Team:NTNU Trondheim/Notebook

From 2012.igem.org

(Difference between revisions)
(→Sunday 22.07.12)
 
(113 intermediate revisions not shown)
Line 1: Line 1:
{{:Team:NTNU_Trondheim/Templates/Header}}
{{:Team:NTNU_Trondheim/Templates/Header}}
 +
<html>
 +
<div class="container">
 +
<div class="page-header-top">
 +
<h1>Notebook <small>Unfiltered notes from the lab</small></h1>
 +
</div>
 +
</div>
 +
 +
<div class="container main-container">
 +
 +
 +
<div class="row">
 +
<div class="span10 offset1">
 +
</html>
__NOTOC__
__NOTOC__
-
=Notebook=
 
 +
<html><div class="well well-small"></html>
{{:Team:NTNU_Trondheim/Templates/Calendar}}
{{:Team:NTNU_Trondheim/Templates/Calendar}}
 +
<html></div>
-
For information on plasmids and DNA mentioned in the notebook, see [https://2012.igem.org/Team:NTNU_Trondheim/Stocks Stocks] and [https://2012.igem.org/Team:NTNU_Trondheim/Constructs Constructs].
+
</div>
 +
</div>
 +
<div class="row-fluid">
 +
<div class="span12">
 +
</html>
 +
Click on a month name or date to view the respective notebook entries. For information on plasmids and DNA mentioned in the notebook, see [https://2012.igem.org/Team:NTNU_Trondheim/Stocks Stocks] and [https://2012.igem.org/Team:NTNU_Trondheim/Constructs Constructs]. For explanations of abbreviations used, click [https://2012.igem.org/Team:NTNU_Trondheim/Abbreviations here].
-
For explanations of abbreviations used, click [https://2012.igem.org/Team:NTNU_Trondheim/Abbreviations here].
+
<!--
 +
===Thursday 09.08.12===
 +
----
 +
Did a restriction digest as described in the [https://2012.igem.org/Team:NTNU_Trondheim/Protocols protocol] on the following parts. On the pieces to be used as inserts, the number of base pairs are also listed.
 +
 +
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
 +
!Biobrick/Construct
 +
!BioBrick
 +
!Enzymes
 +
!Buffer
 +
!bp insert
 +
|-
 +
|LuxI+term
 +
|<partinfo>Bba_C0061</partinfo>, <partinfo>BBa_B0015</partinfo>
 +
|XbaI+PstI
 +
|3
 +
|747
 +
|-
 +
|YFP+term
 +
|<partinfo>BBa_E0030</partinfo>, <partinfo>BBa_B0015</partinfo>
 +
|XbaI+PstI
 +
|3
 +
|852
 +
|-
 +
|Lysis
 +
|<partinfo>BBa_K112808</partinfo>
 +
|XbaI+PstI
 +
|3
 +
|1785
 +
|-
 +
|LuxI
 +
|<partinfo>Bba_C0061</partinfo>
 +
|XbaI+PstI
 +
|3
 +
|618
 +
|-
 +
|RBS*
 +
|<partinfo>BBa_B0030</partinfo>
 +
|SpeI+PstI
 +
|1
 +
| -
 +
|-
 +
|P<sub>luxR+HSL</sub>
 +
|<partinfo>BBa_R0062</partinfo>
 +
|SpeI+PstI
 +
|1
 +
| -
 +
|-
 +
|RBS
 +
|<partinfo>BBa_B0034</partinfo>
 +
|SpeI+PstI
 +
|1
 +
| -
 +
|-
 +
|pSB1A3
 +
|<partinfo>pSB1A3</partinfo>
 +
|EcoRI+PstI+DpnI
 +
|3
 +
| -
 +
|-
 +
|plld
 +
| -
 +
|EcoRI+SpeI
 +
|4
 +
|433
 +
|-
 +
|}
 +
 +
The parts lysis <partinfo>BBa_K112808</partinfo>, YFP+term (<partinfo>BBa_E0030</partinfo>, <partinfo>BBa_B0015</partinfo>), <partinfo>pSB1A3</partinfo> and plld will be assembled using the 3A assembly, so made double cutting mix with these parts.
 +
 +
Gel electrophoresis was done with luxI+term (<partinfo>Bba_C0061</partinfo>, <partinfo>BBa_B0015</partinfo>), lysis <partinfo>BBa_K112808</partinfo>, YFP+term (<partinfo>BBa_E0030</partinfo>, <partinfo>BBa_B0015</partinfo>), LuxI <partinfo>Bba_C0061</partinfo> and plld.
 +
 +
P<sub>lld</sub>+lysis and pSB1A3 cut yesterday with E+P was investigated on gel. Two fragments were obtained for P<sub>lld</sub>+lysis, but the sizes of the fragments were not as expected. Since we are not sure which fragment is which, both of the fragments were cut out of the gel and purified using the QIAquick gel extraction kit. In case one of them is uncut plasmid, the unligated DNA from both bonds will be transformed tomorrow, and we will assume that if the cells transformed with DNA from one of the samples won't grow, that sample will contain digested plasmid. This sample will be ligated with pSB1A3, plated out on a ampicillin plate, and then, several cell cultures from this plate will be plated out on a chloramphenicol plate. The colonies that won't grow on chloramphenicol, is assumed to contain the correct plasmid.
 +
 +
Vgb+RBS religated, Vgb+RBS+LuxR+DTT #1, Vgb+RBS+LuxR+DTT #2, LuxI+DTT, K+RBS+LacI+DTT and his-tagged LldR was miniprepped using the Promega SV miniprep kit. The concentrations of isolated plasmid are given below:
 +
 +
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
 +
!Plasmid
 +
!Concentration [ng/µl]
 +
|-
 +
|Vgb+RBS religated
 +
|27.3
 +
|-
 +
|Vgb+RBS+LuxR+DTT #1
 +
|26.2
 +
|-
 +
|Vgb+RBS+LuxR+DTT #2
 +
|31.7
 +
|-
 +
|LuxI+DTT
 +
|35.3
 +
|-
 +
|K+RBS+LacI+DTT
 +
|7.9
 +
|-
 +
|his-LldR
 +
|51.0
 +
|}
 +
 +
 +
===Wednesday 08.08.12===
 +
----
 +
 +
Tranformed Vgb+RBS+YFP+term (<partinfo>BBa_K561001</partinfo>, <partinfo>BBa_B0034</partinfo>, <partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>) and Vhb+RBS+YFP+term (<partinfo>BBa_K258005</partinfo>, <partinfo>BBa_B0034</partinfo>, <partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>) in competent DH5ɑ cells as described in the [https://2012.igem.org/Team:NTNU_Trondheim/Protocols protocol]. The plasmid in both of the constructs is <partinfo>psB1A2</partinfo>. They were left in the incubator over night.
 +
 +
Inspected the petri dishes with plld+RBS (lactate induced promoter and <partinfo>BBa_B0030</partinfo>) and the religation of RBS <partinfo>BBa_B0030</partinfo>, had many more colonies on the plld+RBS than the religation, which is good. Transferred a colony of the plld+RBS (lactate promoter and <partinfo>BBa_B0030</partinfo>) and a colony of RBS <partinfo>BBa_B0030</partinfo> to liquid media, with ampicillin resistance.
 +
 +
Cut LuxI+term (<partinfo>Bba_C0061</partinfo> and <partinfo>BBa_B0015</partinfo>) and LuxR+term (<partinfo>BBa_C0062</partinfo> and <partinfo>BBa_B0015</partinfo>) with XbaI and PstI, so that they can be used as inserts. Used the [https://2012.igem.org/Team:NTNU_Trondheim/Protocols protocol] with NEBuffer 3.
 +
 +
Did a gel electrophoresis with LuxI+term (<partinfo>Bba_C0061</partinfo> and <partinfo>BBa_B0015</partinfo>) and LuxR+term (<partinfo>BBa_C0062</partinfo> and <partinfo>BBa_B0015</partinfo>).
 +
 +
Purified RBS and LuxR+DTT. Resulting concentrations were 4.8 and 11.2 ng/µl, respectively.
 +
 +
===Tuesday 07.08.12===
 +
----
 +
 +
Inspected the petri dishes from yesterday, LacI <partinfo>BBa_C0012</partinfo> + terminator <partinfo>BBa_B0015</partinfo> showed colonies, the religation of the terminator <partinfo>BBa_B0015</partinfo> did not. Transferred a LacI <partinfo>BBa_C0012</partinfo> + terminator <partinfo>BBa_B0015</partinfo> colony to LB with ampicillin and inoculated at 37C with shaking.
 +
 +
Did a gel electrophoresis on plld, cut it out and extracted it, according to [https://2012.igem.org/Team:NTNU_Trondheim/Protocols protocols]. The concentration after gel extraction was: c<sub>plld</sub> = 10,6 ng/µl.
 +
 +
[[File:Plld, cut E+S, 07.08.12exp.png‎|thumb|center|400px|Picture of gel electrophoresis with plld. It was found at approximately 340 bp, as expected (344 bp).]]
 +
 +
Ligation was performed with plld as insert and RBS <partinfo>BBa_B0034</partinfo> as backbone. That means that the construct has a <partinfo>psB1A2</partinfo> plasmid. Also did a religation of the RBS <partinfo>BBa_B0034</partinfo> without any insert.
 +
 +
Transformed plld and RBS <partinfo>BBa_B0034</partinfo> in competent DH5ɑ cells, as well as the religation of RBS <partinfo>BBa_B0034</partinfo>. They were transferred to petri dishes with ampicillin resistance and left in the incubator over night.
 +
 +
Miniprepped VHB+RBS+lysis (<partinfo>BBa_K258005</partinfo>, <partinfo>BBa_B0034</partinfo> and <partinfo>BBa_K112808</partinfo>), VGB+RBS+lysis (<partinfo>BBa_K561001</partinfo>, <partinfo>BBa_B0034</partinfo> and <partinfo>BBa_K112808</partinfo>), pllD+lysis (lactate promoter and <partinfo>BBa_K112808</partinfo>) and three parallels of pBad+YFP (<partinfo>Bba_K206000</partinfo> and <partinfo>BBa_E0030</partinfo>)
 +
 +
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
 +
!Sample
 +
!Concentration [ng/µl]
 +
|-
 +
|VHB+RBS+lysis
 +
|38,2
 +
|-
 +
|VGB+RBS+lysis
 +
|50,5
 +
|-
 +
|pllD+lysis
 +
|40,2
 +
|-
 +
|pBad+YFP #1
 +
|46,6
 +
|-
 +
|pBad+YFP #2
 +
|40,5
 +
|-
 +
|pBad+YFP #3
 +
|38,9
 +
|}
 +
 +
===Monday 06.08.12===
 +
----
 +
 +
In order to start making the construct for the biobrick we are going to improve, the parts needed for the construct were cut using the restriction digest protocol [https://2012.igem.org/Team:NTNU_Trondheim/Protocols].
 +
 +
RBS <partinfo>BBa_B0030</partinfo> will be used as a backbone and was cut with EcoRI and XbaI. LacI <partinfo>BBa_C0012</partinfo> will be an insert, and was cut with EcoRI and SpeI. The terminator <partinfo>BBa_B0014</partinfo> will be used as a backbone and was cut with EcoRI and XbaI. In addition we will test the construct using a constitutive promoter <partinfo>BBa_J23119</partinfo> which was cut using EcoRI and SpeI.
 +
 +
The inserts LacI <partinfo>BBa_C0012</partinfo> and constitutive promoter <partinfo>BBa_J23119</partinfo> were run on gel after the restriction digest.  The problem with the constitutive promoter is that it is only 35 b.p long, and is therefore difficult to use as an insert. We tried to stop the gel early to see if we could detect the constitutive promoter, but we could not see anything at all. We therefore ran the gel further and cut the LacI <partinfo>BBa_C0012</partinfo> out of the gel.
 +
 +
[[File:LacI-E+S_K-E+X_06.08.12_(1).png‎|thumb|center|400px|Gel picture of the two inserts ran on gel. Used two different ladders. To the left we used a 1kb ladder to identify the Lac I insert, and to the right we used a 50 kb ladder to identify the constitutive promoter. Expected the LacI band to be approximately 1100 bp which seems to be about right. The constitutive promoter was expected to be 35 bp, but was not detected on the gel at all.]]
 +
 +
Used the PCR purification kit and protocol from www.qiagen.com [http://www.google.no/url?sa=t&rct=j&q=&esrc=s&source=web&cd=2&ved=0CFUQFjAB&url=http%3A%2F%2Fwww.qiagen.com%2FHB%2FQIAquickGelExtractionKit_EN&ei=RhYhUPiCA4iL4gS64oD4CA&usg=AFQjCNFwed-RxSRRgTFSJgtn7Fl5qisiWw&sig2=-pxyzkbLpVKt4DLlcSzQcw], on RBS <partinfo>BBa_B0030</partinfo>, pBad <partinfo>Bba_K206000</partinfo> and terminator <partinfo>BBa_B0014</partinfo>. Did a gel extraction using the Gel Extraction kit and [https://2012.igem.org/Team:NTNU_Trondheim/Protocols Protocol] on LacI <partinfo>BBa_C0012</partinfo>.
 +
 +
Did a ligation with LacI <partinfo>BBa_C0012</partinfo> and double terminator <partinfo>BBa_B0015</partinfo>, where the double terminator <partinfo>BBa_B0015</partinfo> was used as a backbone. That means, the construct has a <partinfo>psB1AK3</partinfo> backbone and resistance Ampicillin and Kanamycin. A religation of the backbone <partinfo>BBa_B0015</partinfo> was also performed.
 +
 +
The ligated LacI <partinfo>BBa_C0012</partinfo> and double terminator <partinfo>BBa_B0015</partinfo> was transformed in competent DH5ɑ cells, along with the religation of the backbone <partinfo>BBa_B0015</partinfo>. The petri dishes are left to inoculate through the night.
 +
 +
A new batch of LA-medium was made and used to make ampicillin petri dishes.
 +
 +
A restriction digest was done on the lld promoter, as described in the [https://2012.igem.org/Team:NTNU_Trondheim/Protocols protocols]. It was cut with EcoRI and SpeI, and will be an insert with RBS <partinfo>BBa_B0030</partinfo> as backbone. This will then make the plasmid <partinfo>pSB1A2</partinfo> the backbone.
 +
 +
===Sunday 05.08.12===
 +
----
 +
 +
Plasmid DNA was isolated from pllD-1B and <partinfo>BBa_B0014</partinfo> cultures were isolated by miniprep. DNA concentrations were measured as 41,2/42,5 and 53,3/52,8 ng/uL respectively (two measurements per sample).
 +
 +
Inspected agar plates in incubator inoculated on 3/8:
 +
VGB+RBS religation: 1 colony
 +
VHB+RBS+lysis: Good growth
 +
VHB+RBS religation: ~ 20 colonies
 +
VHB+RBS + lysis: Good growth
 +
pBAD (w/ backbone), religated: 40+ colonies
 +
pBAD +YFP +DTT: 7 colonies
 +
 +
Comments: Judging from the growth on the religation plates, colonies with non-insert plasmids is a possibility on all plates. pBAD is especially worrisome, as the number of colonies is lower on the insert ligation plate than on the backbone religation plate. The lysis part used in the above constructs already has an RBS, so the RBS part is redundant.
 +
 +
Induced one 5 mL culture (induction culture) pllD + lysis (3/8) with 210 uL ~ 1M lactate and addded 210 uL dH2O to another (control culture). Sampled 200 uL from both before induction, for OD measurements.
 +
 +
Inoculated 5 5 mL LB + Amp cultures with colonies from the following agar plates:
 +
VGB+RBS+Lysis (3/8)
 +
VHB+RBS+Lysis (3/8)
 +
pBAD + YFP +DTT (3/8) (3 colonies)
 +
 +
Inoculated 3 5 mL LB + Cm cultures from pllD + lysis agar plate.
 +
 +
===Friday 03.08.12===
 +
----
 +
 +
Isolated plasmid DNA from the cultures of RBS* (<partinfo>BBa_B0030</partinfo>) and LacI (<partinfo>BBa_C0012</partinfo>) inoculated yesterday.
 +
 +
Ligated pBad (<partinfo>Bba_K206000</partinfo>) together with YFP+DTT (<partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>), and VGB+RBS (<partinfo>BBa_K561001</partinfo> and <partinfo>BBa_B0034</partinfo>) and VHB+RBS (<partinfo>BBa_K258005</partinfo> and <partinfo>BBa_B0034</partinfo>) with Lysis (<partinfo>BBa_K124017</partinfo>). These were then transformed into competent E. coli DH5α cells and plated out on petri dishes with Ampicillin.
 +
 +
Terminator <partinfo>BBa_B0014</partinfo> and re-transformed pllD in <partinfo>pSB1C3</partinfo> ("pllD 1-B") were transferred to liquid culture.
 +
 +
Ran gel on the PCR-products from yesterday.
 +
 +
Inoculated 2 x 5 mL, 1 x 10 mL and 1 x 25 mL LB + Cm with plld + lysis.
===Thursday 02.08.12===
===Thursday 02.08.12===
----
----
-
5 µl of the PCR product from yesterday was run on gel to check if it is as expected.
+
5 µl of the PCR product from yesterday was run on gel, but it did not give any results. We looked at the primers and thought we had done something wrong, but we did not. Will try to do the PCR one more time, but with a lower annealing temperature (55°C).
 +
 
 +
The constructs containing plld ligated with the lysis device(<partinfo>BBa_K112808</partinfo>), and plld in plasmid <partinfo>PSB1C3</partinfo> were miniprepped. The concentration were measured using nano drop.
 +
 
 +
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
 +
!Sample
 +
!Concentration [ng/µl]
 +
|-
 +
|pllD + lysis
 +
|45,5
 +
|-
 +
|pllD in PSB1C3
 +
|42,3
 +
|}
 +
 
 +
Inoculated 1 colony from each of three plates containing LacI (<partinfo>BBa_C0012</partinfo>), RBS* <partinfo>BBa_B0030</partinfo> and pllD + lysis (all inoculated 1/8), into 5 mL LB + Amp (BBa_B0030, LacI)/ LB + Cm (pllD + lysis).
 +
 
 +
Transformed the part <partinfo>BBa_B0014</partinfo> from the distribution kit, and re-transformed pllD in pSB1C3 with DNA taken from the sample shipped to the RHIT team yesterday.
 +
 
 +
Reviewed the data from the oxygen-promoter experiment on monday. In conclusion, it appears that oxygen levels in the induced (anaerobic) cultures were not as low as desired, as growth rates were very similar between the aerobic and anaerobic cultures, while one would expect anaerobic cultures to grow slower. After correcting for OD, the fluorescence in the cultures at the end of the experiment was lower than the fluorescence measured from a control culture with no expected production of fluorescent protein. For this reason, a full analysis of the rest of the data was not performed.
===Wednesday 01.08.12===
===Wednesday 01.08.12===
----
----
-
Gel purification was performed on the gel piece from yesterday, the lysis device cut with X+P. The concentration is 10,1 ng/µl. The lysis device and plld were ligated together, plld (with pSB1C3) as backbone.
+
Gel purification was performed on the gel piece from yesterday, the lysis device cut with X+P. The concentration is 10,1 ng/µl. The lysis device and plld were ligated together, plld (with <partinfo>pSB1C3</partinfo>) as backbone.
The ligated lysis and plld were transformed into competent ''E.coli'' DH5α cells. This was also done for the biobricks lacI repressor from E. coli (<partinfo>BBa_C0012</partinfo>) and RBS (<partinfo>BBa_B0030</partinfo>).
The ligated lysis and plld were transformed into competent ''E.coli'' DH5α cells. This was also done for the biobricks lacI repressor from E. coli (<partinfo>BBa_C0012</partinfo>) and RBS (<partinfo>BBa_B0030</partinfo>).
-
The petri dishes from yesterday showed colonies on the dishes with the pSB1C3+Colisin construct and the K+RBS+Colisin construct. One colony from each petri dish were transferred to liquid medium.
+
The petri dishes from yesterday showed colonies on the dishes with the pSB1C3+Colisin construct (<partinfo>pSB1C3</partinfo> and <partinfo>BBa_K150009</partinfo>) and the K+RBS+Colisin construct (<partinfo>BBa_K081005</partinfo> and <partinfo>BBa_K150009</partinfo>). One colony from each petri dish were transferred to liquid medium.
-
Sent a sample of the E. coli pllD promoter in pSB1C3 backbone to the iGEM team at RHIT.
+
Sent a sample of the E. coli pllD promoter in <partinfo>pSB1C3</partinfo> backbone to the iGEM team at RHIT.
-
PCR was performed on pBad and DTT.
+
PCR was performed on pBad (<partinfo>Bba_K206000</partinfo>) and DTT (<partinfo>BBa_B0015</partinfo>), the primers used, PCR-mix and programmed times are listed below.
 +
 
 +
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
 +
!Primer
 +
!Type
 +
!Sequence
 +
!Tm [°C]
 +
|-
 +
|DTT fwd
 +
|Forward
 +
|CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAG
 +
|72
 +
|-
 +
|DTT rev
 +
|Reverse
 +
|CTCTAGAAGCGGCCGCGAATTCCAGAAATC
 +
|72
 +
|-
 +
|pBad scar fwd
 +
|Forward
 +
|TACTAGAGTACTAGTAGCGGCCGCTGCAGT
 +
|72
 +
|-
 +
|pBad fwd
 +
|Forward
 +
|TACTAGTAGCGGCCGCTGCAGTC
 +
|70
 +
|-
 +
|pBad rev
 +
|Reverse
 +
|GCTAGCCCAAAAAAACGGTATGGAGAAACAGTAGAGAG
 +
|72
 +
|}
 +
 
 +
Mix 1:
 +
* 1 µl dNTP
 +
* 2,5 µl 1:10 fwd primer
 +
* 2,5 µl 1:10 rev primer
 +
* 1 µl template DNA
 +
* 18 µl dH<sub>2</sub>O
 +
 
 +
Mix 2:
 +
* 19,25 µl d<sub>2</sub>O
 +
* 5 µl buffer with MgCl<sub>2</sub>
 +
* 0,75 µl Expand High Fidelity enzyme
 +
 
 +
This PCR mix was found here: http://francois.schweisguth.free.fr/protocols/High_fildelity_roche.pdf
 +
 
 +
Thermal timetables:
 +
 
 +
{|
 +
| style="padding-right:7px;" |
 +
{|class="wikitable" style="margin: 1em auto 1em auto;"
 +
|+pBAD
 +
! Step
 +
! Action
 +
! Temperature
 +
! Duration
 +
|-
 +
|1
 +
|Heated lid:
 +
|103°C
 +
|
 +
|-
 +
|2
 +
|Initial denaturation;
 +
|94°C
 +
|2 min
 +
|-
 +
|3
 +
|Denaturation;
 +
|94°C
 +
|15 s
 +
|-
 +
|4
 +
|Annealing;
 +
|66°C
 +
|30 s
 +
|-
 +
|5
 +
|Elongation;
 +
|72°C
 +
|2 min
 +
|-
 +
|6
 +
|Go to step 3, repeat 10 x
 +
|-
 +
|7
 +
|Denaturation;
 +
|98°C
 +
|10 s
 +
|-
 +
|8
 +
|Elongation;
 +
|72°C
 +
|31 s
 +
|-
 +
|9
 +
|Go to step 7, repeat 15 x, with 5 s extra each time.
 +
|-
 +
|10
 +
|Final Elongation;
 +
|72°C
 +
|7 min
 +
|-
 +
|11
 +
|Hold
 +
|4°C
 +
|∞
 +
|}
 +
 
 +
| style="padding-left:7px;" |
 +
 
 +
{|class="wikitable" style="margin: 1em auto 1em auto;"
 +
|+ DTT
 +
! Step
 +
! Action
 +
! Temperature
 +
! Duration
 +
|-
 +
|1
 +
|Heated lid:
 +
|103°C
 +
|
 +
|-
 +
|2
 +
|Initial denaturation;
 +
|94°C
 +
|2 min
 +
|-
 +
|3
 +
|Denaturation;
 +
|94°C
 +
|15 s
 +
|-
 +
|4
 +
|Annealing;
 +
|66°C
 +
|30 s
 +
|-
 +
|5
 +
|Elongation;
 +
|72°C
 +
|3 min
 +
|-
 +
|6
 +
|Go to step 3, repeat 10 x
 +
|-
 +
|7
 +
|Denaturation;
 +
|98°C
 +
|10 s
 +
|-
 +
|8
 +
|Elongation;
 +
|72°C
 +
|31 s
 +
|-
 +
|9
 +
|Go to step 7, repeat 15 x, with 5 s extra each time.
 +
|-
 +
|10
 +
|Final Elongation;
 +
|72°C
 +
|7 min
 +
|-
 +
|11
 +
|Hold
 +
|4°C
 +
|∞
 +
|}
 +
|}
===Tuesday 31.07.12===
===Tuesday 31.07.12===
Line 83: Line 499:
----
----
-
Today, we started testing the Vgb and Vhb promoters. For both promoters, we have made test constructs consisting of promoter, RBS, YFP and terminator. The testing was carried out by using two parallel cultures of each promoter construct, and inducing one of the parallels by bubbling the culture with nitrogen gas to remove oxygen. Samples were collected every 10 minutes.
+
Today, we started testing the Vgb (<partinfo>BBa_K561001</partinfo>) and Vhb (<partinfo>BBa_K258005</partinfo>) promoters. For both promoters, we have made test constructs consisting of promoter, RBS (<partinfo>BBa_B0034</partinfo>), YFP (<partinfo>BBa_E0030</partinfo>) and terminator (<partinfo>BBa_B0015</partinfo>). The testing was carried out by using two parallel cultures of each promoter construct, and inducing one of the parallels by bubbling the culture with nitrogen gas to remove oxygen. Samples were collected every 10 minutes.
-
Further, the constitutive promoter containing RBS was cut with S+P, and the purified colicin PCR product were cut with X+P, to be ligated tomorrow. Another colicin PCR product sample was cut with E+P, to be ligated into the already cut pSB1C3 tomorrow.
+
Further, the constitutive promoter containing RBS (<partinfo>BBa_K081005</partinfo>) was cut with S+P, and the purified colicin PCR product were cut with X+P, to be ligated tomorrow. Another colicin PCR product sample was cut with E+P, to be ligated into the already cut pSB1C3 tomorrow.
-
We also test cutted P<sub>lld</sub> with BpmI and AflIII. This was performed because the number of religations for the pSB1C3 plasmid was higher than it should have been. One of the samples to be test cutted was taken from the miniprepped plasmids of one of the colonies on the religation plate, to be used as negative controll, and three parallel samples from the ligation plate were test cutted.  
+
We also test cutted P<sub>lld</sub> with BpmI and AflIII. This was performed because the number of religations for the pSB1C3 plasmid was higher than it should have been. One of the samples to be test cutted was taken from the miniprepped plasmids of one of the colonies on the religation plate, to be used as negative controll, and three parallel samples from the ligation plate were test cutted. The gel pictures are shown below:
-
The gel pictures are shown below:
+
-
{|border="0"
+
-
|[[File:AflIII-testkutt_Plld_i_pSB1C3_30.07.12.png|thumb|left|400px|Religated pSB1C3, and three parallels of ligated P<sub>lld</sub> and pSB1C3 investigated by cutting with AflIII. AflIII cuts both inside the promoter region, and in the backbone, so if the promoter is present in the plasmid, the expected result for this test cut is two fragments; one on 277 bp, and one on 2136. All parallels from the ligation shows two bonds at the expected positions.]]
+
-
[[File:BpmI-testkutt_Plld_i_pSB1C3_30.07.12.png‎|thumb|right|400px|Religated pSB1C3, and three parallels of ligated P<sub>lld</sub> and pSB1C3 investigated by cutting with BpmI. BpmI also cuts both inside the promoter region and in the backbone, so if the promoter is present in the plasmid, the expected result for this test cut is two fragments; one on 898 bp, and one on 1515. Only one band is present on the gel.]]
+
{| style="text-align:center;"
 +
|[[File:AflIII-testkutt_Plld_i_pSB1C3_30.07.12.png|thumb|center|450px| Religated pSB1C3, and three parallels of ligated P<sub>lld</sub> and pSB1C3 investigated by cutting with AflIII. AflIII cuts both inside the promoter region, and in the backbone, so if the promoter is present in the plasmid, the expected result for this test cut is two fragments; one on 277 bp, and one on 2136. All parallels from the ligation shows two bonds at the expected positions.]]
 +
|[[File:BpmI-testkutt_Plld_i_pSB1C3_30.07.12.png|thumb|center‎|450px|Religated pSB1C3, and three parallels of ligated P<sub>lld</sub> and pSB1C3 investigated by cutting with BpmI. BpmI also cuts both inside the promoter region and in the backbone, so if the promoter is present in the plasmid, the expected result for this test cut is two fragments; one on 898 bp, and one on 1515. Only one band is present on the gel.]]
|}
|}
 +
The results from the test cutting were ambigous. The test cut performed with AflIII show the expected fragments, while the test cut performed with BpmI do not. It seems that the promoter is there in all thre parallels; if not it would have been impossible to yield two fragements in the AflIII test cut. But still, if the promoter sequence is as it should have been, also the test cut with BpmI should have yielded two fragments. It is, however, possible, that the BpmI restriction site inside the promoter is ok, but that the restriction site in the plasmid is damaged.
The results from the test cutting were ambigous. The test cut performed with AflIII show the expected fragments, while the test cut performed with BpmI do not. It seems that the promoter is there in all thre parallels; if not it would have been impossible to yield two fragements in the AflIII test cut. But still, if the promoter sequence is as it should have been, also the test cut with BpmI should have yielded two fragments. It is, however, possible, that the BpmI restriction site inside the promoter is ok, but that the restriction site in the plasmid is damaged.
Line 100: Line 516:
Made LB medium in preparation for experiment with the oxygen-sensitive promoters tomorrow.
Made LB medium in preparation for experiment with the oxygen-sensitive promoters tomorrow.
-
Inspeccted the pSB1C3 religation plate in the incubator. Many colonies that were not visible at the time of the colony count yesterday has now appeared. The religation and the pllD plate now contains about the same number of colonies, casting doubt on the sucess of the transformation. Moved the plate to the fridge.
+
Inspeccted the <partinfo>pSB1C3</partinfo> religation plate in the incubator. Many colonies that were not visible at the time of the colony count yesterday has now appeared. The religation and the pllD plate now contains about the same number of colonies, casting doubt on the sucess of the transformation. Moved the plate to the fridge.
-
Extracted plasmid DNA by miniprep from the pllD (unconfirmed) and pSB1C3 religation cultures inoculated yesterday, and the culture of BBa_E0040 (A. vic. GFP) inoculated 26/7. DNA concentrations were measured with NanoDrop, as follows (two parallel measurements were made for each sample):
+
Extracted plasmid DNA by miniprep from the pllD (unconfirmed) and <partinfo>pSB1C3</partinfo> religation cultures inoculated yesterday, and the culture of <partinfo>BBa_E0040</partinfo> (A. vic. GFP) inoculated 26/7. DNA concentrations were measured with NanoDrop, as follows (two parallel measurements were made for each sample):
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
Line 117: Line 533:
|22,8/23,9
|22,8/23,9
|-
|-
-
|pSB1C3 1
+
|<partinfo>pSB1C3</partinfo> 1
|15,4/15,5
|15,4/15,5
|-
|-
-
|pSB1C3 2
+
|<partinfo>pSB1C3</partinfo> 2
|20,7/20,7
|20,7/20,7
|-
|-
-
|BBa_E0040
+
|<partinfo>BBa_E0040</partinfo>
|38,2/37,8
|38,2/37,8
|}
|}
Line 129: Line 545:
DNA from all the above samples except GFP was digested with Xba1 and Spe1. The digested samples were analyzed by gel electrophoresis to find out whether the desired insert was obtained in any of the samples. 75 V was applied for 45 min, and the gel was imaged. After imaging, electrophoresis was continued at 40 V for a further 30 minutes before imaging again. The result of the second imaging is shown below.
DNA from all the above samples except GFP was digested with Xba1 and Spe1. The digested samples were analyzed by gel electrophoresis to find out whether the desired insert was obtained in any of the samples. 75 V was applied for 45 min, and the gel was imaged. After imaging, electrophoresis was continued at 40 V for a further 30 minutes before imaging again. The result of the second imaging is shown below.
-
[[file:ChemiDoc 2012-07-29 22hr 41min pllD pSB1C3.jpg|center]]
+
[[file:ChemiDoc 2012-07-29 22hr 41min pllD pSB1C3.jpg|thumb|450px|center]]
Results of gel electrophoresis: All three samples from the pllD plate showed a short band identical between these samples, but it is difficult to determine the exact size - there seems to be an inconsistency in the migration of the 50 bp ladder on the left side of the gel and the 1 kb ladder on the right. Looking at the 50 bp ladder, the short band in the three first samples seems to be between the third and the fourth band from the bottom, representing 150 and 200 bp respectively. However, looking at the 1 kb ladder on the right, the short bands lie between the first and second ladder bands, equaling 250 and 500 bp respectively. The position of the short bands with respect to the 1 kb ladder appears to be consistent with the expected size of the pllD insert.
Results of gel electrophoresis: All three samples from the pllD plate showed a short band identical between these samples, but it is difficult to determine the exact size - there seems to be an inconsistency in the migration of the 50 bp ladder on the left side of the gel and the 1 kb ladder on the right. Looking at the 50 bp ladder, the short band in the three first samples seems to be between the third and the fourth band from the bottom, representing 150 and 200 bp respectively. However, looking at the 1 kb ladder on the right, the short bands lie between the first and second ladder bands, equaling 250 and 500 bp respectively. The position of the short bands with respect to the 1 kb ladder appears to be consistent with the expected size of the pllD insert.
-
Taken together, it seems possible that the short band represents the desired insert, but the samples should be analyzed again to get more data. The samples from the pSB1C3 religation plate does not show this band and is overall much fainter.  
+
Taken together, it seems possible that the short band represents the desired insert, but the samples should be analyzed again to get more data. The samples from the <partinfo>pSB1C3</partinfo> religation plate does not show this band and is overall much fainter.  
-
The top bands in the pllD wells are on heigth with the seventh band from the bottom, equaling 2500 bp, in the Generuler 1kb ladder on the right. This is approximately the size of the pSB1C3 plasmid and the pllD insert together. The two wells on the right containing DNA from the pSB1C3 religation plate show two faint bands each: One slightly above the top bands in the pllD wells, and one shorter band slightly above the 1000 bp reference band in the 1 kb ladder.
+
The top bands in the pllD wells are on heigth with the seventh band from the bottom, equaling 2500 bp, in the Generuler 1kb ladder on the right. This is approximately the size of the <partinfo>pSB1C3</partinfo> plasmid and the pllD insert together. The two wells on the right containing DNA from the <partinfo>pSB1C3</partinfo> religation plate show two faint bands each: One slightly above the top bands in the pllD wells, and one shorter band slightly above the 1000 bp reference band in the 1 kb ladder.
===Saturday 28.07.12===
===Saturday 28.07.12===
 +
----
-
Inspected the plates with PllD in <partinfo>pSB1C3</partinfo> and pSB1C3 religation transformants inoculated yesterday. Growth on both plates, but more on the PllD plate. No growth on negative control (non-transformed cells). Approximate colony cound:
+
Inspected the plates with PllD in <partinfo>pSB1C3</partinfo> and <partinfo>pSB1C3</partinfo> religation transformants inoculated yesterday. Growth on both plates, but more on the PllD plate. No growth on negative control (non-transformed cells). Approximate colony cound:
Religation: 73
Religation: 73
pllD: 240
pllD: 240
Line 146: Line 563:
Assuming other factors are equal, based on these numbers a colony on the lldP plate should have about a 2/3 chance of containing the desired insert. Suggested course of action: Inoculate several colonies from the lddp plate, miniprep, perform a test restriction digest and gel electrophoresis to check size.  Use colonies from the religation plate for reference: Plasmids with the desired insert should be about 344 bp larger than the religated plasmid without insert.
Assuming other factors are equal, based on these numbers a colony on the lldP plate should have about a 2/3 chance of containing the desired insert. Suggested course of action: Inoculate several colonies from the lddp plate, miniprep, perform a test restriction digest and gel electrophoresis to check size.  Use colonies from the religation plate for reference: Plasmids with the desired insert should be about 344 bp larger than the religated plasmid without insert.
-
Inoculated 3 colonies from the PllD plate and 2 colonies from the pSB1C3 religation plate into 5 mL LB + Cm, and placed the cultures in 37 C shaking incubator. Placed the plates back in 37 C cabinet.
+
Inoculated 3 colonies from the PllD plate and 2 colonies from the <partinfo>pSB1C3</partinfo> religation plate into 5 mL LB + Cm, and placed the cultures in 37 C shaking incubator. Placed the plates back in 37 C cabinet.
Updated information about stored DNA samples and glycerol stocks on the wiki.
Updated information about stored DNA samples and glycerol stocks on the wiki.
Line 153: Line 570:
===Friday 27.07.12===
===Friday 27.07.12===
 +
----
The PCR batches run yesterday were investigated on gel electrophoresis, and the gel picture shows that colicin has been made!
The PCR batches run yesterday were investigated on gel electrophoresis, and the gel picture shows that colicin has been made!
Line 163: Line 581:
New primers were ordered for LldR, this time containing the biobrick prefix and suffix.
New primers were ordered for LldR, this time containing the biobrick prefix and suffix.
-
 
Discussed experimental design for testing of oxygen-sensitive promoters with Martin. Made a plan for testing both promoters on Monday.
Discussed experimental design for testing of oxygen-sensitive promoters with Martin. Made a plan for testing both promoters on Monday.
Line 208: Line 625:
-
GFP (BBa_E0040) were also transferred to liquid culture.
+
GFP (<partinfo>BBa_E0040</partinfo>) were also transferred to liquid culture.
Today, we also had a video conference with the [https://2012.igem.org/Team:RHIT Rose Hulman Institute of Technology iGEM team], discussing how we could collaborate with each other. It was really nice meeting you, and hopefully, we'll be seing you in Boston in November:-)
Today, we also had a video conference with the [https://2012.igem.org/Team:RHIT Rose Hulman Institute of Technology iGEM team], discussing how we could collaborate with each other. It was really nice meeting you, and hopefully, we'll be seing you in Boston in November:-)
Line 217: Line 634:
Made glycerol stocks from the following cultures:
Made glycerol stocks from the following cultures:
-
EYFP + LVA (BBa_E0430) (26/7)
+
EYFP + LVA (<partinfo>BBa_E0430</partinfo>) (26/7)
-
ptet GFP (BBa_I13522) (26/7)
+
ptet GFP (<partinfo>BBa_I13522</partinfo>) (26/7)
-
ptet mRFP (BBa_I13521) (26/7)
+
ptet mRFP (<partinfo>BBa_I13521</partinfo>) (26/7)
Re-inoculated following liquid cultures in new LB + amp medium (50 uL to 5 mL), followed by miniprep of the old culture.  
Re-inoculated following liquid cultures in new LB + amp medium (50 uL to 5 mL), followed by miniprep of the old culture.  
Line 249: Line 666:
* 0.2 µl Phusion HF DNA polymerase
* 0.2 µl Phusion HF DNA polymerase
-
In the case of both the lld promoter and the LldR gene, the genome of ''E.coli'' K12 (strain ER2925) was used as template. For the colicin batch, the BBa_K150009 biobrick was used as template.
+
In the case of both the lld promoter and the LldR gene, the genome of ''E.coli'' K12 (strain ER2925) was used as template. For the colicin batch, the <partinfo>BBa_K150009</partinfo> biobrick was used as template.
Two of the primer sets contained prefix and suffix, and for these, two different melting temperatures were determined. The reason for this is that in the first cycles, the only the primer parts able to bind to the template will be determining for the melting temperature, while in the later cycles, where the amplified DNA is dominating as template, also the prefix / suffix parts of the primers will be able to bind to the DNA, and hence the primers will obtain higher melting temperatures. For the two PCR mixes containing primers with prefix and suffix, a three step protocol was used in the first ten cycles, while a two step protocol was used in the last fifteen cycles. Phusion High Fidelity DNA Polymerase (Finnzymes). To calculate the melting temperature, we used Finnzymes' Tm calculator (http://www.finnzymes.fi/tm_determination.html).
Two of the primer sets contained prefix and suffix, and for these, two different melting temperatures were determined. The reason for this is that in the first cycles, the only the primer parts able to bind to the template will be determining for the melting temperature, while in the later cycles, where the amplified DNA is dominating as template, also the prefix / suffix parts of the primers will be able to bind to the DNA, and hence the primers will obtain higher melting temperatures. For the two PCR mixes containing primers with prefix and suffix, a three step protocol was used in the first ten cycles, while a two step protocol was used in the last fifteen cycles. Phusion High Fidelity DNA Polymerase (Finnzymes). To calculate the melting temperature, we used Finnzymes' Tm calculator (http://www.finnzymes.fi/tm_determination.html).
 +
 +
{| class="wikitable" style="text-align:centre;margin: 1em auto 1em auto;"
 +
!Primer
 +
!Type
 +
!Sequence
 +
!Tm [°C]
 +
|-
 +
|lld promoter fwd
 +
|Forward
 +
|cacattcctataggccgagtaaggt
 +
|66.2
 +
|-
 +
|lld promoter rev
 +
|Reverse
 +
|gcaggtctcctggagtccacgc
 +
|73.8
 +
|-
 +
|lldR fwd
 +
|Forward
 +
|atgattgttttacccagacgcctgt
 +
|69.3
 +
|-
 +
|lldR rev
 +
|Reverse
 +
|tcatgcgtttttctccctcgaat
 +
|69.7
 +
|-
 +
|Colicin fwd
 +
|Forward
 +
|atggaaaccgcggtagcgta
 +
|68.7
 +
|-
 +
|Colicin rev
 +
|Reverse
 +
|tgcgatggtccctccctgaa
 +
|72.6
 +
|}
The following PCR programs were used:
The following PCR programs were used:
-
lld promoter:
+
{|style="text-align:center; margin: 1em auto 1em auto;" |
-
{|border="0"
+
 
 +
| style="padding-right:10px"; |
 +
 
 +
{|class="wikitable" style="margin: 1em auto 1em auto;"
 +
|+ lld promoter
 +
! Step
 +
! Action
 +
! Temperature
 +
! Duration
 +
|-
|1
|1
|Heated lid:  
|Heated lid:  
Line 312: Line 775:
|}
|}
 +
| style="padding-left:10px;" |
-
lldR:
+
{|class="wikitable" style="margin: 1em auto 1em auto;"
-
{|border="0"
+
|+ Colicin
 +
! Step
 +
! Action
 +
! Temperature
 +
! Duration
 +
|-
|1
|1
|Heated lid:  
|Heated lid:  
Line 338: Line 807:
|Elongation;
|Elongation;
|72°C
|72°C
-
|24 s
+
|31 s
|-
|-
|6
|6
-
|Go to step 3, repeat 25 x
+
|Go to step 3, repeat 10 x
|
|
|
|
|-
|-
-
|7
+
|7
 +
|Denaturation;
 +
|98°C
 +
|10 s
 +
|-
 +
|8
 +
|Elongation;
 +
|72°C
 +
|31 s
 +
|-
 +
|9
 +
|Go to step 7, repeat 15 x
 +
|
 +
|
 +
|-
 +
|10
|Final elongation;
|Final elongation;
|72°C
|72°C
|10 min
|10 min
|-
|-
-
|8
+
|11
|Hold
|Hold
|4°C
|4°C
Line 356: Line 840:
|}
|}
 +
|-
-
Colicin:
+
|colspan="2" |
-
{|border="0"
+
 
 +
{|class="wikitable" style="margin: 1em auto 1em auto;"
 +
|+ lldR
 +
! Step
 +
! Action
 +
! Temperature
 +
! Duration
 +
|-
|1
|1
|Heated lid:  
|Heated lid:  
Line 382: Line 874:
|Elongation;
|Elongation;
|72°C
|72°C
-
|31 s
+
|24 s
|-
|-
|6
|6
-
|Go to step 3, repeat 10 x
+
|Go to step 3, repeat 25 x
|
|
|
|
|-
|-
-
|7
+
|7
-
|Denaturation;
+
-
|98°C
+
-
|10 s
+
-
|-
+
-
|8
+
-
|Elongation;
+
-
|72°C
+
-
|31 s
+
-
|-
+
-
|9
+
-
|Go to step 7, repeat 15 x
+
-
|
+
-
|
+
-
|-
+
-
|10
+
|Final elongation;
|Final elongation;
|72°C
|72°C
|10 min
|10 min
|-
|-
-
|11
+
|8
|Hold
|Hold
|4°C
|4°C
Line 415: Line 892:
|}
|}
-
We also transformed the biobrick BBa_E0040, which is a protein coding part coding for GFP.
+
|}
 +
 
 +
We also transformed the biobrick <partinfo>BBa_E0040</partinfo>, which is a protein coding part coding for GFP.
===Tuesday 24.07.12===
===Tuesday 24.07.12===
----
----
-
Transformed the pBAD+RBS+YFP+DTT, VGB+RBS+YFP+DTT, and VHB+RBS+YFP+DTT constructs ligated yesterday to supercompetent ''E.coli'' Dh5α cells.
+
Transformed the pBAD+RBS+YFP+DTT (<partinfo>Bba_K206000</partinfo>, <partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>), VGB+RBS+YFP+DTT (<partinfo>BBa_K561001</partinfo>, <partinfo>BBa_B0034</partinfo>, <partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>), and VHB+RBS+YFP+DTT (<partinfo>BBa_K258005</partinfo>, <partinfo>BBa_B0034</partinfo>, <partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>) constructs ligated yesterday to supercompetent ''E.coli'' Dh5α cells.
We also started making our iGEM matchmaker, which will be useful for iGEM teams wanting collaboration with other teams.  
We also started making our iGEM matchmaker, which will be useful for iGEM teams wanting collaboration with other teams.  
Line 426: Line 905:
Some of our primers arrived today, so tomorrow the PCR fun will start.
Some of our primers arrived today, so tomorrow the PCR fun will start.
-
Transformed the BioBrick parts BBa_E0430 and BBa_I13522 using the iGEM 2011 DNA distribution kit.
+
Transformed the BioBrick parts <partinfo>BBa_E0430</partinfo> and <partinfo>BBa_I13522</partinfo> using the iGEM 2011 DNA distribution kit.
===Monday 23.07.12===
===Monday 23.07.12===
----
----
-
We continnued the assembly of the promoter test constructs. As the test gel run on friday showed the expected fragment, the YFP+DTT samples were separated using gel electrophoresis. The inserts were cut out of the gel, as shown below, and purified using the QIAquick Gel Extraction Kit.  
+
We continnued the assembly of the promoter test constructs. As the test gel run on friday showed the expected fragment, the YFP+DTT (<partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>) samples were separated using gel electrophoresis. The inserts were cut out of the gel, as shown below, and purified using the QIAquick Gel Extraction Kit.  
[[File:YFP_insert_23.07.12 exp.png|thumb|center|400px|The picture is showing two parallels of the YFP+DTT sample, containing an insert to be used in ligation with promoter+RBS constructs. The inserts, shown in red boxes, were cut out of the gel and purified.]]
[[File:YFP_insert_23.07.12 exp.png|thumb|center|400px|The picture is showing two parallels of the YFP+DTT sample, containing an insert to be used in ligation with promoter+RBS constructs. The inserts, shown in red boxes, were cut out of the gel and purified.]]
-
The pBad+RBS, Jen1+RBS, Vgb+RBS and Vhb+RBS backbones were purified using the QIAquick PCR Purification Kit. Concentrations of both inserts and backbones after purification are given below:
+
The pBad+RBS (<partinfo>Bba_K206000</partinfo>), Jen1+RBS (<partinfo>BBa_K284002</partinfo> and <partinfo>BBa_B0034</partinfo>), Vgb+RBS (<partinfo>BBa_K561001</partinfo> and <partinfo>BBa_B0034</partinfo>) and Vhb+RBS (<partinfo>BBa_K258005</partinfo> and <partinfo>BBa_B0034</partinfo>) backbones were purified using the QIAquick PCR Purification Kit. In all of the above it is the plasmid from RBS that's the backbone (<partinfo>psB1A2</partinfo>). Concentrations of both inserts and backbones after purification are given below:
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
Line 463: Line 942:
|}
|}
-
VGB+RBS, VHB+RBS and pBAD+RBS were all ligated with YFP+DTT.
+
VGB+RBS (<partinfo>BBa_K561001</partinfo> and <partinfo>BBa_B0034</partinfo>), VHB+RBS (<partinfo>BBa_K258005</partinfo> and <partinfo>BBa_B0034</partinfo>) and pBAD+RBS (<partinfo>Bba_K206000</partinfo>) were all ligated with YFP+DTT (<partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>).
For the YFP + DTT fragment, DNA concentration measurements with NanoDrop after isolation with the quiagen kit were inconsistent. For the samples made from the two gel bands, values ranged from 3.7 to 14.8 and 4.0 to 24.4 ng/uL, respectively. Conclusion: Several measurements should always be made.
For the YFP + DTT fragment, DNA concentration measurements with NanoDrop after isolation with the quiagen kit were inconsistent. For the samples made from the two gel bands, values ranged from 3.7 to 14.8 and 4.0 to 24.4 ng/uL, respectively. Conclusion: Several measurements should always be made.
Line 480: Line 959:
Is the problem with the construct itself/expression of GFP from the plasmid, or with plasmid stability? All cultures tested for GFP fluorescence so far have been "old" (probable stationary phase) or inoculated from "old" cultures. Reports indicate that B-lactamase in old culture media may degrade ampicillin at a high rate and lead to decreased plasmid stability, also when a new culture is inoculated using medium from an existing culture. To rule out this being the problem, a fresh culture should be inoculated from an agar plate and tested for fluorescence during log phase. Another possibility is to inoculate from an existing culture by spinning down the cells, washing the pellet with fresh medium (to remove B-lactamase), decant the washing medium and resuspend the cells in new growth medium.
Is the problem with the construct itself/expression of GFP from the plasmid, or with plasmid stability? All cultures tested for GFP fluorescence so far have been "old" (probable stationary phase) or inoculated from "old" cultures. Reports indicate that B-lactamase in old culture media may degrade ampicillin at a high rate and lead to decreased plasmid stability, also when a new culture is inoculated using medium from an existing culture. To rule out this being the problem, a fresh culture should be inoculated from an agar plate and tested for fluorescence during log phase. Another possibility is to inoculate from an existing culture by spinning down the cells, washing the pellet with fresh medium (to remove B-lactamase), decant the washing medium and resuspend the cells in new growth medium.
-
Transformed cells with the part <partinfo>BBa_I13521</partinfo> (pTet mRFP) from the distribution kit and the part BBa_B0034 from miniprep DNA.
+
Transformed cells with the part <partinfo>BBa_I13521</partinfo> (pTet mRFP) from the distribution kit and the part <partinfo>BBa_B0034</partinfo> from miniprep DNA.
===Saturday 21.07.12===
===Saturday 21.07.12===
Line 653: Line 1,132:
Further work on the test construct in J5. Also, Clone was used to simulate cutting and ligating, yielding the sequence of plasmid <partinfo>pSB1A2</partinfo> assembled with constitutive promoter and RBS (<partinfo>BBa_K081005</partinfo>) using the standard BioBrick assembly method outlined at [http://partsregistry.org/Help:Assembly http://partsregistry.org/Help:Assembly].
Further work on the test construct in J5. Also, Clone was used to simulate cutting and ligating, yielding the sequence of plasmid <partinfo>pSB1A2</partinfo> assembled with constitutive promoter and RBS (<partinfo>BBa_K081005</partinfo>) using the standard BioBrick assembly method outlined at [http://partsregistry.org/Help:Assembly http://partsregistry.org/Help:Assembly].
-
LuxI+DTT and LuxR+DTT was transferred to liquid medium for overnight incubation. Miniprepping will be done tomorrow.
+
LuxI+DTT (<partinfo>Bba_C0061</partinfo> and <partinfo>BBa_B0015</partinfo>) and LuxR+DTT (<partinfo>BBa_C0062</partinfo> and <partinfo>BBa_B0015</partinfo>) was transferred to liquid medium for overnight incubation. Miniprepping will be done tomorrow.
We had our weekly meeting with the advisors. A very quick summary can be found in the Dropbox folder.
We had our weekly meeting with the advisors. A very quick summary can be found in the Dropbox folder.
Line 659: Line 1,138:
Inoculated new liquid cultures from existing agar plates of E. coli DH5a cells transformed with the following BioBrick parts/constructs, in preparation for making new plates:
Inoculated new liquid cultures from existing agar plates of E. coli DH5a cells transformed with the following BioBrick parts/constructs, in preparation for making new plates:
-
*pBAD + lysis construct<br>
+
*pBAD + lysis construct (<partinfo>Bba_K206000</partinfo> and <partinfo>BBa_K112808</partinfo>)<br>
*pBAD strong promoter (<partinfo>Bba_K206000</partinfo>)
*pBAD strong promoter (<partinfo>Bba_K206000</partinfo>)
*LuxR (<partinfo>BBa_C0062</partinfo>)<br>
*LuxR (<partinfo>BBa_C0062</partinfo>)<br>
Line 672: Line 1,151:
----
----
-
LuxI and LuxR were cut and ligated with the DTT terminator. LuxI+DTT and LuxR+DTT were thereafter transformed.
+
LuxI (<partinfo>Bba_C0061</partinfo>) and LuxR (<partinfo>BBa_C0062</partinfo>) were cut and ligated with the DTT terminator (<partinfo>BBa_B0015</partinfo>). LuxI+DTT and LuxR+DTT were thereafter transformed.
Colonies of the BioBricks RFP (<partinfo>Bba_E1010</partinfo>), YFP(<partinfo>BBa_E0030</partinfo>), GFP (<partinfo>BBa_K082003</partinfo>), CFP (<partinfo>BBa_E0020</partinfo>) and the constitutive promoter (<partinfo>BBa_K081005</partinfo>) where transferred to liquid medium with amp resistance.  
Colonies of the BioBricks RFP (<partinfo>Bba_E1010</partinfo>), YFP(<partinfo>BBa_E0030</partinfo>), GFP (<partinfo>BBa_K082003</partinfo>), CFP (<partinfo>BBa_E0020</partinfo>) and the constitutive promoter (<partinfo>BBa_K081005</partinfo>) where transferred to liquid medium with amp resistance.  
-
Restriction digestion were performed on Jen1+RBS, VGB+RBS, VHB+RBS and LuxR with the enzymes SpeI and PstI. They are now ready to be ligated together with YFP+DTT and CFP+DTT, to be tested.
+
Restriction digestion were performed on Jen1+RBS (<partinfo>BBa_K284002</partinfo> and <partinfo>BBa_B0034</partinfo>), VGB+RBS (<partinfo>BBa_K561001</partinfo> and <partinfo>BBa_B0034</partinfo>), VHB+RBS (<partinfo>BBa_K258005</partinfo> and <partinfo>BBa_B0034</partinfo>) and LuxR (<partinfo>BBa_C0062</partinfo>) with the enzymes SpeI and PstI. They are now ready to be ligated together with YFP+DTT and CFP+DTT, to be tested.
===Wednesday 11.07.12===
===Wednesday 11.07.12===
Line 698: Line 1,177:
----
----
-
As the restriction cutting of RFP, YFP, GFP and CFP yesterday turned out to be a sucsess, the rest of the samples were run on gel, and the bands containing the fluorescent proteins were cut out and purified using the QIAquick Gel Extraction Kit. Concentrations are given below:
+
As the restriction cutting of RFP (<partinfo>Bba_E1010</partinfo>), YFP (<partinfo>BBa_E0030</partinfo>), GFP (<partinfo>BBa_K082003</partinfo>) and CFP (<partinfo>BBa_E0020</partinfo>) yesterday turned out to be a sucsess, the rest of the samples were run on gel, and the bands containing the fluorescent proteins were cut out and purified using the QIAquick Gel Extraction Kit. Concentrations are given below:
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
Line 718: Line 1,197:
|}
|}
-
The two parallels of the terminator cut yesterday with E+X was purified using the QIAquick PCR purification kit. Concentrations are given below:
+
The two parallels of the terminator (<partinfo>BBa_B0015</partinfo>) cut yesterday with E+X was purified using the QIAquick PCR purification kit. Concentrations are given below:
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
Line 732: Line 1,211:
|}
|}
-
Test cutting of the fluorescent protein parts (RFP, YFP, GFP and CFP) was performed. Results are shown below:
+
Test cutting of the fluorescent protein parts (RFP (<partinfo>Bba_E1010</partinfo>), YFP (<partinfo>BBa_E0030</partinfo>), GFP (<partinfo>BBa_K082003</partinfo>) and CFP (<partinfo>BBa_E0020</partinfo>)) was performed. Results are shown below:
[[File:RFP,_YFP,_GFP,_CFP,_cut_E+X_10.07.12_exp.png|thumb|center|500px|RFP (well 2), YFP (well 3), GFP (well 5) and CFP (well 6) investigated using gel electrophoresis. The lower bands of all samples containing the DNA sequences coding for fluorescent proteins, were cut out of the gel and purified.]]
[[File:RFP,_YFP,_GFP,_CFP,_cut_E+X_10.07.12_exp.png|thumb|center|500px|RFP (well 2), YFP (well 3), GFP (well 5) and CFP (well 6) investigated using gel electrophoresis. The lower bands of all samples containing the DNA sequences coding for fluorescent proteins, were cut out of the gel and purified.]]
Line 751: Line 1,230:
-
The constructs dld+RBS, Jen1+RBS, VGB+RBS and VHB+RBS where all cut once with XbaI and SpeI, and once with an enzyme that has two seats where they digest. Which enzyme used for which construct can be found in the table below.
+
The constructs dld+RBS (<partinfo>BBa_K284003</partinfo> and <partinfo>BBa_B0034</partinfo>), Jen1+RBS (<partinfo>BBa_K284002</partinfo> and <partinfo>BBa_B0034</partinfo>), VGB+RBS (<partinfo>BBa_B0034</partinfo> and <partinfo>BBa_B0034</partinfo>) and VHB+RBS (<partinfo>BBa_K258005</partinfo> and <partinfo>BBa_B0034</partinfo>) where all cut once with XbaI and SpeI, and once with an enzyme that has two seats where they digest. Which enzyme used for which construct can be found in the table below.
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
Line 1,253: Line 1,732:
We recieved emails from Eivind letting us know that we are the ones that have been selected to represent NTNU in iGEM 2012. Everybody is happy!
We recieved emails from Eivind letting us know that we are the ones that have been selected to represent NTNU in iGEM 2012. Everybody is happy!
 +
-->
 +
<html>
</div>
</div>
 +
</html>
 +
{{:Team:NTNU_Trondheim/Templates/Sponsors}}
 +
<html>
 +
</div></div></html>
 +
{{:Team:NTNU_Trondheim/Templates/Footer}}

Latest revision as of 17:15, 25 September 2012

Search and Destroy
Search and Destroy
NTNU IS B.A.C.K.
Bacterial Anti-Cancer-Kamikaze

Notebook Unfiltered notes from the lab


February
Mon Tue Wed Thu Fri Sat Sun
1 2 3 4 5
6 7 8 9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 25
27 28 29
March
Mon Tue Wed Thu Fri Sat Sun
1 2 3 4
5 6 7 8 9 10 11
12 13 14 15 16 17 18
19 20 21 22 23 24 25
26 27 28 29 30
April
Mon Tue Wed Thu Fri Sat Sun
1
2 3 4 5 6 7 8
9 10 11 12 13 14 15
16 17 18 19 20 21 22
23 24 25 26 27 28 29
30
May
Mon Tue Wed Thu Fri Sat Sun
1 2 3 4 5 6
7 8 9 10 11 12 13
14 15 16 17 18 19 20
21 22 23 24 25 26 27
28 29 30 31
June
Mon Tue Wed Thu Fri Sat Sun
1 2 3
4 5 6 7 8 9 10
11 12 13 14 15 16 17
18 19 20 21 22 23 24
25 26 27 28 29 30 31
July
Mon Tue Wed Thu Fri Sat Sun
1
2 3 4 5 6 7 8
9 10 11 12 13 14 15
16 17 18 19 20 21 22
23 24 25 26 27 28 29
30 31
August
Mon Tue Wed Thu Fri Sat Sun
1 2 3 4 5
6 7 8 9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 26
27 28 29 30 31
September
Mon Tue Wed Thu Fri Sat Sun
1 2
3 4 5 6 7 8 9
10 11 12 13 14 15 16
17 18 19 20 21 22 23
24 25 26 27 28 29 30

Click on a month name or date to view the respective notebook entries. For information on plasmids and DNA mentioned in the notebook, see Stocks and Constructs. For explanations of abbreviations used, click here.


Retrieved from "http://2012.igem.org/Team:NTNU_Trondheim/Notebook"