2. GFP emits its green light byactivation with UV (364 nm) and the light is transferred to the other test tube through an optical fiber.
↓

mf.Lon+LVA tag is expressed and GFP is degraded by the Lon protease.

4. mf.Lon+LVA tag is degraded by ClpX preexisting in E. coli

We are trying to draw a movie of a firework that goes upward and bursts scattering light-emitting pieces. The basic green light sensor needs two plasmids.pPLPCB provides a light-sensing molecule that binds to CcaS molecule. pJT118 harbors the genes for CcaS and CcaR and the reporter lacZ gene under the control of the PcpcG2 promoter. CcaS activates　PcpcG2,when the light-sensing molecule catches green light, by activating phosphorylation of CcaR. We will substitute the lacZ gene with the GFP gene. Therefore, our green sensor should produce GFP in reaponse to green light.

We will draw, with E. coli harboring pPLPCB and the GFP-substituted pJT118,a picture of a trajectory of a rising firework on an ager plate, and will “fire”with a pilot light at the bottom. Under the blue LED light(or weak UV light),the bottom part of the picture should begin to emit green light that should activate the neighboring bacteria. Because the GFP has a degradation tag, the emission will stop soon. It is exposed that, as a result, the green light will move upward along the trajectory until it reaches the top.

At the top, we put E.coli with pPLPCB and an RFP-substituted pJT118.This will sense the green light coming from the neighboring bacteria and emit red light.

At the last, we put E.coli with pPLPCB and an RFP-substituted pJT106b. This will sense the red light coming from the neighboring bacteria and emit red light.

With these plasmids, we believe that we could draw movie pictures on an ager plate canvas. Our first one would be that of a firework in which a ball of green light would go straight upward and burst, scattering lines of red light. The data for the plasmid construction experiments are shown below.

1.We amplified a sequence in pJT118 spanning almost all of the plasmid except the region of the lacZ ORF, by PCR with KOD Fx Neo. (using the primers GCGGCCGCTCGAGTCTAATTTTTTTG and ATCTATCATAGATAAAGTTAGTAATTAAAC). The 5780bp fragment was obtained and gel-purified.

2.We amplified the sequence of the GFP ORF from BioBrick (BBa-E0040) using the primers CTTTATCTATGATAGATATGCGTAAAGGAGAAGAACTT and GACCTGAGCGGCCGCTTTGTATAGTTCATCCATGCCAT.The 750bp fragment was gel-purified.

3.We put the fragment from 1 and 2 together by the InFusion svstem (Clontech). The miniprep plasmid sample from acolony was checked by agarose gel electrophoresis (Figure1,the middlelabeled as118+GFP). The other plasmids were constructed in almost the same way, and checked on agarose gels (Figures 1and 2).

We transformed JT2 (ΔEnvZ strain) with the plasmids and picked up an individual colony to put into liquid medium. Incubation with shaking at 37℃ was continued for 42 hours. We expected that the E. coli under white light will express GFP or RFP, and on the other hand, the E. coli under Dark will not express them. Unfortunately, we were not able to see that the E. coli having pJT118 (GFP and RFP) worked.

We wanted to try to find the best condition for GFP or RFP expression (green sensor), but time was running out, so we decided to use the red light sensor only for our project.

・On plate

To investigate the condition for expression of RFP, We incubated JT2 transformed with three plasmids (106b+RFP, cph8, and pPLPCB) with shaking at 37℃ for 16 hours, exposing white light to them. After centrifugation, the bacteria were plated on M9 agar and were incubated for 24 hours under three different conditions (at room temperature).
1. Red light
2. White light
3. Dark
Result → RFP was expressed under the all condition.　

・Make E.co-Domino

Purpose: To measure time required for activation of the red light sensor by RFP light.
We useed JT2 transformed with the plasmids(106b+RFP,cph8, and pPLPCB). It was first incubated with shaking incubate on 37℃ was constituted for 12 hours in LB medium. After centrifugation, the medium was replaced with 100μL of buffer(MQ). The samples were put into the wells of a microtiter plate. They were observed under a UV light. We tried this experiment under two different conditions.
1.Exposing UV
2.Dark
Result
RFP was expressed in 9 hours.

0hour→9hour

Result and Discussion

・Compare the time for expressing RFP from the different cells ( cell (1)-(3) ).

The cells are named (1)-(3) on above the picture.

(1) The E.coli on the top of E.coli expressing RFP (RFP-E.coli)
(2)The E.coli on the right of (1)
(3) The E.coli on the right of RFP-E.coli

RFP was expressed on the center of the cell.

Table2. The assay of E.co-Domino

(1)	(2)	(3)
7 hours	9 hours	10 hours

In comparison with the cell (2), the amount of RFP in the cell (3) was more. Also, the cell (1) and cell (2) expressed RFP. From the result above, we found that the red sensor genes are induced by UV (364 nm) and UV+RFP. Furthermore, the condition of RFP+UV is more effective for red sensor genes than UV only.

Therefore, E.co-Domino will be realized by the red light sensor system.

=== The Experiments ===

E.cold-heat Sensing System

・Heat Shock Sensor

This is a sensor that promotes expression of RFP at a particular temperature. We made two plasmids. One produces a signaling molecule, and the other receives the signaling molecule. The plasmids that produces the signaling molecule has a heat shock promoter(HSP). Transcription of luxI gene is regulated by a HSP. LuxI produces OHHL(3OC6HSL). The other plasmid has Ptet promoter and transcription of the luxR gene is constitutively regulated by the promoter. The luxR protein binds to OHHL upregurates and upregulated the luxpR promoter, causing transcription of the mCherry reporter.

・Cold Shock Sensor

This is a sensor that promotes expression of GFP a particular temperature. The sensor also consists of two plasmids. The plasmid that produces signaling molecule has a cold shock promoter(CSP). Transcription of the lasI gene is regulated by a CSP. LasR produces 3OC12-HSL. The other plasmid has a constitutive promoter upstream, transcription of the lasR gene is regulated by the promoter. The lasR protein binds to 3OC12-HSL and upregulates the laspR promoter, causing transcription of the GFP.

Figure1 Figure2
　　　　　PlasmidⅠ　　　　　　　　　　　　　　　 　 　　PlasmidⅡ
Figure3 Figure4
　　　　　PlasmidⅢ　　　　　　　　　　　　　　　 　 　　PlasmidⅣ

'''Heat Shock Sensor'''

Plasmid 1 (Fig.1） was made for BBa_K338081 and BBa_C0261 by ligation.

'''Cold Shock Sensor'''

Plasmid 2 (Fig.2 BBa_K794000) was made for BBa_S03878 and BBa_K328001 by ligation.

And we are planning to replace the origin(rep(pMB1)) of Plasmid 2 with the origin(p15A) of pPLPCB(S) by the InFusion system (Clontech).

Plasmid 4 (Fig.1) was made from BBa_S03878 and BBa_K328001 by repetition of the InFusion recombination (primer list 1～5).

Retrieved from "http://2012.igem.org/Team:Ehime-Japan/Project"