Team:Westminster/Experiments

From 2012.igem.org

(Difference between revisions)
 
(16 intermediate revisions not shown)
Line 11: Line 11:
}
}
body {
body {
-
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif;  
+
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif;  
font-weight: 300;
font-weight: 300;
-
background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;
+
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/
 +
background-color:#FFF;
color: #666666;
color: #666666;
 +
}
}
-
h1, h2 {
+
h1 {
color: #ff0000;
color: #ff0000;
font-size: 18pt;
font-size: 18pt;
margin-bottom: 0.5em;
margin-bottom: 0.5em;
-
}
+
-
h2 {
+
 
-
font-size: 16pt;
+
-
}
+
-
h3 {
+
-
color: #ff0000;
+
}
}
p {
p {
Line 39: Line 37:
div#content {
div#content {
box-shadow: 0px 0px 17px -4px #666666;
box-shadow: 0px 0px 17px -4px #666666;
 +
padding:0px;
 +
margin-top:0px;
 +
}
}
div#wrapper {
div#wrapper {
position: relative;
position: relative;
-
width: 885px;
+
width: 100%;
font-size: 12pt;
font-size: 12pt;
-
padding: 50px 40px;
 
margin: 0 auto;
margin: 0 auto;
background: #ffffff;
background: #ffffff;
 +
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');
 +
background-repeat: no-repeat;
 +
 +
padding:0px;
 +
margin-top:0px;
 +
top:0px;
 +
}
}
div#header {
div#header {
-
height: 185px;
+
height: 120px;
 +
width: 100%;
 +
background-color:#000;
 +
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');
 +
background-repeat: no-repeat;
 +
z-index:10;
 +
position:relative;
 +
top:0px;
 +
left:0px;
}
}
div#header div#logo {
div#header div#logo {
position: relative;
position: relative;
-
width: 400px;
+
width: 260px;
-
height: 125px;
+
right:10px;
-
margin: 0 auto;
+
top:-9px;
 +
float:right;
 +
 
 +
margin-bottom: 0px;
 +
/*
 +
height: 0px;
 +
margin: 0 auto;*/
}
}
-
div#header div#logo {
+
div#header div#logo a {
-
margin-bottom: 20px;
+
float:left;
 +
display:block;
 +
margin-left:10px;
 +
 
}
}
 +
 +
div#navigation {
div#navigation {
-
width: 100%;
+
width: 850px;
-
height: 40px;
+
height: 27px;
-
background: #000000;
+
background:rgba(0,0,0,.5);
 +
float:left;
 +
position:relative;
 +
top:54px;
}
}
ul#navigation-list {
ul#navigation-list {
-
height: 40px;
+
height: 27px;
-
line-height: 40px;
+
line-height: 27px;
-
overflow: hidden;
+
overflow: auto;
}
}
ul#navigation-list > li {
ul#navigation-list > li {
float: left;
float: left;
 +
margin-top:-5px;
}
}
ul#navigation-list > li > ul {
ul#navigation-list > li > ul {
Line 83: Line 113:
}
}
ul#navigation-list > li > ul.submenu li {
ul#navigation-list > li > ul.submenu li {
-
padding: 5px 0px;
+
padding: 2px 0px;
}
}
ul#navigation-list a.navlink {
ul#navigation-list a.navlink {
color: #ffffff;
color: #ffffff;
-
font-weight: bold;
+
font-weight: normal;
display: block;
display: block;
-
padding: 0px 14px;
+
padding: 0px 10px;
text-decoration: none;
text-decoration: none;
}
}
Line 98: Line 128:
div#home-main-image {
div#home-main-image {
text-align: center;
text-align: center;
 +
background-color: #410000;
 +
 +
border-bottom:1px #000 solid;
 +
}
 +
div#the-content {
 +
position:relative;
 +
top:-19px;
 +
}
}
div#home-main-image img {
div#home-main-image img {
-
width: 885px;
+
/*width: 885px;
height: 300px;
height: 300px;
margin-bottom: 20px;
margin-bottom: 20px;
border-radius: 20px;
border-radius: 20px;
 +
*/
}
}
div.text-box {
div.text-box {
Line 110: Line 149:
padding: 15px 20px;
padding: 15px 20px;
border-radius: 10px;
border-radius: 10px;
-
}
+
-
div.three-columns {
+
-
padding-left: 20px;
+
-
overflow: auto;
+
-
}
+
-
div.column, img.column {
+
-
float: left;
+
-
width: 235px;
+
-
margin: 10px 0px 50px 20px;
+
-
border-radius: 10px;
+
}
}
div#footer-box {
div#footer-box {
border-radius: 0 0 5px 5px;
border-radius: 0 0 5px 5px;
 +
}
 +
#bodyContent {
 +
}
 +
#three-column
 +
{
 +
margin:0 auto;
 +
width:850px;
 +
margin-top:50px;
 +
 +
}
 +
 +
.col
 +
{
 +
text-align:justify; float:left; margin:5px;
 +
}
 +
.col h1
 +
{
 +
font-size:14px;
 +
color:#000;
 +
 +
}
 +
/* hide native rubbish*/
 +
#top-section {display:none; position:absolute; left:0px; top:-200px;}
 +
#top-section a { color:#FFF; }
 +
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}
 +
.annoying-gap {
 +
padding:0px;
 +
margin:0px;
 +
line-height:0;
 +
}
 +
 +
#contentSub, #siteSub {display:none;}
 +
 +
#control-btn
 +
{
 +
 +
width: 20px;
 +
height: 20px;
 +
position:absolute;
 +
top:0px;
 +
left:5px;
 +
 +
line-height: 0px;
 +
 +
 +
}
 +
.btn-cog {
 +
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat  2px 2px;
 +
}
 +
.btn-close {
 +
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png')  #000 no-repeat  2px 2px;
 +
}
 +
.right-menu li a, .left-menu li a {background: none}
 +
 +
#home-main-text {
 +
padding:20px 40px 20px 40px;
 +
text-align: justify;
 +
}
 +
.diary-date {
 +
font-weight: bold;
 +
width:100%;
 +
 +
}
 +
#home-main-text ul li
 +
{
 +
list-style-image: url('https://static.igem.org/mediawiki/2012/4/43/Tickmark.png');
 +
}
}
</style>
</style>
Line 129: Line 226:
<script type="text/javascript">
<script type="text/javascript">
$('document').ready(function() {
$('document').ready(function() {
-
$('li.submenu-holder').hover(function() {
+
-
$(this).children('ul.submenu').stop(true).fadeIn('slow');
+
// menu
-
}, function() {
+
$('li.submenu-holder').hover(function() {
-
$(this).children('ul.submenu').stop(true).fadeOut('slow');
+
$(this).children('ul.submenu').stop(true).fadeIn('fast');
 +
}, function() {
 +
$(this).children('ul.submenu').stop(true).fadeOut('fast');
 +
});
 +
 
 +
              // hide standard team basics
 +
              $('#top-section').hide();
 +
  $('#bodyContent p:first').addClass("annoying-gap");
 +
 
 +
 +
$('#control-btn').click( function(){
 +
 +
if ($('#control-btn').hasClass("btn-cog"))
 +
{
 +
showTopMenu();
 +
$('#control-btn').animate({left: "-20px"});
 +
$('#control-btn').addClass("btn-close");
 +
$('#control-btn').removeClass("btn-cog");
 +
} else
 +
{
 +
hideTopMenu();
 +
$('#control-btn').animate({left: "0px"});
 +
$('#control-btn').addClass("btn-cog");
 +
$('#control-btn').removeClass("btn-close");
 +
}
});
});
 +
});
});
 +
 +
 +
 +
 +
var $bar;
 +
function hideTopMenu()
 +
{
 +
$bar.slideUp('fast');
 +
 +
}
 +
function showTopMenu()
 +
{
 +
if ($bar==null)
 +
{
 +
$bar = $("#top-section").clone();
 +
$($bar.find("#search-controls")).remove();
 +
$($bar.find("#p-logo")).remove();
 +
$("#wrapper").prepend($bar);
 +
$bar.css("position", "absolute");
 +
$bar.css("top", "0px");
 +
$bar.css("left", "0px");
 +
$bar.css("background", "none");
 +
$bar.css("background", "rgba(0,0,0,.5)");
 +
$bar.css("height", "20px");
 +
$bar.css("border", "none");
 +
$bar.css("z-index", "100");
 +
$bar.css("color", "#000");
 +
 +
 +
}
 +
$bar.slideDown('fast');
 +
 +
$('#control-btn').mouseover( function(){
 +
 +
});
 +
}
</script>
</script>
-
 
</head>
</head>
<body>
<body>
-
 
<div id="wrapper">
<div id="wrapper">
<div id="header">
<div id="header">
-
<div id="logo">
+
  <div id="control-btn" class="btn-cog"></div>
-
<a href="https://2012.igem.org/Team:Westminster">
+
 
-
<img src="https://static.igem.org/mediawiki/2012/1/1e/Westminster-logo.png" alt="iSTEM" title="Back to home!" />
+
-
</a>
+
-
</div><!-- #logo -->
+
<div id="navigation">
<div id="navigation">
<ul id="navigation-list">
<ul id="navigation-list">
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li>
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li>
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li>
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li>
-
<li><a href="https://igem.org/Team.cgi?year=2012&team_name=Westminster"class="navlink">Team Profile</a></li>
 
<li class="submenu-holder">
<li class="submenu-holder">
-
<a href="https://2012.igem.org/Team:Westminster/Project/Overview"class="navlink active">Project</a>
+
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a>
 +
 
<ul class="submenu">
<ul class="submenu">
-
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Overview</a></li>
+
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li>
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li>
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li>
-
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li>
+
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink active">Experiments</a></li>
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li>
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li>
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li>
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li>
 +
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li>
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li>
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li>
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li>
 +
                         
 +
                 
</ul>
</ul>
</li>
</li>
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li>
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li>
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li>
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li>
-
<li><a href="https://2012.igem.org/Team:Westminster/Notebook"class="navlink">Notebook</a></li>
+
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li>
-
<li><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li>
+
                    <li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li>
 +
 
 +
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li>
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li>
</ul><!-- #navigation-list -->
</ul><!-- #navigation-list -->
</div><!-- #navigation -->
</div><!-- #navigation -->
 +
            <div id="logo">
 +
                    <a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a>
 +
<a href="https://2012.igem.org/Team:Westminster">
 +
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" />
 +
</a>
 +
</div><!-- #logo -->
</div><!-- #header -->
</div><!-- #header -->
<div id="the-content">
<div id="the-content">
<div id="home-main-image">
<div id="home-main-image">
-
<img src="https://static.igem.org/mediawiki/2012/4/4d/Westminster_team.png" alt="Welcome" title="Welcome to our home!" />
+
<img src="https://static.igem.org/mediawiki/2012/0/0c/Lab.png" alt="Welcome" width="965" height="518" title="Welcome to our home!" />
</div><!-- #home-main-image -->
</div><!-- #home-main-image -->
<div id="home-main-text">
<div id="home-main-text">
-
<h1>BIOINFORMATICS</h1>
+
<h2>Promoter Sequence Identification</h2>
-
<h2>Promoter Seqeunce Identification</h2>
+
<p>The team isolated regions of approximately 1kbp where the gene promoter was likely to be found. These were compared with commercial promoters (if available) and European Promoter database (EPD). The promoter sequences that appeared on the EPD site have been experimentally analysed, and also did not contain any illegal sites. Thus they were selected, in case of ADH1A1 and ALDH3A1. ALDH1A3 identified by the team had no illegal site, so it was maintained. However, ALDH2 promoter sequence on the EPD site was too small to be included. Therefore a commercial promoter of ALDH2 was selected.</p>
<p>The team isolated regions of approximately 1kbp where the gene promoter was likely to be found. These were compared with commercial promoters (if available) and European Promoter database (EPD). The promoter sequences that appeared on the EPD site have been experimentally analysed, and also did not contain any illegal sites. Thus they were selected, in case of ADH1A1 and ALDH3A1. ALDH1A3 identified by the team had no illegal site, so it was maintained. However, ALDH2 promoter sequence on the EPD site was too small to be included. Therefore a commercial promoter of ALDH2 was selected.</p>
<p>The following gives an example of how a promoter sequences were identified by the iSTEM team:</p>
<p>The following gives an example of how a promoter sequences were identified by the iSTEM team:</p>
Line 191: Line 354:
<p>TAATAA= TATA box </p>  
<p>TAATAA= TATA box </p>  
<p>GCTGCATACetc = the 5’UTR region.</p>
<p>GCTGCATACetc = the 5’UTR region.</p>
-
<p> The promoter includes elements of the 5’UTR plus the grey sequence upstream of it, up to and including the yellow region coding for the forward primer (about 1,000bp in total.</p>  
+
<p> The promoter includes elements of the 5’UTR plus the grey sequence upstream of it, up to and including the yellow region coding for the forward primer (about 1,000bp in total).</p>  
<p> ATGTCATCCetc = start of gene at -75567940 approx  
<p> ATGTCATCCetc = start of gene at -75567940 approx  
</p>
</p>
 +
<p> F: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCATCATATGACTTTTTTCAAC </p>
 +
<p> R: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTCTGATTCGGCTCCTGGAA </p>
 +
<img src="https://static.igem.org/mediawiki/2012/7/75/Aldh1a1_promoter.png" alt="ALDH1A1 directions" title="1A1" width="545" height="141" />
 +
<p> The promoter sequences identified are represented below:</p>
-
</div><!-- #home-main-text -->
+
<p> ALDH1A1 (552BP)</p>
 +
<img src="https://static.igem.org/mediawiki/2012/e/e4/Box_2.png" alt="ALDH1A1 directions" title="1A1" width="452" height="132" />
 +
 
 +
<p> ALDH2 (903BP)</p>
 +
<img src="https://static.igem.org/mediawiki/2012/6/60/Box3.png" alt="ALDH1A1 directions" title="1A1" width="452" height="162" />
 +
 
 +
<p> ALDH1A3 (932BP)</p>
 +
<img src="https://static.igem.org/mediawiki/2012/f/f3/Box4.png" alt="ALDH1A1 directions" title="1A1" width="452" height="194" />
 +
 
 +
<p> ALDH3A1 (600BP)</p>
 +
<img src="https://static.igem.org/mediawiki/2012/3/31/Box5.png" alt="ALDH1A1 directions" title="1A1" width="452" height="137" />
 +
<h2>Primer Design</h2>
 +
<p>The primers for these sequences were designed using Gingko bioworks part design tool that allows the sequences to be flanked with biobrick suffix and prefix. The primers are represented in the table below:</p>
 +
<img src="https://static.igem.org/mediawiki/2012/e/e5/Primer_table1.png" alt="ALDH1A1 directions" title="1A1" width="432" height="302" />
 +
<h2>Experimental Design</h2>
 +
<h3>Experiment 1:Identification</h3>
 +
<p>This experiment is designed to help in identifying cancer stem cells from normal cancer cells, by using their ability to characteristically express ALDH.  The genetic construct resulting from this experiment would contain fluorescent reporters and a bacterial selection marker. Only stem cells with ALDH activity will be express ALDH promoter activity resulting in Fluorescence of those cells. These cells can be visually identified.</p>
 +
<img src="https://static.igem.org/mediawiki/2012/7/76/Construct_1.png" alt="ALDH1A1 directions" title="1A1" width="490" height="425" />
 +
<h3>Experiment 2:Isolation</h3>
 +
<p>The second part of the experiment is designed to isolate the cancer stem cells form normal cells by rendering them resistance to antibiotics. Neomycin was used as the mammalian selection marker. When grown in a medium containing the corresponding antibiotic, only those cells with resistance will survive.</p>
 +
<img src="https://static.igem.org/mediawiki/2012/9/99/Construct2_%282%29.png" alt="ALDH1A1 directions" title="1A1" width="476" height="437" />
 +
<h3>Experiment 3:Destruction</h3>
 +
<p>The final part of the experiment is to make a construct that will help to destroy the cancer stem cells. The antibiotic resistance marker will be flanked with two lox sites that will be excised in the presence of cre recombinase. The cre will be induced by the presence of doxycycline in the medium.</p>
 +
<img src="https://static.igem.org/mediawiki/2012/c/c4/Construct3_%282%29.png" alt="ALDH1A1 directions" title="1A1" width="476" height="430" />
 +
<h2>Assembly Strategy </h2>
 +
<p>The assembly strategy followed in the project is ‘Plug and Play’, developed by DTU.
 +
This strategy was chosen as this considerably reduces cloning time and helps in
 +
focusing on the experiment strategy. The primers (linkers) for each part of each
 +
experiment were generated using the software PHUSER version1.2. Care was taken
 +
to ensure that the construct in its entirety, and the promoters was flanked by biobrick
 +
prefix and suffix.</p>
 +
<img src="https://static.igem.org/mediawiki/2012/c/cf/Linkers%27.png" alt="ALDH1A1 directions" title="1A1" width="482" height="259" />"
 +
 
 +
 
 +
 
 +
 
 +
 
 +
  </div><!-- #home-main-text -->
</div><!-- #the-content -->
</div><!-- #the-content -->
Line 203: Line 407:
</body>
</body>
-
 
</html>
</html>

Latest revision as of 23:44, 26 September 2012

Welcome

Promoter Sequence Identification

The team isolated regions of approximately 1kbp where the gene promoter was likely to be found. These were compared with commercial promoters (if available) and European Promoter database (EPD). The promoter sequences that appeared on the EPD site have been experimentally analysed, and also did not contain any illegal sites. Thus they were selected, in case of ADH1A1 and ALDH3A1. ALDH1A3 identified by the team had no illegal site, so it was maintained. However, ALDH2 promoter sequence on the EPD site was too small to be included. Therefore a commercial promoter of ALDH2 was selected.

The following gives an example of how a promoter sequences were identified by the iSTEM team:

ALDH1A1

ALDH1A1 directions

Directionality:5-3

ALDH1A1 directions

TAATAA= TATA box

GCTGCATACetc = the 5’UTR region.

The promoter includes elements of the 5’UTR plus the grey sequence upstream of it, up to and including the yellow region coding for the forward primer (about 1,000bp in total).

ATGTCATCCetc = start of gene at -75567940 approx

F: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCATCATATGACTTTTTTCAAC

R: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTCTGATTCGGCTCCTGGAA

ALDH1A1 directions

The promoter sequences identified are represented below:

ALDH1A1 (552BP)

ALDH1A1 directions

ALDH2 (903BP)

ALDH1A1 directions

ALDH1A3 (932BP)

ALDH1A1 directions

ALDH3A1 (600BP)

ALDH1A1 directions

Primer Design

The primers for these sequences were designed using Gingko bioworks part design tool that allows the sequences to be flanked with biobrick suffix and prefix. The primers are represented in the table below:

ALDH1A1 directions

Experimental Design

Experiment 1:Identification

This experiment is designed to help in identifying cancer stem cells from normal cancer cells, by using their ability to characteristically express ALDH. The genetic construct resulting from this experiment would contain fluorescent reporters and a bacterial selection marker. Only stem cells with ALDH activity will be express ALDH promoter activity resulting in Fluorescence of those cells. These cells can be visually identified.

ALDH1A1 directions

Experiment 2:Isolation

The second part of the experiment is designed to isolate the cancer stem cells form normal cells by rendering them resistance to antibiotics. Neomycin was used as the mammalian selection marker. When grown in a medium containing the corresponding antibiotic, only those cells with resistance will survive.

ALDH1A1 directions

Experiment 3:Destruction

The final part of the experiment is to make a construct that will help to destroy the cancer stem cells. The antibiotic resistance marker will be flanked with two lox sites that will be excised in the presence of cre recombinase. The cre will be induced by the presence of doxycycline in the medium.

ALDH1A1 directions

Assembly Strategy

The assembly strategy followed in the project is ‘Plug and Play’, developed by DTU. This strategy was chosen as this considerably reduces cloning time and helps in focusing on the experiment strategy. The primers (linkers) for each part of each experiment were generated using the software PHUSER version1.2. Care was taken to ensure that the construct in its entirety, and the promoters was flanked by biobrick prefix and suffix.

ALDH1A1 directions"

Retrieved from "http://2012.igem.org/Team:Westminster/Experiments"