Team:Evry/Freezer
From 2012.igem.org
(Difference between revisions)
Chr.karine (Talk | contribs) |
|||
Line 41: | Line 41: | ||
<tr style="background: #ccccff; text-align: center;"> | <tr style="background: #ccccff; text-align: center;"> | ||
- | <td width="5%"> | + | <td width="5%"> Code |
</td><td width="10%"> Name | </td><td width="10%"> Name | ||
</td><td width="25%"> Sequence | </td><td width="25%"> Sequence | ||
Line 411: | Line 411: | ||
<tr style="background: #ccccff; text-align: center;"> | <tr style="background: #ccccff; text-align: center;"> | ||
- | <td width=" | + | <td width="5%"> Code |
- | </td><td width=" | + | </td><td width="5%"> Name |
</td><td width="5%"> Length | </td><td width="5%"> Length | ||
+ | </td><td width="5%"> Concentration (ng/ul) | ||
</td><td width="5%"> Species of origin | </td><td width="5%"> Species of origin | ||
</td><td width="5%"> Expression domain | </td><td width="5%"> Expression domain | ||
</td><td width="5%"> Restriction sites (EcoRI, XbaI, SpeI, PtsI) | </td><td width="5%"> Restriction sites (EcoRI, XbaI, SpeI, PtsI) | ||
</td><td width="5%"> Reference | </td><td width="5%"> Reference | ||
+ | </td><td width="100"> Sequence | ||
<tr style="background: #cccccc;"> | <tr style="background: #cccccc;"> | ||
- | <td style="background: #ccffcc;"> | + | <td style="background: #ccffcc;">Promo 1 |
- | </td><td | + | </td><td>p2 Xlurp |
</td><td>5273bp | </td><td>5273bp | ||
+ | </td><td>177,1 | ||
</td><td>Xenopus Laevis | </td><td>Xenopus Laevis | ||
</td><td>Myeloid cells | </td><td>Myeloid cells | ||
</td><td>/ | </td><td>/ | ||
</td><td>Smith et al., 2002 | </td><td>Smith et al., 2002 | ||
+ | </td><td>Sequence | ||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 2 | ||
+ | </td><td>p2 CMV | ||
+ | </td><td>1016bp | ||
+ | </td><td>65,3 | ||
+ | </td><td>Cytomegalovirus | ||
+ | </td><td>Widespread | ||
+ | </td><td>/ | ||
+ | </td><td>Werdien et al., 2001 | ||
+ | </td><td>Sequence | ||
+ | |||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 3 | ||
+ | </td><td>p2 Flk-1 | ||
+ | </td><td>2723bp | ||
+ | </td><td>54 | ||
+ | </td><td>Xenopus Laevis | ||
+ | </td><td>Vasculature | ||
+ | </td><td>/ | ||
+ | </td><td>Doherty et al., 2007 | ||
+ | </td><td>Sequence | ||
+ | |||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 4 | ||
+ | </td><td>p2 14xUAS E1b-ATG | ||
+ | </td><td>454bp | ||
+ | </td><td>93,7 | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td>Xba1 | ||
+ | </td><td> | ||
+ | </td><td>Sequence | ||
+ | |||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 5 | ||
+ | </td><td>p2 ROSA26 | ||
+ | </td><td>814bp | ||
+ | </td><td>55,7 | ||
+ | </td><td>Mus musculus | ||
+ | </td><td>Widespread | ||
+ | </td><td>/ | ||
+ | </td><td>Gross et al., 2006 | ||
+ | </td><td>Sequence | ||
+ | |||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 6 | ||
+ | </td><td>p2 foxi short | ||
+ | </td><td>2020bp | ||
+ | </td><td>105,9 | ||
+ | </td><td>Xenopus Tropicalis | ||
+ | </td><td>Ionocytes | ||
+ | </td><td>/ | ||
+ | </td><td>Unpublished results | ||
+ | </td><td>Sequence | ||
+ | |||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 7 | ||
+ | </td><td>p2 UASt | ||
+ | </td><td>341bp | ||
+ | </td><td>64,8 | ||
+ | </td><td>Saccharomyces cerevisiae | ||
+ | </td><td>GAL4 inductible | ||
+ | </td><td>/ | ||
+ | </td><td> | ||
+ | </td><td>Sequence | ||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 8 | ||
+ | </td><td>p2 HB9 | ||
+ | </td><td>3142bp | ||
+ | </td><td>48,1 | ||
+ | </td><td>Danio rerio | ||
+ | </td><td>Motor neurons | ||
+ | </td><td>PtsI | ||
+ | </td><td>Flanagan-Street et al., 2005 | ||
+ | </td><td>Sequence | ||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 9 | ||
+ | </td><td>p2 pax6 | ||
+ | </td><td>bp | ||
+ | </td><td>58,9 | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td>Sequence | ||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 10 | ||
+ | </td><td>p2 NBT | ||
+ | </td><td>3481bp | ||
+ | </td><td>168,7 | ||
+ | </td><td>Xenopus Laevis | ||
+ | </td><td>Differentiated neurons | ||
+ | </td><td>EcoRI | ||
+ | </td><td>Huang et et al., 2007 | ||
+ | </td><td>Sequence | ||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 11 | ||
+ | </td><td>p2 LMO2 long | ||
+ | </td><td>4730bp | ||
+ | </td><td>170,1 | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td>Sequence | ||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 12 | ||
+ | </td><td>p2 pax3 | ||
+ | </td><td>2916bp | ||
+ | </td><td>109,5 | ||
+ | </td><td>Xenopus Laevis | ||
+ | </td><td>Neural ectoderm | ||
+ | </td><td> | ||
+ | </td><td>Unpublished results | ||
+ | </td><td>Sequence | ||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 13 | ||
+ | </td><td>p2 vimentin | ||
+ | </td><td>7205bp | ||
+ | </td><td>187,4 | ||
+ | </td><td>Xenopus Tropicalis | ||
+ | </td><td>Neural progenitor/glia | ||
+ | </td><td> | ||
+ | </td><td>Love et al., 2011 | ||
+ | </td><td>Sequence | ||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 14 | ||
+ | </td><td>p2 Brachyury | ||
+ | </td><td>3856bp | ||
+ | </td><td>103,6 | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td>Sequence | ||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 15 | ||
+ | </td><td>p2 CMG long | ||
+ | </td><td> | ||
+ | </td><td>92,4 | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td>Sequence | ||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 16 | ||
+ | </td><td>p2 LMO2 short | ||
+ | </td><td>2007bp | ||
+ | </td><td>88,3 | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td>Sequence | ||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 17 | ||
+ | </td><td>p2 Ef1a | ||
+ | </td><td>528bp | ||
+ | </td><td>128,9 | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td>Sequence | ||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 18 | ||
+ | </td><td>p2 Hsp70 | ||
+ | </td><td>487bp | ||
+ | </td><td>62,5 | ||
+ | </td><td>Xenopus Laevis | ||
+ | </td><td>Heat shock inductible | ||
+ | </td><td>PrsI | ||
+ | </td><td>Beck et al., 2003 | ||
+ | </td><td>Sequence | ||
+ | |||
+ | <tr style="background: #cccccc;"> | ||
+ | <td style="background: #ccffcc;">Promo 19 | ||
+ | </td><td>pCAR (eGFP) | ||
+ | </td><td>bp | ||
+ | </td><td>2900 | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td> | ||
+ | </td><td>Sequence | ||
</table> | </table> | ||
Revision as of 14:35, 6 August 2012
Freezer
Primers
Code | Name | Sequence | Length | Tm | %GC | Comments | Date |
P1 | Tir1-BB-FW | cgcttctagATGACGTACTTCCCGGAGG | 19 | 57 | 58 | 13th july | |
P2 | Tir1-BB-Rv | ctactagtaTTATTATAGGATTTTAACAAAATTTGGTGC | 24 | 52 | 29 | 13th july | |
P3 | SdMTir1-BB-Fw | AACTGAACTCACTACTGTACTTCTGTCACCAAATGACTAATGCTGCTCTAGTTACTGTCGCCAAG | 65 | 72 | 43 | 13th july | |
P4 | SdMTir1-BB-Rv | TTGGACAGCCCAAGGATACTGCAACAAGTCCCTCCTCTGTCACAGCAGAATAACCAGCTACG | 62 | 76 | 52 | 13th july | |
P5 | Tir1 SdM v02-Fw | tgcTgtgacagaggagggac | 20 | 60 | 60 | 25th july | |
P6 | Tir1 SdM v02-Fw | ctagAgcagcattagtcatttgg | 23 | 55 | 43 | 25th july | |
P7 | pCS2+BB-Fw | cgctgcagGAACTATAGTGAGTCGTATTACG | 23 | 51 | 39 | 13th july | |
P8 | pCS2+BB-Rv | tgcatGAATTCGAATCGATGGGATCC | 21 | 54 | 48 | 13th july | |
P9 | GFP-AID-BB-Fw | gaattcgcggccgcttctagagATGGCCACAACCATGGTG | 40 | 74 | 58 | 20th july | |
P10 | GFP-AID-BB-Rv | tactagtagcggccgctgcagTTATTAAACCTTACGTTTCTTTTTAGGGAC | 51 | 70 | 43 | 20th july | |
P11 | p2 Hsp70-Fw | ACTGTCGACCCCGTTTAGCAGGAAATAGCC | 30 | 67 | 53 | Heat Shock | 20th july |
P12 | p2 Hsp70-Rv | ACTAAGCTTATTTGCGCTCCTTACAGTTTGC | 31 | 63 | 42 | Heat Shock | 20th july |
P13 | p2 Flk-1-Fw | ACTGTCGACCTGGACTCTGGGCTAGGG | 27 | 68 | 63 | Vasculature | 20th july |
P14 | p2 Flk-1-Rv | TCAAAGCTTGTTGACGTTTAGTCCAGGACAG | 31 | 64 | 45 | Vasculature | 20th july |
P15 | p2 ROSA-Fw | ACTGTCGACTAGATGAAGGAGAGCC | 25 | 61 | 52 | Ubiquitous | 20th july |
P16 | p2 ROSA-Rv | GATAAGCTTGGATCCCCGCAAACGCAC | 27 | 66 | 56 | Ubiquitous | 20th july |
P17 | p2 CarA-Fw | ACTGTCGACGTCCCATACCAGTACAATGCAAT | 32 | 66 | 47 | muscles | 20th july |
P18 | p2 CarA-Rv | AGTAAGCTTGTGCTGTGATTGAATTGGCTG | 30 | 63 | 43 | muscles | 20th july |
P19 | IaaH-BB-Fw | gaattcgcggccgcttctagATGCGCGAAATGATTACGC | 19 | 55 | 47 | 23th july | |
P20 | IaaH-BB-Rv | ctgcagcggccgctactagtaTTATTAGCCTTTTAACACTTTTTCG | 25 | 52 | 28 | 23th july | |
P21 | IaaM-BB-Fw | gaattcgcggccgcttctagatgtttggaccggatttccc | 20 | 56 | 50 | 23th july | |
P22 | IaaM-BB-Rv | ctgcagcggccgctactagtattattagtcccccagcgc | 39 | 55/73 | 56/59 | 23th july | |
P23 | AID-Fw | cgcttctagGGAGCTGGTGCAGGCGCT | 18 | 64 | 72 | 25th july | |
P24 | Sp6 | ATTTAGGTGACACTATA | 17 | 41 | 27 | for BB detection when sequenced | NP |
P25 | T3 | AATTAACCCTCACTAAAGGG | 20 | 50 | 40 | for BB detection when sequenced | NP |
P26 | primer_sequencing_pCS2+_Fw | CAAGTGTAGCGGTCACGCTG | 20 | 59 | 60 | 13th july | |
P27 | primer_sequencing_pCS2+_Rv | GCGTAATCATGGTCATAGCTG | 21 | 52 | 48 | 13th july | |
P28 | GFP_AID_BB_Fw_v2 | TGCATgaattcgcggccgcttctagagATGGCCACAACCATGGTG | 45 | 75 | 56 | ||
P29 | IaaH_BB_Fw_v2 | TGCATgaattcgcggccgcttctagATGCGCGAAATGATTACGC | 44 | 74 | 52 | ||
P30 | IaaM_BB_Fw_v2 | TGCATgaattcgcggccgcttctagatgtttggaccggatttccc | 45 | 74 | 53 | ||
P31 | IRES_BB_F | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCGATCATTCAagagaTCCCC | 50 | 53/74 | 50/52 | ||
P32 | IRES_BB_R | GTTTCTTCCTGCAGCGGCCGCTACTAGTAttgtggccatattatcatcg | 49 | 51/72 | 40/49 | ||
P33 | BBa_G1005 | gtttcttcctgcagcggccgctactagta | 29 | 67 | 55 | ||
P34 | IaaM_Kozak_BB_F | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGGGTTCCAAACCATGCGCGAAATGATTACGC | 60 | 55/76 | 46/52 | ||
P35 | IaaH_Kozak_BB_F | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGGGTTCCAAACCatgtttggaccggatttcc | 60 | 54/76 | 47/52 |
Promoteurs
Code | Name | Length | Concentration (ng/ul) | Species of origin | Expression domain | Restriction sites (EcoRI, XbaI, SpeI, PtsI) | Reference | Sequence |
Promo 1 | p2 Xlurp | 5273bp | 177,1 | Xenopus Laevis | Myeloid cells | / | Smith et al., 2002 | Sequence
|
Promo 2 | p2 CMV | 1016bp | 65,3 | Cytomegalovirus | Widespread | / | Werdien et al., 2001 | Sequence
|
Promo 3 | p2 Flk-1 | 2723bp | 54 | Xenopus Laevis | Vasculature | / | Doherty et al., 2007 | Sequence
|
Promo 4 | p2 14xUAS E1b-ATG | 454bp | 93,7 | Xba1 | Sequence
| |||
Promo 5 | p2 ROSA26 | 814bp | 55,7 | Mus musculus | Widespread | / | Gross et al., 2006 | Sequence
|
Promo 6 | p2 foxi short | 2020bp | 105,9 | Xenopus Tropicalis | Ionocytes | / | Unpublished results | Sequence
|
Promo 7 | p2 UASt | 341bp | 64,8 | Saccharomyces cerevisiae | GAL4 inductible | / | Sequence | |
Promo 8 | p2 HB9 | 3142bp | 48,1 | Danio rerio | Motor neurons | PtsI | Flanagan-Street et al., 2005 | Sequence |
Promo 9 | p2 pax6 | bp | 58,9 | Sequence | ||||
Promo 10 | p2 NBT | 3481bp | 168,7 | Xenopus Laevis | Differentiated neurons | EcoRI | Huang et et al., 2007 | Sequence |
Promo 11 | p2 LMO2 long | 4730bp | 170,1 | Sequence | ||||
Promo 12 | p2 pax3 | 2916bp | 109,5 | Xenopus Laevis | Neural ectoderm | Unpublished results | Sequence | |
Promo 13 | p2 vimentin | 7205bp | 187,4 | Xenopus Tropicalis | Neural progenitor/glia | Love et al., 2011 | Sequence | |
Promo 14 | p2 Brachyury | 3856bp | 103,6 | Sequence | ||||
Promo 15 | p2 CMG long | 92,4 | Sequence | |||||
Promo 16 | p2 LMO2 short | 2007bp | 88,3 | Sequence | ||||
Promo 17 | p2 Ef1a | 528bp | 128,9 | Sequence | ||||
Promo 18 | p2 Hsp70 | 487bp | 62,5 | Xenopus Laevis | Heat shock inductible | PrsI | Beck et al., 2003 | Sequence |
Promo 19 | pCAR (eGFP) | bp | 2900 | Sequence |
Glycerol Stocks
Number | Strain | Plasmid | Description | Date |
P1 | E.Coli DH5 aplpha | pCS2+ | RFP ( BBA_J23100 ) | 13th july |
P2 | E.Coli DH5 aplpha | pCS2+ | Auxine () | 13th july |
P3 | E.Coli DH5 aplpha | pCS2+ | Tir1 GFP-Aid () | 19th july |
P4 | E.Coli DH5 aplpha | pCS2+ | Tir1 GFP-Aid () | 19th july
|