Team:TU Munich/Project/Constitutive Promoter

From 2012.igem.org

(Difference between revisions)
(Constitutive Promoters)
 
(58 intermediate revisions not shown)
Line 1: Line 1:
{{Team:TU_Munich/Header}}
{{Team:TU_Munich/Header}}
 +
{{Team:TU_Munich/ExCol}}
= Constitutive Promoters =
= Constitutive Promoters =
 +
----
-
==Background and principles==
+
[[File:Georg_einzel_TUM12.jpg|200px|thumb||Responsible: Georg Schützinger]]
 +
To control expression of the enzymes and proteins from our biosynthetic pathways a '''variety of promoters is essential'''. Since gyle from beer is a complex medium, the controlled induction of protein expression proves to be a '''difficult task.'''
 +
Therefore '''constitutive promoters''' are the ideal solution for that problem. They offer '''simplicity''', and therefore are the first choice for the introduction of '''new biosynthetic pathways''' in yeast in complex media.
-
Georg
+
In order to finetune biosynthetic pathways with two or more enzymes, as in our with caffeine pathway, we want to use 3 constitutive promoters '''ADH1''', '''TEF1''' and '''TEF2''' to account for the turnover rates of the different enzymes.
-
Jie Sun et al. describes 14 constitutive promoters from Saccharomyces cerevisiae, and its reaction at different culture conditions, oxy(-)/glu(+),oxy(+)/glu(+). 2 Where described as higher strength promoters TEF1p, TPI1p, and 7 as medium strenth pr. GPM1p, GPDp (TDH3p), FBA1p, PDC1p, ENO2p, PYK1p, and TEF2p. With exception to the strongest TEF1p all exhibit nearly the same expression values with varying oxygen conditions. TEF1p was also tested for small glucose concentrations showed 100% expression levels with oxygen limitation and 70 % without oxygenlimitation after 80 hours of cell cultivation.
+
Their strength, and constant expression have been characterized by [[http://http://www.ncbi.nlm.nih.gov/pubmed?term=partow%202010 Partow et al., 2010], [http://http://www.ncbi.nlm.nih.gov/pubmed/22383307 Sun J. et al., 2012]] and many more.  
 +
For illustration of their difference in strength TEF1-P and ADH1-P were cloned in front of Renilla Luciferase  [http://partsregistry.org/Part:BBa_J52008 BBa_J52008] in pTUM100 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K801001 BBa_K801001]
 +
and bioluminescence will be measured. The same experiment shall soon be also made with TEF2-P.
-
[[File:Geclonte_promoter.jpg]]
+
==Background and principles==
 +
----
 +
The promoter '''ADH1''' is one of the most widely used constitutive promoters, for protein expression in yeast. It naturally controls the expression of '''Alcohol Dehydrogenase 1''' of ''Saccharomyces Cerevisiae''. This enzyme is part of the 
 +
'''yeast glycolytic pathway''' and is needed for the fermentation of glucose into alcohol.
 +
For that reason its natural form (1500 bp) is inhibited by ethanol. To avoid this problem, we used a shortened version (720 bp) [http://partsregistry.org/wiki/index.php?title=Part:BBa_K319005 BBa_K319005] that was successfully engineered and tested by [[http://http://www.ncbi.nlm.nih.gov/pubmed/7766401 Ruohonen et al., 1995]] and that is not susceptible to ethanol repression, thus providing '''constant expression''' throughout the brewing process.
-
A.Blount et al. states that repeated use of the same biological parts is not possible since the cells recombine long stretches of homologous DNA
+
The promoter '''TEF1''' controls the expression of '''translation elongation factor EF1 alpha'''. The most important characteristics of this promoter for brewing is his '''high expression strength''' that is 5x above ADH1-P, and its insensitivity to repression by ethanol which often occurs with constitutive promoters from the '''yeast glycolytic pathway''' [[http://http://www.ncbi.nlm.nih.gov/pubmed?term=partow%202010 Partow et al., 2010]]. During the brewing process expression even becomes stronger due a slight repression by Glucose at the beginning.
-
Siavash Partow et al. compares several constitutive Promoters during varying Glucose concentrations [[Media:Tum12Promoterstärken.pdf]], TEF1, HXT7,PGK1 are shown to be the most suitable ones. They also show the fusion of two promoters for bidirectional control of
+
The promoter '''TEF2''' controls the expression of a second gene for translation elongation factor EF1 alpha. Since TEF2 protein alone can keep mutants, lacking TEF1, growing, it is believed that it is an identical of nearly identical version of TEF1 protein [[http://http://www.ncbi.nlm.nih.gov/pubmed?term=TEF1%201984 Schiermaier et al., 1984]].
-
two genes namely TEF1 and PGK1 with comparable activity in both states [[Media:Tum12Promoterfusion.pdf]], two constructs were successfully used pSP-G1-Vector and pSP-G2.
+
-
 
+
-
.
+
-
[[Media:Tum12Fusionspromoter_Vector.pdf]]
+
-
 
+
-
Elke Nevoigt et al. generated a library of TEF1 promotermutants for finetuning of Expression [[Media:Tum12 TEF-Promoter-mutants.pdf]]
+
-
 
+
-
==Idea==
+
==General remarks and issues==
==General remarks and issues==
 +
----
 +
[[File:Promoter strenghts .png|300px|thumb|right|Original image taken from <html>[<a href="http://http://www.ncbi.nlm.nih.gov/pubmed/22383307">Sun J. et al., 2012</a>]</html>. Comparison of promoter strength with GFP, cloned promoters are marked by arrows]]
 +
For '''comparison of the promoter strength''' 3 timepoints were chosen. After '''12''' hours, after '''24''' hours and '''48''' hours. This way differences in activity due to varying Ethanol- and glucose concentrations can be analyzed.
 +
This would be the more interesting since the influence of these substances on the activity of TEF2-Promoter has not been analyzed this far.
 +
If you set the activity of TEF1-Promoter for 100%, the activity of ADH1-P should be roughly 20% and keep constant. TEF1-Promoter should reach 150 % during the later  The activity of TEF2-P activity should be 40% at the beginning.
-
TEF1p guarantues relative strong expression values under varying conditions as it is the case for brewing.
+
<div style="clear:both">
-
 
+
=== Gel picture of finished Constructs ===
-
==Biobricks and sequences==
+
</div>
-
 
+
[[File:20120918_ADH1-P_und_P791.png]]   
-
TEF1 sequence : from Promoter Database for Sacharomyces cerevisiae SCPD :(http://rulai.cshl.edu/cgi-bin/SCPD/getgenelist)
+
-
+
* Analytical digestion of ADH1-P with luciferase in pTUM100
-
      RAP1
+
-
          GCCGTACCACTTCAAAACACCCAAGCACAGCATACTAAATTTCCCCTCTT -301
+
-
         
+
-
          TCTTCCTCTAGGGTGTCGTTAATTACCCGTACTAAAGGTTTGGAAAAGAA -251
+
-
         
+
-
          AAAAGAGACCGCCTCGTTTCTTTTTCTTCGTCGAAAAAGGCAATAAAAAT -201
+
-
         
+
-
          TTTTATCACGTTTCTTTTTCTTGAAAATTTTTTTTTTTGATTTTTTTCTC -151
+
-
         
+
-
          TTTCGATGACCTCCCATTGATATTTAAGTTAATAAACGGTCTTCAATTTC -101
+
-
         
+
-
          TCAAGTTTCAGTTTCATTTTTCTTGTTCTATTACAACTTTTTTTACTTCT -51
+
-
         
+
-
          TGCTCATTAGAAAGAAAGCATAGCAATCTAATCTAAGTTTTAATTACAAA
+
-
TPI1 Promotorsequenz
+
[[File:20120918_TEF1-P_und_P791.png]]
-
                CTACTTATTCCCTTCGAGATTATATCTAGGAACCCATCAGGTTGGTGGAA -401
+
* Analytical digestion of TEF1-P with luciferase in pTUM100
-
                                  GCR1            RAP1   
+
-
          GATTACCCGTTCTAAGACTTTTCAGCTTCCTCTATTGATGTTACACCTGG -351
+
-
          RAP1          GCR1                             
+
-
          ACACCCCTTTTCTGGCATCCAGTTTTTAATCTTCAGTGGCATGTGAGATT -301
+
-
                                                           
+
-
          CTCCGAAATTAATTAAAGCAATCACACAATTCTCTCGGATACCACCTCGG -251
+
-
                                                           
+
-
          TTGAAACTGACAGGTGGTTTGTTACGCATGCTAATGCAAAGGAGCCTATA -201
+
-
                                                           
+
-
          TACCTTTGGCTCGGCTGCTGTAACAGGGAATATAAAGGGCAGCATAATTT -151
+
-
                                                           
+
-
          AGGAGTTTAGTGAACTTGCAACATTTACTATTTTCCCTTCTTACGTAAAT -101
+
-
                                                           
+
-
          ATTTTTCTTTTTAATTCTAAATCAATCTTTTTCAATTTTTTGTTTGTATT -51
+
-
                                                           
+
-
          CTTTTCTTGCTTAAATCTATAACTACAAAAAACACATACATAAACTAAAA -1
+
-
PGK1-Promoter
+
=== Biobricks ===
-
                CGATTTGGGCGCGAATCCTTTATTTTGGCTTCACCCTCATACTATTATCA -601
+
[http://partsregistry.org/wiki/index.php?title=Part:BBa_K801001 BBa_K801001] pTUM101 yeast shuttle vector with pTEF1 promoter
-
                                                REB1    ABF1
+
-
          GGGCCAGAAAAAGGAAGTGTTTCCCTCCTTCTTGAATTGATGTTACCCTC -551
+
-
                                      ABF1
+
-
          ATAAAGCACGTGGCCTCTTATCGAGAAAGAAATTACCGTCGCTCGTGATT -501
+
-
                                      RAP1          GCR1
+
-
          TGTTTGCAAAAAGAACAAAACTGAAAAAACCCAGACACGCTCGACTTCCT -451
+
-
         
+
-
          GTCTTCCTATTGATTGCAGCTTCCAATTTCGTCACACAACAAGGTCCTAG -401
+
-
         
+
-
          CGACGGCTCACAGGTTTTGTAACAAGCAATCGAAGGTTCTGGAATGGCGG -351
+
-
         
+
-
          GAAAGGGTTTAGTACCACATGCTATGATGCCCACTGTGATCTCCAGAGCA -301
+
-
         
+
-
          AAGTTCGTTCGATCGTACTGTTACTCTCTCTCTTTCAAACAGAATTGTCC -251
+
-
         
+
-
          GAATCGTGTGACAACAACAGCCTGTTCTCACACACTCTTTTCTTCTAACC -201
+
-
         
+
-
          AAGGGGGTGGTTTAGTTTAGTAGAACCTCGTGAAACTTACATTTACATAT -151
+
-
         
+
-
          ATATAAACTTGCATAAATTGGTCAATGCAAGAAATACATATTTGGTCTTT -101
+
-
         
+
-
          TCTAATTCGTAGTTTTTCAAGTTCTTAGATGCTTTCTTTTTCTCTTTTTT -51
+
-
         
+
-
          ACAGATCATCAAGGAAGTAATTATCTACTTTTTACAACAAATATAAAACA -1
+
-
For Yeast genes there is also another database calles yeast promoter atlas, the sequences however differ from the first one (http://ypa.ee.ncku.edu.tw/)
+
[http://partsregistry.org/wiki/index.php?title=Part:BBa_K801002 BBa_K801002] pTUM102 yeast shuttle vector with pTEF2 promoter
-
Here the sequences from YPA [[Media:Tum12Promotersequenzen.pdf‎]], [[Media:Tum12 Promoterliste.pdf]]
+
-
+
[http://partsregistry.org/wiki/index.php?title=Part:BBa_K801003 BBa_K801003] pTUM103 yeast shuttle vector with pADH1 promoter
-
== Vectorsystems for Yeast ==
+
-
A common commercial Vector system for Yeast transformation is the pESC lineage from Stratagene
+
[http://partsregistry.org/wiki/index.php?title=Part:BBa_K801010 BBa_K801010] TEF2 constitutive yeast promoter
-
a broad range of Protocols for yeast transformation and for the making of competent cells can be found on [http://www.protocol-online.org/prot/Model_Organisms/Yeast/Yeast_Transformation/index.html] from several laboratories that work with yeast.
+
[http://partsregistry.org/wiki/index.php?title=Part:BBa_K801011 BBa_K801011] TEF1 yeast terminator
-
Plasmids from Publications as well as from companies can be viewed at[http://www.addgene.org/] and can also be ordered there, as far as I could see they are far less expensive than those from companies.
+
[http://partsregistry.org/wiki/index.php?title=Part:BBa_K801012 BBa_K801012] ADH1 yeast terminator
==References==
==References==
 +
----
 +
*[[http://http://www.ncbi.nlm.nih.gov/pubmed/22129153 Da Silva et al., 2012]] Da Silva, Nancy A.; Srikrishnan, Sneha (2012): Introduction and expression of genes for metabolic engineering applications in Saccharomyces cerevisiae. ''FEMS Yeast Res.'' 12 (2), P. 197–214.
-
[[Media:Tum12_Characterization_of_different_promoters_for_designing_a_new_expression_vector_in_Saccharomyces_cerevisiae.pdf‎]]
+
*[[http://http://www.ncbi.nlm.nih.gov/pubmed/22383307 Sun J. et al., 2012]] Sun, Jie; Shao, Zengyi; Zhao, Hua; Nair, Nikhil; Wen, Fei; Xu, Jian-He; Zhao, Huimin (2012): Cloning and characterization of a panel of constitutive promoters for applications in pathway engineering in Saccharomyces cerevisiae. ''Biotechnol. Bioeng.'' 109 (8), P. 2082–2092.
-
[[Media:Tum12_Rational_Diversification_of_a_Promoter_Providing_Fine-_Tuned_Expression_and_Orthogonal_Regulation_for_Synthetic_Biology.pdf‎ ]]
+
*[[http://http://www.ncbi.nlm.nih.gov/pubmed?term=partow%202010 Partow et al., 2010]] Partow, Siavash; Siewers, Verena; Bjørn, Sara; Nielsen, Jens; Maury, Jérôme (2010): Characterization of different promoters for designing a new expression vector in Saccharomyces cerevisiae. ''Yeast 27'' (11), P. 955–964.
-
[[Media:Tum12 Cloning and Characterization of a Panel of Constitutive Promoters for Applications in Pathway Engineering in Saccharomyces cerevisiae.pdf]]
+
*[[http://http://www.ncbi.nlm.nih.gov/pubmed?term=TEF1%201984 Schiermaier et al., 1984]] Schirmaier, F.; Philippsen, P. (1984): Identification of two genes coding for the translation elongation factor EF-1 alpha of S. cerevisiae. ''EMBO J.'' 3 (13), P. 3311–3315.
-
[[Media:Tum12_Engineering_of_Promoter_Replacement_Cassettes_for_Fine-Tuning_of_Gene_Expression_in_Saccharomyces_cerevisiae.pdf‎ ]]
+
*[[http://http://www.ncbi.nlm.nih.gov/pubmed/7766401 Ruohonen et al., 1995]] Ruohonen, L.; Aalto, M. K.; Keränen, S. (1995): Modifications to the ADH1 promoter of Saccharomyces cerevisiae for efficient production of heterologous proteins. ''J. Biotechnol.'' 39 (3), S. 193–203.

Latest revision as of 01:37, 27 September 2012


Contents

Constitutive Promoters


Responsible: Georg Schützinger

To control expression of the enzymes and proteins from our biosynthetic pathways a variety of promoters is essential. Since gyle from beer is a complex medium, the controlled induction of protein expression proves to be a difficult task. Therefore constitutive promoters are the ideal solution for that problem. They offer simplicity, and therefore are the first choice for the introduction of new biosynthetic pathways in yeast in complex media.

In order to finetune biosynthetic pathways with two or more enzymes, as in our with caffeine pathway, we want to use 3 constitutive promoters ADH1, TEF1 and TEF2 to account for the turnover rates of the different enzymes.

Their strength, and constant expression have been characterized by [[http://http://www.ncbi.nlm.nih.gov/pubmed?term=partow%202010 Partow et al., 2010], [http://http://www.ncbi.nlm.nih.gov/pubmed/22383307 Sun J. et al., 2012]] and many more. For illustration of their difference in strength TEF1-P and ADH1-P were cloned in front of Renilla Luciferase [http://partsregistry.org/Part:BBa_J52008 BBa_J52008] in pTUM100 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K801001 BBa_K801001] and bioluminescence will be measured. The same experiment shall soon be also made with TEF2-P.

Background and principles


The promoter ADH1 is one of the most widely used constitutive promoters, for protein expression in yeast. It naturally controls the expression of Alcohol Dehydrogenase 1 of Saccharomyces Cerevisiae. This enzyme is part of the yeast glycolytic pathway and is needed for the fermentation of glucose into alcohol. For that reason its natural form (1500 bp) is inhibited by ethanol. To avoid this problem, we used a shortened version (720 bp) [http://partsregistry.org/wiki/index.php?title=Part:BBa_K319005 BBa_K319005] that was successfully engineered and tested by http://http://www.ncbi.nlm.nih.gov/pubmed/7766401 Ruohonen et al., 1995 and that is not susceptible to ethanol repression, thus providing constant expression throughout the brewing process.

The promoter TEF1 controls the expression of translation elongation factor EF1 alpha. The most important characteristics of this promoter for brewing is his high expression strength that is 5x above ADH1-P, and its insensitivity to repression by ethanol which often occurs with constitutive promoters from the yeast glycolytic pathway http://http://www.ncbi.nlm.nih.gov/pubmed?term=partow 2010 Partow et al., 2010. During the brewing process expression even becomes stronger due a slight repression by Glucose at the beginning.

The promoter TEF2 controls the expression of a second gene for translation elongation factor EF1 alpha. Since TEF2 protein alone can keep mutants, lacking TEF1, growing, it is believed that it is an identical of nearly identical version of TEF1 protein http://http://www.ncbi.nlm.nih.gov/pubmed?term=TEF1 1984 Schiermaier et al., 1984.

General remarks and issues


Original image taken from [Sun J. et al., 2012]. Comparison of promoter strength with GFP, cloned promoters are marked by arrows

For comparison of the promoter strength 3 timepoints were chosen. After 12 hours, after 24 hours and 48 hours. This way differences in activity due to varying Ethanol- and glucose concentrations can be analyzed. This would be the more interesting since the influence of these substances on the activity of TEF2-Promoter has not been analyzed this far. If you set the activity of TEF1-Promoter for 100%, the activity of ADH1-P should be roughly 20% and keep constant. TEF1-Promoter should reach 150 % during the later The activity of TEF2-P activity should be 40% at the beginning.

Gel picture of finished Constructs

20120918 ADH1-P und P791.png

  • Analytical digestion of ADH1-P with luciferase in pTUM100

20120918 TEF1-P und P791.png

  • Analytical digestion of TEF1-P with luciferase in pTUM100

Biobricks

[http://partsregistry.org/wiki/index.php?title=Part:BBa_K801001 BBa_K801001] pTUM101 yeast shuttle vector with pTEF1 promoter

[http://partsregistry.org/wiki/index.php?title=Part:BBa_K801002 BBa_K801002] pTUM102 yeast shuttle vector with pTEF2 promoter

[http://partsregistry.org/wiki/index.php?title=Part:BBa_K801003 BBa_K801003] pTUM103 yeast shuttle vector with pADH1 promoter

[http://partsregistry.org/wiki/index.php?title=Part:BBa_K801010 BBa_K801010] TEF2 constitutive yeast promoter

[http://partsregistry.org/wiki/index.php?title=Part:BBa_K801011 BBa_K801011] TEF1 yeast terminator

[http://partsregistry.org/wiki/index.php?title=Part:BBa_K801012 BBa_K801012] ADH1 yeast terminator

References