"
User comments
Prof. Huang Wei (HongKong University)
I have played a little with your web tool a little. It is pretty smooth. I guess that you don’t want to show all your findings in this website, such as predicted better terminators, and their hierarchy etc. It would be nice if you could link it to your wiki (or something) to explain your model, and the meaning of the results for three algorithms.
Please feel free to ask if you have more to discuss. I will try to find if any student is around to test your website.
Dr.Ying-Ja Chen ( Synthetic Biology Center, MIT )
It is exciting to see your webtool online. Good job! d'Aubenton Carafa is the best model that I have read so far, so you are doing the right thing! I have tested the webtool briefly.
I have tried a few terminators using the TTEC run and it works!
There seems to be some problem with the web interface. It often gives this error:
Bad Request (Invalid Hostname)
And the address bar shows this: http://50.115.135.169/
However, I haven't figured out how to upload SBOL sequences. Maybe you can clarify on that.
2012 iGEM team: Shenzhen
Hi, I am K2, the instructor of Team Shenzhen. As I am a researcher in C.Dog project, I have tested some well measured terminators in C.Dog, via TTEC. As the algorithm of TTEC is being advanced, the simulation results seem to be much more reliable now. Furthermore, as part of our iGEM project YAO#1.0, younsters in our team have annoted several terminators in yeast mitochondiral genome. Then we caculate the termination efficency and 2nd structure via TTEC, and we wish the data can be vertified by our on-going experiments :)
2012 iGEM team: Shenzhen-SUSTC-A
We are glad to use your TTEC. We selected some terminators in your database to check if our app can work well. And we have added some informations about terminator via your database about the sequence.
What's more, we have played your calculator to calculate the terminator efficiency, the structure picture is cute and great:), and the efficiency is close to our database. But there are some bugs in your website about those links, like"About us". A great software to have fun, haha~! Captain.Tong of App-team.
2012 iGEM team: OUC
I have tested TTEC using our small RNA endogenous terminator,spot42 scaffold.
*Can this tool help your team?
We calculated spot42 scaffold terminator efficiency using algorithm1 (90%,medium?),which meets our explanation on some unexpected experimental results.
Some evidence suggests the terminator is not very strong: when induces Spot42 in the upstream of GFP_Generator with very high aTc concentration, the GFP level soared to a very high level(even higher than GFP_generator alone), made it elusive on this paradox.
seq:ATTTGGCTGAATATTTTAGCCGCCCCAGTCAGTAATGACTGGGGCGTTTTTTAT
*How does it help you?
It shed some light on the unexpected result theoretically.
*If you have any suggestion(such as interface or the tool), please feel free to tell us.
1/I'm wondering if there is any chance that you could present easy-to-understand guidiance on the homepage? And it will be better to make comparsions to other similar tools.
2/The efficiency label of algorithm2 or 3 doesn't work well on chrome.
Good job!
