Team:Edinburgh/Project/Non-antibiotic-Markers

From 2012.igem.org

(Difference between revisions)
 
(39 intermediate revisions not shown)
Line 21: Line 21:
color: #002BB8;
color: #002BB8;
}
}
-
/* navigation edit*/
+
#main-menu ul li#project-page:hover ul li{
-
#nav-markers a,
+
-
#nav-markers-nitroreductase{
+
-
color:#ccc;
+
-
cursor:default;
+
-
}
+
-
/* actual page */
+
-
#page-content{
+
-
background-color:#fff;
+
-
border:1px solid #ccc;
+
-
}
+
-
#pSBIC3-primers,
+
-
#pSBIC3-seq,
+
-
#pSBIC3-method,
+
-
#Plac-lacZ-method,
+
-
#PstI{
+
-
height:0px;
+
-
position: relative;
+
top:-9000px;
top:-9000px;
-
}
 
-
#fig1, #fig2, #fig3,
 
-
#fig4, #fig5, #fig6{
 
-
height:0px;
 
-
margin:5px;
 
-
}
 
-
#fig1, #fig3{
 
-
margin-left:240px;
 
-
}
 
-
#fig2, #fig5, #fig6{
 
-
margin-left:300px;
 
-
}
 
-
#fig4{
 
-
margin-left:310px;
 
}
}
</style>
</style>
Line 60: Line 29:
document.getElementById(x).style.height="auto";
document.getElementById(x).style.height="auto";
document.getElementById(x).style.top="0px";
document.getElementById(x).style.top="0px";
-
if(x == 'pSBIC3-method'){
 
-
document.getElementById('fig1').style.height="auto";
 
-
document.getElementById('fig2').style.height="auto";
 
-
}
 
-
if(x == 'Plac-lacZ-method'){
 
-
document.getElementById('fig3').style.height="auto";
 
-
document.getElementById('fig4').style.height="auto";
 
-
document.getElementById('fig5').style.height="auto";
 
-
}
 
-
if(x == 'PstI'){
 
-
document.getElementById('fig6').style.height="auto";
 
-
}
 
}
}
function collapse(x){
function collapse(x){
document.getElementById(x).style.height="0px";
document.getElementById(x).style.height="0px";
document.getElementById(x).style.top="-9000px";
document.getElementById(x).style.top="-9000px";
-
if(x == 'pSBIC3-method'){
 
-
document.getElementById('fig1').style.height="0px";
 
-
document.getElementById('fig2').style.height="0px";
 
-
}
 
-
if(x == 'Plac-lacZ-method'){
 
-
document.getElementById('fig3').style.height="0px";
 
-
document.getElementById('fig4').style.height="0px";
 
-
document.getElementById('fig5').style.height="0px";
 
-
}
 
-
if(x == 'PstI'){
 
-
document.getElementById('fig6').style.height="0px";
 
-
}
 
}
}
</script>
</script>
Line 98: Line 43:
<div class="text">
<div class="text">
<p class="h1">
<p class="h1">
-
Non-antibiotic selectable and counter-selectable markers:
+
Alternative selectable and counter-selectable markers:
<br /><br />
<br /><br />
-
Nitroreductase
+
Introduction
-
</p>
+
-
<p class="h2">
+
-
Background
+
</p>
</p>
<p class="normal-text">
<p class="normal-text">
-
Nitroreductase is an Enterobacter cloacae enzyme which reduces nitrogen containing compounds  <a href="#bibliography" onclick="expand('works-cited');">(Nicklin & Bruce, 1998)</a>. Other nitroreductases were implemented in converting nitro drugs such as metronidazole into their active form which is essential part of their toxicity <a href="#bibliography" onclick="expand('works-cited');">(Nillius, Muller, & Muller, 2011)</a>. Bearing this in mind, we decided to look into nitroreductases’s potential as counter selectable marker.
+
Genetic modification requires us to discriminate between bacteria which have taken up the DNA of interest and those which have not. This is traditionally done by using antibiotic resistance markers – cells that have taken up the DNA of interest (along with these markers) will be able to survive on media supplemented with the relevant antibiotic while those that do not have the DNA will not grow.  
-
</p>
+
-
<p class="h2">
+
-
Cloning
+
-
</p>
+
-
<p class="h3">
+
-
pSBIC3-nitroreductase
+
-
</p>
+
-
<p class="normal-text">
+
-
The nitroreductase gene was cloned using these <a href="#" onclick="expand('pSBIC3-primers');">primers</a> and inserted into the standard biobrick vector pSBIC3. This construct was confirmed trough <a href="#" onclick="expand('pSBIC3-seq');">sequencing</a>.
+
-
<a href="#" onclick="expand('pSBIC3-method')">Method</a>.
+
-
</p>
+
-
<p class="normal-text" id="pSBIC3-primers">
+
-
<i>Forward primer: GCTA gaattcgcggccgcttctagag caccagg agttgtt atg gat<br />
+
-
Reverse primer: CATG ctgcag cggccgc t actagt a tta tt AGCACTCGG TCACAATCGT<br /></i>
+
-
<a href="#" onclick="collapse('pSBIC3-primers');">Close the primers.</a>
+
-
</p>
+
-
<p class="normal-text" id="pSBIC3-seq">
+
-
<i>Sequencing results:<br />
+
-
aacttataaatattcttaggcttatctctagggaggatttctggaattcgcggccgcttctagagcaccaggagttgttctggatatgatttctgtcgccctgaaacggcactccaccaaggcgttcgaccc
+
-
cgctaaaaaactgaccgcatacgatccggaaaagatcaaacccctgctgcaataccgtccgtccaacaccctgtcccagccgtggcactttattgtccttgcaccgaggaaggtaaaccttgcgtggtttcc
+
-
tctgccgaaagcacttacgtcttctacgatcgcaaaacgctggacgcttctctcgtggtggtgttctgcgcgaaaaccgcttcggatgatgccttcatggaacgcttggtggatcatgaagaacccgatggc
+
-
cggt</i>
+
-
<br />
+
-
<a href="#" onclick="collapse('pSBIC3-seq');">Close the sequencing results.</a>
+
-
</p>
+
-
<p class="normal-text" id="pSBIC3-method">
+
-
<i>Method: The nitroreductase PCR product was purified and digested with EcoRI HQ and SpeI together with pSBIC3.  These were ligated, E.coli cells transformed with the ligation and the white colonies (RFP  disruption) were miniprepped. Detailed method procedures in methods section.</i><br />
+
-
<img id="fig1" src="https://static.igem.org/mediawiki/2012/9/9e/Markers-fig01.JPG"><br />
+
-
Figure 1: DNA gel of PCR product of BS-nitred with primers specific for nitroreductase. The product is around 0.6-0.7 kb which corresponds to the size of nitroreductase gene, around 0.6 kb.<br />
+
-
<img id="fig2" src="https://static.igem.org/mediawiki/2012/d/d3/Markers-fig02.JPG"><br />
+
-
Figure 2: DNA gel of pSBIC3-nitroreductase ligation. The band is around 2.5-2.6 kb which corresponds to the vector pSBIC3 (around 2 kb) together with the nitroreductase (0.6 kb). Sample 2 was confirmed with sequencing.<br />
+
-
<a href="#" onclick="collapse('pSBIC3-method')">Close the method.</a>
+
-
</p>
+
-
<p class="h3">
+
-
<br />Plac-lacZ-nitroreductase
+
-
</p>
+
-
<p class="normal-text">
+
-
It was further proceeded to add a promoter and a reporter gene in front of the nitroreductase gene (plac-lacZ).
+
-
<a href="#" onclick="expand('Plac-lacZ-method')">Method</a>.
+
-
</p>
+
-
<p class="normal-text" id="Plac-lacZ-method">
+
-
<i>Method: The sequence confirmed  PSBIC3- nitroreductase was digested with EcoRI HQ and XbaI while Edinbrick1 was digested with EcoRI HQ and SpeI.  These were ligated together. The ligations were transformed into cells and the transformants plated on LB+chloramphenicol+IPTG+Xgal plate. The blue colonies (contain lacZ) were further used.  Colony PCR screen of pooled blue plac-lacZ-nitroreductase transformants with lacZ forward primer and reverse nitroreductase primer showed a band corresponding to lacZ-nitroreductase.</i><br />
+
-
<img id="fig3" src="https://static.igem.org/mediawiki/2012/4/42/Markers-fig03.JPG"><br />
+
-
<i>Figure 3: DNA gel with Colony PCR products of pooled blue plac-lacZ-nitroreductase transformants with lacZ forward primer and reverse nitroreductase primer resulted in in bands around 1.2-1.3 kb which corresponds  to nitroreductase (0.6 kb) plus lacZ (0.6 kb).
+
<br /><br />
<br /><br />
-
To confirm the presence of plac-lacZ-nitroreductase in pSBIC3, the samples in the smallest pool were minipreped, digested with EcoRI and SpeI to check the size of the insert.
+
Selectable markers select for the cells which have taken up the gene of interest (eg. sucrose hydrolase) while counter-selectable markers select against the cells which have the DNA of interest (nitroreductase and SacB), which may be useful if we want to get rid of the cells that still contain a no longer wanted DNA insert.
-
</i><br />
+
-
<img id="fig4" src="https://static.igem.org/mediawiki/2012/a/a0/Markers-fig04.JPG"><br />
+
-
<i>Figure 4: DNA gel with plac-lacZ-nitroreductase which was digested with EcoRI HQ and SpeI.. The biggest band is likely to correspond to psBIC3 around 2.2-2.3 kb, the middle band is likely to correspond to  plac-lacZ-nitroreductase around 1.5 kb and the smallest fragment is unknown.</i><br />
+
-
<img id="fig5" src="https://static.igem.org/mediawiki/2012/5/5a/Markers-fig05.JPG"><br />
+
-
<i>Figure 5: DNA gel with plac-lacZ-nitroreductase which was digested with EcoRI HQ to linearise the DNA. There are two distinctive bands, one around 3.0 kb and one around 3.6 kb likely to correspond to psBIC3 with plac-lacZ-nitroreductase and plac-lacZ.</i><br />
+
-
<a href="#" onclick="collapse('Plac-lacZ-method')">Close the method.</a><br />
+
-
</p>
+
-
<p class="h3">
+
-
<br />PstI restriction site <a href="#" onclick="expand('PstI');">(expand)</a>
+
-
</p>
+
-
<p class="normal-text" id="PstI">
+
-
<i>The original <a href="http://www.ncbi.nlm.nih.gov/nuccore/M63808.1">sequence</a> used for primer design has PstI restriction site. However the sequencing results suggests that there is no such site. The sequence confirmed psBIC3-nitroreductase was digested with PstI and run alongside an undigested sample.</i><br />
+
-
<img id="fig6" src="https://static.igem.org/mediawiki/2012/0/00/Markers-fig06.JPG"><br />
+
-
<i>Figure 6: DNA gel with psBIc3-nitroreductase undigested and digested with PstI. Only one band at around 3 kb is visible corresponding to the linearized plasmid confirming that there is no PstI restriction site.</i>
+
-
<a href="#" onclick="collapse('PstI')">Close the method.</a>
+
-
</p>
+
-
<p class="h2">
+
-
Characterisation
+
-
</p>
+
-
<p class="h3">
+
-
Specific activity
+
-
</p>
+
-
<p class="normal-text">
+
-
Before cloning the nitroreductase gene in the biobrick vector, 3 nitroreductase genes into different vectors with different promoters and control which were available in the lab were used to test nitroreductase specific activity. Method is detailed in the methods section.
+
<br /><br />
<br /><br />
-
The change of NADH concentration was estimated by the change of OD340 absorbance per minute, background is subtracted and specific activity calculated. The results are presented in the diagram below.<br />
+
The problem with this system is that <a href="https://2012.igem.org/Team:Edinburgh/Human_Practices/Laws-and-Legislations ">international law</a> does not allow the release of genetically modified organisms which contain such antibiotic resistance markers because these might aid the spreading of antibiotic resistance genes in the wild population.  
-
<img id="fig7" src="https://static.igem.org/mediawiki/2012/a/a9/Markers-fig07.JPG"><br />
+
-
Figure 7: Comparison of the specific activity of 3 nitroreductase genes into different vectors with different promoters and control.
+
<br /><br />
<br /><br />
-
BS-nitred was used further for characterization experiments as it showed highest specific activity.
+
We have questioned the legacy and safety of using antibiotics for selection and counter-selection and thus we aim to provide alternative markers that do not necessarily rely on antibiotic resistance genes for selection or counterselection. This would allow iGEM projects (and other projects where genetic engineering is used) to pass this hurdle on their way to releasing their constructs into the environment where they could be used for the real life purpose they were built for. This does not, of course, means that any constructs can now be released into the wild, as the properties of the construct still need to be considered, but that the issue of antibiotic resistance will no longer be present.
</p>
</p>
-
<p class="h3">
+
<p class="normal-text" style="text-align:center">
-
<br />Plates
+
-
</p>
+
-
<p class="normal-text">
+
-
To determine the relative toxicity of different compounds, 5 ul of DMSO, MTZ and DNBA were added on three distinct spots in a freshly spread plates.<br /><br />
+
-
<img id="table1" src="https://static.igem.org/mediawiki/2012/4/43/Markers-table1.JPG">
+
<br /><br />
<br /><br />
-
DMSO was determined to be non-toxic, DNBA showed small difference between the different strains while MTZ distinctively more toxic to BS-nitred and BS-contol.
+
<span class="subtle-emphasis">&lt;&lt;Prev</span><span style="color:white;">__</span>1/6</span><span style="color:white;">__</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Nitroreductase"><span class="intense-emphasis">Next&gt;&gt;</span></a>
<br /><br />
<br /><br />
-
Numerous plates experiments with MTZ concentration ranging from 0 ug/ml to 300 ug/ml and various concentrations of DNBA and NFT were made to determine concentrations at which BS-control was growing which BS-nitred’s growth is inhibited. Similar growth patterns were observed in DNBA and NFT plates. All metronidazole experiments showed inhibited growth of BS-nitred in comparison to BS-control however the inhibition was never 100 % which is required for nitroreductase to be used as a counterselectable markers.<br /><br />
 
-
<img id="fig8" src="https://static.igem.org/mediawiki/2012/5/5a/Markers-fig08.JPG"><br /><br />
 
-
Figure 8: Overnight plates with 100 ug/ml MTZ concentration with and without IPTG with different nitroreductase strains and control. BS-nitred’s growth was inhibited in comparison with BS-control however there are still some BS-nitred colonies growing.<br /><br />
 
-
<img id="fig9" src="https://static.igem.org/mediawiki/2012/2/2d/Markers-fig09.JPG"><br /><br />
 
-
Figure 9: Comparison of growth of BS-contol and BS-nitred at 90 ug/ml metronidazole. BS-nitred’s growth is clearly inhibited in comparison to BS-control however growth inhibition is not absolute.
 
-
We could not find a concentration of metronidazole at which nitroreductase containing cells’ growth was inhibited while control cells were growing. We determined that this gene is not suitable as a counter-selectable marker on plates.
 
-
</p>
 
-
<p class="h3">
 
-
<br />Liquid cultures
 
-
</p>
 
-
<p class="normal-text">
 
-
The growth of nitroreductase containing and control strains was assessed in liquid medium as well. The cells were grown in aerobic or anaerobic conditions with and without MTZ in triplicate.<br />
 
-
<img id="fig10" src="https://static.igem.org/mediawiki/2012/e/e4/Markers-fig10.JPG"><br />
 
-
Figure 10: Comparison of growth patterns of BS-nitred and BS-control in 150 ug/ml metronidazole in aerobic cultures. Initial OD600 was extracted and error bars are standard error of the mean (SEM).<br />
 
-
<img id="fig11" src="https://static.igem.org/mediawiki/2012/a/a8/Markers-fig11.JPG"><br />
 
-
Figure 11: Comparison of growth patterns of BS-nitred and BS-control in 150 ug/ml metronidazole in anaerobic cultures. Initial OD600 was extracted and error bars are standard error of the mean (SEM).
 
-
<br /><br />
 
-
The results in aerobic cultures are promising since nitroreductase containing cells have not grown while the control cells are growing.
 
-
</p>
 
-
<p class="h2">
 
-
Conclusion:
 
-
</p>
 
-
<p class="normal-text">
 
-
We successfully cloned the nitroreductase gene and inserted it into biobrick vector.<br /><br />
 
-
We extensively characterized the nitroreductase gene in plates and liquid cultures.<br /><br />
 
-
We are developing novel (to the best of our knowledge) counter-selection system which may have advantages over currently used systems.<br /><br />
 
-
We determined that it is most suitable as counter-selectable marker in liquid aerobic cultures at 150 ug/ml metronidazole.
 
-
</p>
 
-
<p class="h2">
 
-
Further plans:
 
-
</p>
 
-
<p class="normal-text">
 
-
To determine what is wrong with the plac-lacZ-nitroreductase clone.<br /><br />
 
-
To repeat characterization with the plac-lacZ-nitroreductase.<br /><br />
 
-
Compare our counter-selection system efficiency with other currently used systems.
 
</p>
</p>
 +
</html>
</html>
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}
Line 235: Line 68:
<style type="text/css">
<style type="text/css">
/* navigation edit*/
/* navigation edit*/
-
#nav-markers a,
+
#page-navigation ul li#nav-markers p,
-
#nav-markers-nitroreductase{
+
#page-navigation ul li#nav-markers ul li#nav-markers-introduction a{
color:#ccc;
color:#ccc;
cursor:default;
cursor:default;

Latest revision as of 19:05, 26 October 2012

Alternative selectable and counter-selectable markers:

Introduction

Genetic modification requires us to discriminate between bacteria which have taken up the DNA of interest and those which have not. This is traditionally done by using antibiotic resistance markers – cells that have taken up the DNA of interest (along with these markers) will be able to survive on media supplemented with the relevant antibiotic while those that do not have the DNA will not grow.

Selectable markers select for the cells which have taken up the gene of interest (eg. sucrose hydrolase) while counter-selectable markers select against the cells which have the DNA of interest (nitroreductase and SacB), which may be useful if we want to get rid of the cells that still contain a no longer wanted DNA insert.

The problem with this system is that international law does not allow the release of genetically modified organisms which contain such antibiotic resistance markers because these might aid the spreading of antibiotic resistance genes in the wild population.

We have questioned the legacy and safety of using antibiotics for selection and counter-selection and thus we aim to provide alternative markers that do not necessarily rely on antibiotic resistance genes for selection or counterselection. This would allow iGEM projects (and other projects where genetic engineering is used) to pass this hurdle on their way to releasing their constructs into the environment where they could be used for the real life purpose they were built for. This does not, of course, means that any constructs can now be released into the wild, as the properties of the construct still need to be considered, but that the issue of antibiotic resistance will no longer be present.



<<Prev__1/6__Next>>

Methods (expand)

Inserting gene into a biobrick vecor: Cloning a PCR product into a biobrick vector protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:bbcloning) however NEB buffers were used.

DNA gel preparation: Analysing DNA by gel electrophoresis protocol on OpanWetWare (http://openwetware.org/wiki/Cfrench:AGE) however 0.5*TAE rather than 1*TAE was used.

Colony PCR screen: Screening colonies by PCR protocol on OpenWetWare http://openwetware.org/wiki/Cfrench:PCRScreening

Transformations: Preparing and using compenent E.coli cells protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:compcellprep1)

PCR reactions : Cloning parts by PCR with Kod polymerase protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:KodPCR)

Minipreps : Plasmid DNA minipreps from Escerichia coli JM109 and similar strains protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:minipreps1)

Digests to linearise the DNA frangment/determine size of insert: Analytical restriction digests protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:restriction1)

DNA purification: Purifying a PCR product from solution protocol on OpenWetWare (http://openwetware.org/wiki/Cfrench:DNAPurification1) however 165 ul NaI, 5 ul glass beads,180 ul wash buffer and 10 ul EB were used.

DNA preparation for sequencing: 2.5 ul miniprepped DNA, 2 ul water and 1 ul forward primer ( specific for biobrick prefix) or reverse primer (specific for biobrick suffix)

Nitroreductase activity assay: Overnight liquid cultures of nitroreductase strains were centrifuged at 10000 rpm for 5 mins to pellet the cells. The cells were then resuspended in 250 ul PBS and 1 ul DTT to ensure that cellular proteins are not oxidized. The solution was sonicated 6* (10 s sonication+20 s rest). The supernatant was separated from the pellet by centrifugation and used for the NADH-dependent nitroreductase activity assay.

To assess background activity NADH (5 ul) and bacterial supernatant (5 ul) were added to 0.8 ml PBS and mixed. OD340 was measured for 1 minute. DNBA(5 ul) was added to the same cuvette to start the reaction and change in OD340 was monitored for 1 minute. DMSO(5 ul) was used a control (DNBA is dissolved in DMSO)

The protein concentration of each of the supernants was estimated by by Bradford protein assay using the Pierce reagent protocol on OpenWetWare(http://openwetware.org/wiki/Cfrench:ProteinAssay)

Close methods.

Works Cited (expand)

French, C., & Kowal, M. (2010, 09 24). B. subtilis levansucrase. Lethal to E.coli in presence of sucrose. Retrieved 2012, from Registry of standard biological parts: http://partsregistry.org/Part:BBa_K322921

Gay, P., Coq, D. l., Strinmetz, M., Ferrari, E., & Hoch, J. A. (1983). Cloning Structural Gene SacB, which Codes for Exoenzyme Levansucrase of Bacillus subtilis: Expression of the Gene in Esherichia coli. Journal of Bacteriology , 1424-1431.

Jahreis, K., Bentler, L., Bockmann, J., Hans, S., Meyer, A., Siepelmeyer, J., et al. (2002). Adaptation of sucrose metabolism in the Escherichia coli Wild-Type Strain EC31132. Journal of Bacteriology, 5307-5316.

Keuning, S., Janssen, D. B., & Witholt, B. (1985). Purification and Characterisation of Hyrdrolytic Haloalkane Dehalogenase from Xanthobacter autotrophicus GJ10. Journal of Bacteriology, 635-639.

Naested, H., Fennema, M., Hao, L., Andersen, M., Janssen, D. B., & Mundy, J. (1999). A bacterial haloalkane dehalogenase gene as a negative selectable marker in Arabidopsis. The Plant Journal, 571-576.

Nicklin, C. E., & Bruce, N. C. (1998). Aerobic degradation of 2,4,6-Trinitrotoluene by Enterobacter cloaceae PB2 and by Pentaerythritol tetranitrate reductase. Applied and environmental microbiology , 2864-2868.

Nillius, D., Muller, J., & Muller, N. (2011). Nitroreductase (GlNR1) increases susceptibility of Giardia lamblia and Escherichia coli to nitro drugs. Journal of antimicrobial chemotherapy, 1029-1035.

Kang et al. (2009). "Levan: Applications and Perspectives". Microbial Production of Biopolymers and Polymer Precursors. Caister Academic Press

Dahech, I, Belghith, K. S., Hamden, K., Feki, A., Belghith, H. and Mejdoub, H. (2011) Antidiabetic activity of levan polysaccharide in alloxan-induced diabetic rats. International Journal of Biological Macromolecules 49(4):742-746

Close cited works.

Retrieved from "http://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers"