctgcgccagaaa
| + | |
- | gat
| + | |
- | >268//NRE|8|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=NRBE6112|Engineered construct|C2H2 (2x3F)|AAGGGTTCAGTGCGTGGGCG
| + | |
- | gaacgcccgtatgcgtgcccggtggaaagctgcgatcgccgctttagccgcagcgatgaa
| + | |
- | ctgacccgccatattcgcattcataccggccagaaaccgtttcagtgccgcatttgcatg
| + | |
- | cgcaactttagccgcagcgatcatctgaccacccatattcgcacccataccggcgaaaaa
| + | |
- | ccgtttgcgtgcgatatttgcggccgcaaatttgcgcgcagcgatgaacgcaaacgccat
| + | |
- | accaaaattcatctgcgccagaaagatggcggcggcagcgaacgcccgtatgcgtgcccg
| + | |
- | gtggaaagctgcgatcgccgctttagccagagccatgatctgaccaaacatattcgcatt
| + | |
- | cataccggccagaaaccgtttcagtgccgcatttgcatgcgcaactttagcgatagcagc
| + | |
- | aaactgagccgccatattcgcacccataccggcgaaaaaccgtttgcgtgcgatatttgc
| + | |
- | ggccgcaaatttgcgcgcccggataaccgcaccgcgcataccaaaattcatctgcgccag
| + | |
- | aaagat
| + | |
- | >E2C|9|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=E2CE6125|Engineered construct|C2H2 (2x3F)|GGGGCCGGAGCCGCAGTG
| + | |
- | gcgcaggcggcgctggaaccgggcgaaaaaccgtatgcgtgcccggaatgcggcaaaagc
| + | |
- | tttagccgcaaagatagcctggtgcgccatcagcgcacccataccggcgaaaaaccgtat
| + | |
- | aaatgcccggaatgcggcaaaagctttagccagagcggcgatctgcgccgccatcagcgc
| + | |
- | acccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgattgc
| + | |
- | cgcgatctggcgcgccatcagcgcacccataccggcgaaaaaccgtatgcgtgcccggaa
| + | |
- | tgcggcaaaagctttagccagagcagccatctggtgcgccatcagcgcacccataccggc
| + | |
- | gaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgattgccgcgatctggcg
| + | |
- | cgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagc
| + | |
- | tttagccgcagcgataaactggtgcgccatcagcgcacccataccggcaaaaaaaccagc
| + | |
- | ggccaggcgggc
| + | |
- | >ZFPAP3|10|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=AP3E6135|Engineered construct|C2H2 (2x3F)|TACTTCTTCAACTCCATC
| + | |
- | gcgcaggcggcgctggaaccgaaagaaaaaccgtatgcgtgcccggaatgcggcaaaagc
| + | |
- | tttagccagagcagcagcctggtgcgccatcagcgcacccataccggcgaaaaaccgtat
| + | |
- | aaatgcccggaatgcggcaaaagctttagccagagcagcaacctggtgcgccatcagcgc
| + | |
- | acccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccagagc
| + | |
- | agcaacctggtgcgccatcagcgcacccataccggcgaaaaaccgtatgcgtgcccggaa
| + | |
- | tgcggcaaaagctttagcaccagcggcagcctggtgcgccatcagcgcacccataccggc
| + | |
- | gaaaaaccgtataaatgcccggaatgcggcaaaagctttagccagagcagccatctggtg
| + | |
- | cgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagc
| + | |
- | tttagcaccagcggcaacctggtgcgccatcagcgcacccataccggcaaaaaaaccagc
| + | |
- | ggccaggcgggc
| + | |
- | >E3|11|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=E3PE6126|Engineered construct|C2H2 (2x3F)|GGAGCCGGAGCCGGAGTC
| + | |
- | gcgcaggcggcgctggaaccgggcgaaaaaccgtatgcgtgcccggaatgcggcaaaagc
| + | |
- | tttagcgatccgggcgcgctggtgcgccatcagcgcacccataccggcgaaaaaccgtat
| + | |
- | aaatgcccggaatgcggcaaaagctttagccagagcagccatctggtgcgccatcagcgc
| + | |
- | acccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgattgc
| + | |
- | cgcgatctggcgcgccatcagcgcacccataccggcgaaaaaccgtatgcgtgcccggaa
| + | |
- | tgcggcaaaagctttagccagagcagccatctggtgcgccatcagcgcacccataccggc
| + | |
- | gaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgattgccgcgatctggcg
| + | |
- | cgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagc
| + | |
- | tttagccagagcagccatctggtgcgccatcagcgcacccataccggcaaaaaaaccagc
| + | |
- | ggccaggcgggc
| + | |
- | >MUT|13|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=MUTE3115|Engineered construct|C2H2 (3F)|GCGGACGCG
| + | |
- | gaacgcccgtatgcgtgcccggtggaaagctgcgatcgccgctttagccgcagcgatgaa
| + | |
- | ctgacccgccatattcgcattcataccggccagaaaccgtttcagtgccgcatttgcatg
| + | |
- | cgcaactttagcgatcgcagcaacctggaacgccatacccgcacccataccggcgaaaaa
| + | |
- | ccgtttgcgtgcgatatttgcggccgcaaatttgcgcgcagcgatgaacgcaaacgccat
| + | |
- | accaaaattcatctgcgccagaaagat
| + | |
- | >NRE|14|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=NRAE3111|Engineered construct|C2H2 (3F)|AAGGGTTCA
| + | |
- | gaacgcccgtatgcgtgcccggtggaaagctgcgatcgccgctttagccagagccatgat
| + | |
- | ctgaccaaacatattcgcattcataccggccagaaaccgtttcagtgccgcatttgcatg
| + | |
- | cgcaactttagcgatagcagcaaactgagccgccatattcgcacccataccggcgaaaaa
| + | |
- | ccgtttgcgtgcgatatttgcggccgcaaatttgcgcgcccggataaccgcaccgcgcat
| + | |
- | accaaaattcatctgcgccagaaagat
| + | |
- | >GNG-GA1|15|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=GA1E3168|Engineered construct|C2H2 (3F)|GAGGAGGGG
| + | |
- | gatccgggcaaaaaaaaacagcatatttgccatattcagggctgcggcaaagtgtatggc
| + | |
- | cgcagcgatcatctggcgcgccatctgcgctggcataccggcgaacgcccgtttatgtgc
| + | |
- | acctggagctattgcggcaaacgctttacccgcagcgataacctggcgcgccataaacgc
| + | |
- | acccataccggcgaaaaaaaatttgcgtgcccggaatgcccgaaacgctttatgcgcagc
| + | |
- | gataacctgacccgccatattaaaacccatcagaacaaaaaa
| + | |
- | >GNG-GA2|16|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=GA2E3169|Engineered construct|C2H2 (3F)|GTGGAGGGG
| + | |
- | gatccgggcaaaaaaaaacagcatatttgccatattcagggctgcggcaaagtgtatggc
| + | |
- | cgcagcgatcatctggcgcgccatctgcgctggcataccggcgaacgcccgtttatgtgc
| + | |
- | acctggagctattgcggcaaacgctttacccgcagcgataacctggcgcgccataaacgc
| + | |
- | acccataccggcgaaaaaaaatttgcgtgcccggaatgcccgaaacgctttatgcgcagc
| + | |
- | gatgcgctgacccgccatattaaaacccatcagaacaaaaaa
| + | |
- | >GNG-GA3|17|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=GA3E3170|Engineered construct|C2H2 (3F)|GGGGAGGGG
| + | |
- | gatccgggcaaaaaaaaacagcatatttgccatattcagggctgcggcaaagtgtatggc
| + | |
- | cgcagcgatcatctggcgcgccatctgcgctggcataccggcgaacgcccgtttatgtgc
| + | |
- | acctggagctattgcggcaaacgctttacccgcagcgataacctggcgcgccataaacgc
| + | |
- | acccataccggcgaaaaaaaatttgcgtgcccggaatgcccgaaacgctttatgcgcagc
| + | |
- | gatcatctgagccgccatattaaaacccatcagaacaaaaaa
| + | |
- | >GNG-GT3|18|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=GT3E3174|Engineered construct|C2H2 (3F)|GGGGTGGGG
| + | |
- | gatccgggcaaaaaaaaacagcatatttgccatattcagggctgcggcaaagtgtatggc
| + | |
- | cgcagcgatcatctggcgcgccatctgcgctggcataccggcgaacgcccgtttatgtgc
| + | |
- | acctggagctattgcggcaaacgctttacccgcagcgatgcgctgagccgccataaacgc
| + | |
- | acccataccggcgaaaaaaaatttgcgtgcccggaatgcccgaaacgctttatgcgcagc
| + | |
- | gatcatctgagccgccatattaaaacccatcagaacaaaaaa
| + | |
- | >GNG-GT2|19|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=GT2E3173|Engineered construct|C2H2 (3F)|GTGGTGGGG
| + | |
- | gatccgggcaaaaaaaaacagcatatttgccatattcagggctgcggcaaagtgtatggc
| + | |
- | cgcagcgatcatctggcgcgccatctgcgctggcataccggcgaacgcccgtttatgtgc
| + | |
- | acctggagctattgcggcaaacgctttacccgcagcgatgcgctgagccgccataaacgc
| + | |
- | acccataccggcgaaaaaaaatttgcgtgcccggaatgcccgaaacgctttatgcgcagc
| + | |
- | gatgcgctgacccgccatattaaaacccatcagaacaaaaaa
| + | |
- | >GNG-GT1|20|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=GT1E3172|Engineered construct|C2H2 (3F)|GAGGTGGGG
| + | |
- | gatccgggcaaaaaaaaacagcatatttgccatattcagggctgcggcaaagtgtatggc
| + | |
- | cgcagcgatcatctggcgcgccatctgcgctggcataccggcgaacgcccgtttatgtgc
| + | |
- | acctggagctattgcggcaaacgctttacccgcagcgatgcgctgagccgccataaacgc
| + | |
- | acccataccggcgaaaaaaaatttgcgtgcccggaatgcccgaaacgctttatgcgcagc
| + | |
- | gataacctgacccgccatattaaaacccatcagaacaaaaaa
| + | |
- | >GNG-GG4|21|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=GG4E4179|Engineered construct|C2H2 (3F)|GCGGGGGGG
| + | |
- | gatccgggcaaaaaaaaacagcatatttgccatattcagggctgcggcaaagtgtatggc
| + | |
- | cgcagcgatcatctggcgcgccatctgcgctggcataccggcgaacgcccgtttatgtgc
| + | |
- | acctggagctattgcggcaaacgctttacccgcagcgatcatctgacccgccataaacgc
| + | |
- | acccataccggcgaaaaaaaatttgcgtgcccggaatgcccgaaacgctttatgcgcagc
| + | |
- | gatgatctgacccgccatattaaaacccatcagaacaaaaaa
| + | |
- | >GNG-GA4|22|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=GA4E3171|Engineered construct|C2H2 (3F)|GCGGAGGGG
| + | |
- | gatccgggcaaaaaaaaacagcatatttgccatattcagggctgcggcaaagtgtatggc
| + | |
- | cgcagcgatcatctggcgcgccatctgcgctggcataccggcgaacgcccgtttatgtgc
| + | |
- | acctggagctattgcggcaaacgctttacccgcagcgataacctggcgcgccataaacgc
| + | |
- | acccataccggcgaaaaaaaatttgcgtgcccggaatgcccgaaacgctttatgcgcagc
| + | |
- | gatgatctgacccgccatattaaaacccatcagaacaaaaaa
| + | |
- | >GNG-GC1|23|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=GC1E3180|Engineered construct|C2H2 (3F)|GAGGCGGGG
| + | |
- | gatccgggcaaaaaaaaacagcatatttgccatattcagggctgcggcaaagtgtatggc
| + | |
- | cgcagcgatcatctggcgcgccatctgcgctggcataccggcgaacgcccgtttatgtgc
| + | |
- | acctggagctattgcggcaaacgctttacccgcagcgatgatctgcagcgccataaacgc
| + | |
- | acccataccggcgaaaaaaaatttgcgtgcccggaatgcccgaaacgctttatgcgcagc
| + | |
- | gataacctgacccgccatattaaaacccatcagaacaaaaaa
| + | |
- | >GNG-GG3|24|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=GG3E3178|Engineered construct|C2H2 (3F)|GGGGGGGGG
| + | |
- | gatccgggcaaaaaaaaacagcatatttgccatattcagggctgcggcaaagtgtatggc
| + | |
- | cgcagcgatcatctggcgcgccatctgcgctggcataccggcgaacgcccgtttatgtgc
| + | |
- | acctggagctattgcggcaaacgctttacccgcagcgatcatctgacccgccataaacgc
| + | |
- | acccataccggcgaaaaaaaatttgcgtgcccggaatgcccgaaacgctttatgcgcagc
| + | |
- | gatcatctgagccgccatattaaaacccatcagaacaaaaaa
| + | |
- | >GNG-GG2|25|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=GG2E3177|Engineered construct|C2H2 (3F)|GTGGGGGGG
| + | |
- | gatccgggcaaaaaaaaacagcatatttgccatattcagggctgcggcaaagtgtatggc
| + | |
- | cgcagcgatcatctggcgcgccatctgcgctggcataccggcgaacgcccgtttatgtgc
| + | |
- | acctggagctattgcggcaaacgctttacccgcagcgatcatctgacccgccataaacgc
| + | |
- | acccataccggcgaaaaaaaatttgcgtgcccggaatgcccgaaacgctttatgcgcagc
| + | |
- | gatgcgctgacccgccatattaaaacccatcagaacaaaaaa
| + | |
- | >GNG-GC2|26|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=GC2E3181|Engineered construct|C2H2 (3F)|GTGGCGGGG
| + | |
- | gatccgggcaaaaaaaaacagcatatttgccatattcagggctgcggcaaagtgtatggc
| + | |
- | cgcagcgatcatctggcgcgccatctgcgctggcataccggcgaacgcccgtttatgtgc
| + | |
- | acctggagctattgcggcaaacgctttacccgcagcgatgatctgcagcgccataaacgc
| + | |
- | acccataccggcgaaaaaaaatttgcgtgcccggaatgcccgaaacgctttatgcgcagc
| + | |
- | gatgcgctgacccgccatattaaaacccatcagaacaaaaaa
| + | |
- | >GNG-GC3|27|http://web.iitd.ac.in/~sundar/zifbase/prot_disp1.php?id=GC3E3182|Engineered construct|C2H2 (3F)|GGGGCGGGG
| + | |
- | gatccgggcaaaaaaaaacagcatatttgccatattcagggctgcggcaaagtgtatggc
| + | |
- | cgcagcgatcatctggcgcgccatctgcgctggcataccggcgaacgcccgtttatgtgc
| + | |
- | acctggagctattgcggcaaacgctttacccgcagcgatgatctgcagcgccataaacgc
| + | |
- | acccataccggcgaaaaaaaatttgcgtgcccggaatgcccgaaacgctttatgcgcagc
| + | |
- | gatcatctgagccgccatattaaaacccatcagaacaaaaaa'
| + | |
- | > | + | |
- | <div class="form-checkbox"> | + | |
- | <input type="checkbox" value="BBa_K086017:unmodified Lutz-Bujard LacO promoter:ttgtgagcggataacaagatactgagcaca" id="BBa_K086017" name="promoter" title="unmodified Lutz-Bujard LacO promoter"/>
| + | |
- | <label for="BBa_K086017">BBa_K086017</label>
| + | |
- | <input type="checkbox" value="BBa_K086018:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ24:ttgtgagcggataacaattctgaagaacaa" id="BBa_K086018" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ24"/>
| + | |
- | <label for="BBa_K086018">BBa_K086018</label>
| + | |
- | <input type="checkbox" value="BBa_K086019:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ24:ttgtgagcggataacaattctgataaaaca" id="BBa_K086019" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ24"/>
| + | |
- | <label for="BBa_K086019">BBa_K086019</label>
| + | |
- | <input type="checkbox" value="BBa_K086020:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ24 :ttgtgagcggataacatctaaccctttaga" id="BBa_K086020" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ24 "/>
| + | |
- | <label for="BBa_K086020">BBa_K086020</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_K086021:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ24 :ttgtgagcggataacatagcagataagaaa" id="BBa_K086021" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ24 "/>
| + | |
- | <label for="BBa_K086021">BBa_K086021</label>
| + | |
- | <input type="checkbox" value="BBa_K086022:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ28 :gtttgagcgagtaacgccgaaaatcttgca" id="BBa_K086022" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ28 "/>
| + | |
- | <label for="BBa_K086022">BBa_K086022</label>
| + | |
- | <input type="checkbox" value="BBa_K086023:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ28 :gtgtgagcgagtaacgacgaaaatcttgca" id="BBa_K086023" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ28 "/>
| + | |
- | <label for="BBa_K086023">BBa_K086023</label>
| + | |
- | <input type="checkbox" value="BBa_K086024:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ28 :tttgagcgagtaacagccgaaaatcttgca" id="BBa_K086024" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ28 "/>
| + | |
- | <label for="BBa_K086024">BBa_K086024</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_K086025:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ28 :tgtgagcgagtaacagccgaaaatcttgca" id="BBa_K086025" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ28 "/>
| + | |
- | <label for="BBa_K086025">BBa_K086025</label>
| + | |
- | <input type="checkbox" value="BBa_K086026:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 :ttgtgagcgagtggcaccattaagtacgta" id="BBa_K086026" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 "/>
| + | |
- | <label for="BBa_K086026">BBa_K086026</label>
| + | |
- | <input type="checkbox" value="BBa_K086027:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 :ttgtgagcgagtgacaccattaagtacgta" id="BBa_K086027" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 "/>
| + | |
- | <label for="BBa_K086027">BBa_K086027</label>
| + | |
- | <input type="checkbox" value="BBa_K086028:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 :ttgtgagcgagtaacaccattaagtacgta" id="BBa_K086028" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 "/>
| + | |
- | <label for="BBa_K086028">BBa_K086028</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_K086029:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 :ttgtgagcgagtaacaccattaagtacgta" id="BBa_K086029" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 "/>
| + | |
- | <label for="BBa_K086029">BBa_K086029</label>
| + | |
- | <input type="checkbox" value="BBa_K086030:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 :cagtgagcgagtaacaactacgctgtttta" id="BBa_K086030" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 "/>
| + | |
- | <label for="BBa_K086030">BBa_K086030</label>
| + | |
- | <input type="checkbox" value="BBa_K086031:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 :cagtgagcgagtaacaactacgctgtttta" id="BBa_K086031" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 "/>
| + | |
- | <label for="BBa_K086031">BBa_K086031</label>
| + | |
- | <input type="checkbox" value="BBa_K086032:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 :atgtgagcggataacactataattaataga" id="BBa_K086032" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 "/>
| + | |
- | <label for="BBa_K086032">BBa_K086032</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_K086033:modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 :atgtgagcggataacactataattaataga" id="BBa_K086033" name="promoter" title="modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 "/>
| + | |
- | <label for="BBa_K086033">BBa_K086033</label>
| + | |
- | </div>
| + | |
- | <br><div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_I712074:T7 promoter (strong promoter from T7 bacteriophage):agggaatacaagctacttgttctttttgca" id="BBa_I712074" name="promoter" title="T7 promoter (strong promoter from T7 bacteriophage)"/>
| + | |
- | <label for="BBa_I712074">BBa_I712074</label>
| + | |
- | <input type="checkbox" value="BBa_I719005:T7 Promoter:taatacgactcactatagggaga" id="BBa_I719005" name="promoter" title="T7 Promoter"/>
| + | |
- | <label for="BBa_I719005">BBa_I719005</label>
| + | |
- | <input type="checkbox" value="BBa_J34814:T7 Promoter:gaatttaatacgactcactatagggaga" id="BBa_J34814" name="promoter" title="T7 Promoter"/>
| + | |
- | <label for="BBa_J34814">BBa_J34814</label>
| + | |
- | <input type="checkbox" value="BBa_J64997:T7 consensus -10 and rest:taatacgactcactatagg" id="BBa_J64997" name="promoter" title="T7 consensus -10 and rest"/>
| + | |
- | <label for="BBa_J64997">BBa_J64997</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_J64998:consensus -10 and rest from SP6:atttaggtgacactataga" id="BBa_J64998" name="promoter" title="consensus -10 and rest from SP6"/>
| + | |
- | <label for="BBa_J64998">BBa_J64998</label>
| + | |
- | <input type="checkbox" value="BBa_K113010:overlapping T7 promoter:gagtcgtattaatacgactcactatagggg" id="BBa_K113010" name="promoter" title="overlapping T7 promoter"/>
| + | |
- | <label for="BBa_K113010">BBa_K113010</label>
| + | |
- | <input type="checkbox" value="BBa_K113011:more overlapping T7 promoter :agtgagtcgtactacgactcactatagggg" id="BBa_K113011" name="promoter" title="more overlapping T7 promoter "/>
| + | |
- | <label for="BBa_K113011">BBa_K113011</label>
| + | |
- | <input type="checkbox" value="BBa_K113012:weaken overlapping T7 promoter:gagtcgtattaatacgactctctatagggg" id="BBa_K113012" name="promoter" title="weaken overlapping T7 promoter"/>
| + | |
- | <label for="BBa_K113012">BBa_K113012</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_K525998:Promoter T7 and RBS:atacgactcactatagggaaagaggagaaa" id="BBa_K525998" name="promoter" title="Promoter T7 and RBS"/>
| + | |
- | <label for="BBa_K525998">BBa_K525998</label>
| + | |
- | <input type="checkbox" value="BBa_R0085:T7 Consensus Promoter Sequence:taatacgactcactatagggaga" id="BBa_R0085" name="promoter" title="T7 Consensus Promoter Sequence"/>
| + | |
- | <label for="BBa_R0085">BBa_R0085</label>
| + | |
- | <input type="checkbox" value="BBa_R0180:T7 RNAP promoter:ttatacgactcactatagggaga" id="BBa_R0180" name="promoter" title="T7 RNAP promoter"/>
| + | |
- | <label for="BBa_R0180">BBa_R0180</label>
| + | |
- | <input type="checkbox" value="BBa_R0181:T7 RNAP promoter:gaatacgactcactatagggaga" id="BBa_R0181" name="promoter" title="T7 RNAP promoter"/>
| + | |
- | <label for="BBa_R0181">BBa_R0181</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_R0182:T7 RNAP promoter:taatacgtctcactatagggaga" id="BBa_R0182" name="promoter" title="T7 RNAP promoter"/>
| + | |
- | <label for="BBa_R0182">BBa_R0182</label>
| + | |
- | <input type="checkbox" value="BBa_R0183:T7 RNAP promoter:tcatacgactcactatagggaga" id="BBa_R0183" name="promoter" title="T7 RNAP promoter"/>
| + | |
- | <label for="BBa_R0183">BBa_R0183</label>
| + | |
- | <input type="checkbox" value="BBa_R0184:T7 promoter (lacI repressible):ataggggaattgtgagcggataacaattcc" id="BBa_R0184" name="promoter" title="T7 promoter (lacI repressible)"/>
| + | |
- | <label for="BBa_R0184">BBa_R0184</label>
| + | |
- | <input type="checkbox" value="BBa_R0185:T7 promoter (lacI repressible):ataggggaattgtgagcggataacaattcc" id="BBa_R0185" name="promoter" title="T7 promoter (lacI repressible)"/>
| + | |
- | <label for="BBa_R0185">BBa_R0185</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_R0186:T7 promoter (lacI repressible):ataggggaattgtgagcggataacaattcc" id="BBa_R0186" name="promoter" title="T7 promoter (lacI repressible)"/>
| + | |
- | <label for="BBa_R0186">BBa_R0186</label>
| + | |
- | <input type="checkbox" value="BBa_R0187:T7 promoter (lacI repressible):ataggggaattgtgagcggataacaattcc" id="BBa_R0187" name="promoter" title="T7 promoter (lacI repressible)"/>
| + | |
- | <label for="BBa_R0187">BBa_R0187</label>
| + | |
- | <input type="checkbox" value="BBa_Z0251:T7 strong promoter:taatacgactcactatagggagaccacaac" id="BBa_Z0251" name="promoter" title="T7 strong promoter"/>
| + | |
- | <label for="BBa_Z0251">BBa_Z0251</label>
| + | |
- | <input type="checkbox" value="BBa_Z0252:T7 weak binding and processivity:taattgaactcactaaagggagaccacagc" id="BBa_Z0252" name="promoter" title="T7 weak binding and processivity"/>
| + | |
- | <label for="BBa_Z0252">BBa_Z0252</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_Z0253:T7 weak binding promoter:cgaagtaatacgactcactattagggaaga" id="BBa_Z0253" name="promoter" title="T7 weak binding promoter"/>
| + | |
- | <label for="BBa_Z0253">BBa_Z0253</label>
| + | |
- | </div>
| + | |
- | <br><div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_I721001:Lead Promoter:gaaaaccttgtcaatgaagagcgatctatg" id="BBa_I721001" name="promoter" title="Lead Promoter"/>
| + | |
- | <label for="BBa_I721001">BBa_I721001</label>
| + | |
- | <input type="checkbox" value="BBa_I731004:FecA promoter:ttctcgttcgactcatagctgaacacaaca" id="BBa_I731004" name="promoter" title="FecA promoter"/>
| + | |
- | <label for="BBa_I731004">BBa_I731004</label>
| + | |
- | <input type="checkbox" value="BBa_I760005:Cu-sensitive promoter:atgacaaaattgtcat" id="BBa_I760005" name="promoter" title="Cu-sensitive promoter"/>
| + | |
- | <label for="BBa_I760005">BBa_I760005</label>
| + | |
- | <input type="checkbox" value="BBa_I765000:Fe promoter:accaatgctgggaacggccagggcacctaa" id="BBa_I765000" name="promoter" title="Fe promoter"/>
| + | |
- | <label for="BBa_I765000">BBa_I765000</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_I765007:Fe and UV promoters:ctgaaagcgcataccgctatggagggggtt" id="BBa_I765007" name="promoter" title="Fe and UV promoters"/>
| + | |
- | <label for="BBa_I765007">BBa_I765007</label>
| + | |
- | <input type="checkbox" value="BBa_J3902:PrFe (PI + PII rus operon) :tagatatgcctgaaagcgcataccgctatg" id="BBa_J3902" name="promoter" title="PrFe (PI + PII rus operon) "/>
| + | |
- | <label for="BBa_J3902">BBa_J3902</label>
| + | |
- | </div>
| + | |
- | <br><div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_I1051:Lux cassette right promoter:tgttatagtcgaatacctctggcggtgata" id="BBa_I1051" name="promoter" title="Lux cassette right promoter"/>
| + | |
- | <label for="BBa_I1051">BBa_I1051</label>
| + | |
- | <input type="checkbox" value="BBa_I14015:P(Las) TetO:ttttggtacactccctatcagtgatagaga" id="BBa_I14015" name="promoter" title="P(Las) TetO"/>
| + | |
- | <label for="BBa_I14015">BBa_I14015</label>
| + | |
- | <input type="checkbox" value="BBa_I14016:P(Las) CIO:ctttttggtacactacctctggcggtgata" id="BBa_I14016" name="promoter" title="P(Las) CIO"/>
| + | |
- | <label for="BBa_I14016">BBa_I14016</label>
| + | |
- | <input type="checkbox" value="BBa_I14017:P(Rhl):tacgcaagaaaatggtttgttatagtcgaa" id="BBa_I14017" name="promoter" title="P(Rhl)"/>
| + | |
- | <label for="BBa_I14017">BBa_I14017</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_I739105:Double Promoter (LuxR/HSL, positive / cI, negative):cgtgcgtgttgataacaccgtgcgtgttga" id="BBa_I739105" name="promoter" title="Double Promoter (LuxR/HSL, positive / cI, negative)"/>
| + | |
- | <label for="BBa_I739105">BBa_I739105</label>
| + | |
- | <input type="checkbox" value="BBa_I746104:P2 promoter in agr operon from S. aureus:agattgtactaaatcgtataatgacagtga" id="BBa_I746104" name="promoter" title="P2 promoter in agr operon from S. aureus"/>
| + | |
- | <label for="BBa_I746104">BBa_I746104</label>
| + | |
- | <input type="checkbox" value="BBa_I751501:plux-cI hybrid promoter:gtgttgatgcttttatcaccgccagtggta" id="BBa_I751501" name="promoter" title="plux-cI hybrid promoter"/>
| + | |
- | <label for="BBa_I751501">BBa_I751501</label>
| + | |
- | <input type="checkbox" value="BBa_I751502:plux-lac hybrid promoter:agtgtgtggaattgtgagcggataacaatt" id="BBa_I751502" name="promoter" title="plux-lac hybrid promoter"/>
| + | |
- | <label for="BBa_I751502">BBa_I751502</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_I761011:CinR, CinL and glucose controlled promotor:acatcttaaaagttttagtatcatattcgt" id="BBa_I761011" name="promoter" title="CinR, CinL and glucose controlled promotor"/>
| + | |
- | <label for="BBa_I761011">BBa_I761011</label>
| + | |
- | <input type="checkbox" value="BBa_J06403:RhIR promoter repressible by CI:tacgcaagaaaatggtttgttatagtcgaa" id="BBa_J06403" name="promoter" title="RhIR promoter repressible by CI"/>
| + | |
- | <label for="BBa_J06403">BBa_J06403</label>
| + | |
- | <input type="checkbox" value="BBa_J102001:Reverse Lux Promoter:tcttgcgtaaacctgtacgatcctacaggt" id="BBa_J102001" name="promoter" title="Reverse Lux Promoter"/>
| + | |
- | <label for="BBa_J102001">BBa_J102001</label>
| + | |
- | <input type="checkbox" value="BBa_J64000:rhlI promoter:atcctcctttagtcttccccctcatgtgtg" id="BBa_J64000" name="promoter" title="rhlI promoter"/>
| + | |
- | <label for="BBa_J64000">BBa_J64000</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_J64010:lasI promoter:taaaattatgaaatttgcataaattcttca" id="BBa_J64010" name="promoter" title="lasI promoter"/>
| + | |
- | <label for="BBa_J64010">BBa_J64010</label>
| + | |
- | <input type="checkbox" value="BBa_J64067:LuxR+3OC6HSL independent R0065:gtgttgactattttacctctggcggtgata" id="BBa_J64067" name="promoter" title="LuxR+3OC6HSL independent R0065"/>
| + | |
- | <label for="BBa_J64067">BBa_J64067</label>
| + | |
- | <input type="checkbox" value="BBa_J64712:LasR/LasI Inducible & RHLR/RHLI repressible Promoter:gaaatctggcagtttttggtacacgaaagc" id="BBa_J64712" name="promoter" title="LasR/LasI Inducible & RHLR/RHLI repressible Promoter"/>
| + | |
- | <label for="BBa_J64712">BBa_J64712</label>
| + | |
- | <input type="checkbox" value="BBa_K091107:pLux/cI Hybrid Promoter:acaccgtgcgtgttgatatagtcgaataaa" id="BBa_K091107" name="promoter" title="pLux/cI Hybrid Promoter"/>
| + | |
- | <label for="BBa_K091107">BBa_K091107</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_K091117:pLas promoter:aaaattatgaaatttgtataaattcttcag" id="BBa_K091117" name="promoter" title="pLas promoter"/>
| + | |
- | <label for="BBa_K091117">BBa_K091117</label>
| + | |
- | <input type="checkbox" value="BBa_K091143:pLas/cI Hybrid Promoter:ggttctttttggtacctctggcggtgataa" id="BBa_K091143" name="promoter" title="pLas/cI Hybrid Promoter"/>
| + | |
- | <label for="BBa_K091143">BBa_K091143</label>
| + | |
- | <input type="checkbox" value="BBa_K091146:pLas/Lux Hybrid Promoter:tgtaggatcgtacaggtataaattcttcag" id="BBa_K091146" name="promoter" title="pLas/Lux Hybrid Promoter"/>
| + | |
- | <label for="BBa_K091146">BBa_K091146</label>
| + | |
- | <input type="checkbox" value="BBa_K091156:pLux:caagaaaatggtttgttatagtcgaataaa" id="BBa_K091156" name="promoter" title="pLux"/>
| + | |
- | <label for="BBa_K091156">BBa_K091156</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_K091157:pLux/Las Hybrid Promoter:ctatctcatttgctagtatagtcgaataaa" id="BBa_K091157" name="promoter" title="pLux/Las Hybrid Promoter"/>
| + | |
- | <label for="BBa_K091157">BBa_K091157</label>
| + | |
- | <input type="checkbox" value="BBa_K145150:Hybrid promoter: HSL-LuxR activated, P22 C2 repressed:tagtttataatttaagtgttctttaatttc" id="BBa_K145150" name="promoter" title="Hybrid promoter: HSL-LuxR activated, P22 C2 repressed"/>
| + | |
- | <label for="BBa_K145150">BBa_K145150</label>
| + | |
- | <input type="checkbox" value="BBa_K266000:PAI+LasR -:caccttcgggtgggcctttctgcgtttata" id="BBa_K266000" name="promoter" title="PAI+LasR -"/>
| + | |
- | <label for="BBa_K266000">BBa_K266000</label>
| + | |
- | <input type="checkbox" value="BBa_K266005:PAI+LasR -:aataactctgatagtgctagtgtagatctc" id="BBa_K266005" name="promoter" title="PAI+LasR -"/>
| + | |
- | <label for="BBa_K266005">BBa_K266005</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_K266006:PAI+LasR -:caccttcgggtgggcctttctgcgtttata" id="BBa_K266006" name="promoter" title="PAI+LasR -"/>
| + | |
- | <label for="BBa_K266006">BBa_K266006</label>
| + | |
- | <input type="checkbox" value="BBa_K266007:Complex QS -:caccttcgggtgggcctttctgcgtttata" id="BBa_K266007" name="promoter" title="Complex QS -"/>
| + | |
- | <label for="BBa_K266007">BBa_K266007</label>
| + | |
- | <input type="checkbox" value="BBa_K658006:position 3 mutated promoter lux pR-3 (luxR & HSL regulated):caagaaaatggtttgttatagtcgaataaa" id="BBa_K658006" name="promoter" title="position 3 mutated promoter lux pR-3 (luxR & HSL regulated)"/>
| + | |
- | <label for="BBa_K658006">BBa_K658006</label>
| + | |
- | <input type="checkbox" value="BBa_K658007:position 5 mutated promoter lux pR-5 (luxR & HSL regulated) :caagaaaatggtttgttatagtcgaataaa" id="BBa_K658007" name="promoter" title="position 5 mutated promoter lux pR-5 (luxR & HSL regulated) "/>
| + | |
- | <label for="BBa_K658007">BBa_K658007</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_K658008:position 3&5 mutated promoter lux pR-3/5 (luxR & HSL regulated):caagaaaatggtttgttatagtcgaataaa" id="BBa_K658008" name="promoter" title="position 3&5 mutated promoter lux pR-3/5 (luxR & HSL regulated)"/>
| + | |
- | <label for="BBa_K658008">BBa_K658008</label>
| + | |
- | <input type="checkbox" value="BBa_R0061:Promoter (HSL-mediated luxR repressor):ttgacacctgtaggatcgtacaggtataat" id="BBa_R0061" name="promoter" title="Promoter (HSL-mediated luxR repressor)"/>
| + | |
- | <label for="BBa_R0061">BBa_R0061</label>
| + | |
- | <input type="checkbox" value="BBa_R0062:Promoter (luxR & HSL regulated -- lux pR):caagaaaatggtttgttatagtcgaataaa" id="BBa_R0062" name="promoter" title="Promoter (luxR & HSL regulated -- lux pR)"/>
| + | |
- | <label for="BBa_R0062">BBa_R0062</label>
| + | |
- | <input type="checkbox" value="BBa_R0063:Promoter (luxR & HSL regulated -- lux pL):cacgcaaaacttgcgacaaacaataggtaa" id="BBa_R0063" name="promoter" title="Promoter (luxR & HSL regulated -- lux pL)"/>
| + | |
- | <label for="BBa_R0063">BBa_R0063</label>
| + | |
- | </div>
| + | |
- | <div class="form-checkbox">
| + | |
- | <input type="checkbox" value="BBa_R0071:Promoter (RhlR & C4-HSL regulated):gttagctttcgaattggctaaaaagtgttc" id="BBa_R0071" name="promoter" title="Promoter (RhlR & C4-HSL regulated)"/>
| + | |
- | <label for="BBa_R0071">BBa_R0071</label>
| + | |
- | <input type="checkbox" value="BBa_R0078:Promoter (cinR and HSL regulated):ccattctgctttccacgaacttgaaaacgc" id="BBa_R0078" name="promoter" title="Promoter (cinR and HSL regulated)"/>
| + | |
- | <label for="BBa_R0078">BBa_R0078</label>
| + | |
- | <input type="checkbox" value="BBa_R0079:Promoter (LasR & PAI regulated):ggccgcgggttctttttggtacacgaaagc" id="BBa_R0079" name="promoter" title="Promoter (LasR & PAI regulated)"/>
| + | |
- | <label for="BBa_R0079">BBa_R0079</label>
| + | |
- | <input type="checkbox" value="BBa_R1062:Promoter, Standard (luxR and HSL regulated -- lux pR):aagaaaatggtttgttgatactcgaataaa" id="BBa_R1062" name="promoter" title="Promoter, Standard (luxR and HSL regulated -- lux pR)"/>
| + | |
- | <label for="BBa_R1062">BBa_R1062</label>
| + | |
- | </div>
| + | |
- | <br>
| + | |
- | <br>
| + | |
- | <br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br>
| + | |
- | <input type=BUTTON value="Submit" name="mySubmit" onClick="setup()"></form>
| + | |
- | </p>
| + | |
- | <div id="visualizationButtons"></div>
| + | |
- | <div id="readout"></div>
| + | |
- | <div id="infovis"></div>
| + | |
- | <div id="inner-details"></div>
| + | |
- | </body>
| + | |
| </html> | | </html> |
| + | {{Team:Amsterdam/Foot}} |