|
|
| (98 intermediate revisions not shown) |
| Line 1: |
Line 1: |
| | + | {{Team:Amsterdam/toolStyleBase}} |
| | + | {{Team:Amsterdam/toolStyleSunburst}} |
| | {{Team:Amsterdam/stylesheet}} | | {{Team:Amsterdam/stylesheet}} |
| | {{Team:Amsterdam/scripts}} | | {{Team:Amsterdam/scripts}} |
| | {{Team:Amsterdam/Header}} | | {{Team:Amsterdam/Header}} |
| - | {{Team:Amsterdam/Sidebar1}} | + | {{Team:Amsterdam/Sidebar2}} |
| | <html> | | <html> |
| - | <head>
| + | <script type='text/javascript' src='/Team:Amsterdam/maarten/slides.min.jquery.js?action=raw'></script> |
| - | <script type="text/javascript" src="jquery-1.2.3.min.js"></script>
| + | |
| - | <script type='text/javascript'> | + | |
| - | | + | |
| - | (function() {
| + | |
| - | var ua = navigator.userAgent,
| + | |
| - | iStuff = ua.match(/iPhone/i) || ua.match(/iPad/i),
| + | |
| - | typeOfCanvas = typeof HTMLCanvasElement,
| + | |
| - | nativeCanvasSupport = (typeOfCanvas == 'object' || typeOfCanvas == 'function'),
| + | |
| - | textSupport = nativeCanvasSupport
| + | |
| - | && (typeof document.createElement('canvas').getContext('2d').fillText == 'function');
| + | |
| - | //I'm setting this based on the fact that ExCanvas provides text support for IE
| + | |
| - | //and that as of today iPhone/iPad current text support is lame
| + | |
| - | labelType = (!nativeCanvasSupport || (textSupport && !iStuff))? 'Native' : 'HTML';
| + | |
| - | nativeTextSupport = labelType == 'Native';
| + | |
| - | useGradients = nativeCanvasSupport;
| + | |
| - | animate = !(iStuff || !nativeCanvasSupport);
| + | |
| - | })();
| + | |
| - | | + | |
| - | var Log = {
| + | |
| - | elem: false,
| + | |
| - | write: function(text){
| + | |
| - | if (!this.elem)
| + | |
| - | this.elem = document.getElementById('log');
| + | |
| - | this.elem.innerHTML = text;
| + | |
| - | this.elem.style.left = (500 - this.elem.offsetWidth / 2) + 'px';
| + | |
| - | }
| + | |
| - | };
| + | |
| - | | + | |
| - | | + | |
| - | function init(json){
| + | |
| - | //init data
| + | |
| - | //init Sunburst
| + | |
| - | var sb = new $jit.Sunburst({
| + | |
| - | //id container for the visualization
| + | |
| - | injectInto: 'infovis',
| + | |
| - | //Distance between levels
| + | |
| - | levelDistance: 90,
| + | |
| - | //Change node and edge styles such as
| + | |
| - | //color, width and dimensions.
| + | |
| - | Node: {
| + | |
| - | overridable: true,
| + | |
| - | type: useGradients? 'gradient-multipie' : 'multipie'
| + | |
| - | },
| + | |
| - | //Select canvas labels
| + | |
| - | //'HTML', 'SVG' and 'Native' are possible options
| + | |
| - | Label: {
| + | |
| - | type: labelType
| + | |
| - | },
| + | |
| - | //Change styles when hovering and clicking nodes
| + | |
| - | NodeStyles: {
| + | |
| - | enable: true,
| + | |
| - | type: 'Native',
| + | |
| - | stylesClick: {
| + | |
| - | 'color': '#33dddd'
| + | |
| - | },
| + | |
| - | },
| + | |
| - | //Add tooltips
| + | |
| - | Tips: {
| + | |
| - | enable: true,
| + | |
| - | onShow: function(tip, node) {
| + | |
| - | var html = "<div class=\"tip-title\">" + node.name + "</div>";
| + | |
| - | var data = node.data;
| + | |
| - | if("length" in data) {
| + | |
| - | html += "<b>Length of feature:</b> " + data.length + "bp";
| + | |
| - | }
| + | |
| - | if("type" in data){
| + | |
| - | html += "<br\><b>Type of feature:</b> " + data.type;
| + | |
| - | }
| + | |
| - | tip.innerHTML = html;
| + | |
| - | }
| + | |
| - | },
| + | |
| - | //implement event handlers
| + | |
| - | Events: {
| + | |
| - | enable: true,
| + | |
| - | onClick: function(node) {
| + | |
| - | if(!node) return;
| + | |
| - | //Build detailed information about the file/folder
| + | |
| - | //and place it in the right column.
| + | |
| - | var html = "<h4>" + node.name + "</h4>", data = node.data;
| + | |
| - |
| + | |
| - | if("description" in data) {
| + | |
| - | html += "<br /><br /><b>Last commit was:</b><br /><pre>" + data.description + "</pre>";
| + | |
| - | }
| + | |
| - | $jit.id('inner-details').innerHTML = html;
| + | |
| - | //hide tip
| + | |
| - | sb.tips.hide();
| + | |
| - | //rotate
| + | |
| - | sb.rotate(node, animate? 'animate' : 'replot', {
| + | |
| - | duration: 1000,
| + | |
| - | transition: $jit.Trans.Quart.easeInOut
| + | |
| - | });
| + | |
| - | }
| + | |
| - | },
| + | |
| - | // Only used when Label type is 'HTML' or 'SVG'
| + | |
| - | // Add text to the labels.
| + | |
| - | // This method is only triggered on label creation
| + | |
| - | onCreateLabel: function(domElement, node){
| + | |
| - | var labels = sb.config.Label.type,
| + | |
| - | aw = node.getData('angularWidth');
| + | |
| - | if (labels === 'HTML' && (node._depth < 2 || aw > 2000)) {
| + | |
| - | domElement.innerHTML = node.name;
| + | |
| - | } else if (labels === 'SVG' && (node._depth < 2 || aw > 2000)) {
| + | |
| - | domElement.firstChild.appendChild(document.createTextNode(node.name));
| + | |
| - | }
| + | |
| - | },
| + | |
| - | // Only used when Label type is 'HTML' or 'SVG'
| + | |
| - | // Change node styles when labels are placed
| + | |
| - | // or moved.
| + | |
| - | onPlaceLabel: function(domElement, node){
| + | |
| - | var labels = sb.config.Label.type;
| + | |
| - | if (labels === 'SVG') {
| + | |
| - | var fch = domElement.firstChild;
| + | |
| - | var style = fch.style;
| + | |
| - | style.display = '';
| + | |
| - | style.cursor = 'pointer';
| + | |
| - | style.fontSize = "0.8em";
| + | |
| - | fch.setAttribute('fill', "#fff");
| + | |
| - | } else if (labels === 'HTML') {
| + | |
| - | var style = domElement.style;
| + | |
| - | style.display = '';
| + | |
| - | style.cursor = 'pointer';
| + | |
| - | style.fontSize = "0.8em";
| + | |
| - | style.color = "#ddd";
| + | |
| - | var left = parseInt(style.left);
| + | |
| - | var w = domElement.offsetWidth;
| + | |
| - | style.left = (left - w / 2) + 'px';
| + | |
| - | }
| + | |
| - | }
| + | |
| - | });
| + | |
| - | //load JSON data.
| + | |
| - | sb.loadJSON(json);
| + | |
| - | //compute positions and plot.
| + | |
| - | sb.refresh();
| + | |
| - |
| + | |
| - | //end
| + | |
| - | }
| + | |
| - | | + | |
| - | function addForbiddenSequences(){
| + | |
| - | forbiddenSequences.addSite('Forbidden-EcoRI','GAATTC')
| + | |
| - | forbiddenSequences.addSite('Forbidden-XbaI','GAATTC')
| + | |
| - | forbiddenSequences.addSite('Forbidden-SpeI','ACTAGT')
| + | |
| - | forbiddenSequences.addSite('Forbidden-PstI','CTGCAG')
| + | |
| - | forbiddenSequences.addSite('Forbidden-NotI','GCGGCCGC')
| + | |
| - | }
| + | |
| - | | + | |
| - | var forbiddenSequences = {
| + | |
| - | forbiddenSequencesArray : {},
| + | |
| - | addSite : function(name,sequence){
| + | |
| - | forbiddenSequences.forbiddenSequencesArray[name] = sequence
| + | |
| - | },
| + | |
| - | }
| + | |
| - | | + | |
| - | function checkOccurrence(target,sequence){
| + | |
| - | if (sequence.length > target.length){
| + | |
| - | if (sequence.indexOf(target) == -1){
| + | |
| - | return false
| + | |
| - | } else{
| + | |
| - | return true
| + | |
| - | }
| + | |
| - | } else{
| + | |
| - | if (target.indexOf(sequence) == -1){
| + | |
| - | return false
| + | |
| - | } else{
| + | |
| - | return true
| + | |
| - | }
| + | |
| - | }
| + | |
| - | }
| + | |
| - | | + | |
| - | function randomDNA(length){
| + | |
| - | chars = 'atgc'
| + | |
| - | inForbiddenSite = true
| + | |
| - | while (inForbiddenSite === true){
| + | |
| - | sequence = ''
| + | |
| - | inForbiddenSite = false
| + | |
| - | for (k=0; k<length; k++) {
| + | |
| - | rnum = Math.floor(Math.random() * chars.length);
| + | |
| - | sequence += chars.substring(rnum,rnum+1);
| + | |
| - | }
| + | |
| - | for (item in forbiddenSequences.forbiddenSequencesArray){
| + | |
| - | if (checkOccurrence(sequence,forbiddenSequences.forbiddenSequencesArray[item].toLowerCase()) === false){
| + | |
| - | continue
| + | |
| - | } else{
| + | |
| - | inForbiddenSite = true
| + | |
| - | break
| + | |
| - | }
| + | |
| - | }
| + | |
| - | }
| + | |
| - | return sequence
| + | |
| - | }
| + | |
| - | | + | |
| - | function getMethyltransferases(){
| + | |
| - | methyltransferases = new Array()
| + | |
| - | sca1 = new Object()
| + | |
| - | sca1.target = "AGTACT"
| + | |
| - | sca1.sequence = "tccgggcgggactttggatatgtgatacagtcgtccgctgcactatggaatcgactctctacattctcacagagaggaaaagccttggacaccaggcttgcagacatcaagaaggccctggggaagccgtactacgaaacctcggatgtccttctttaccacggcgacagtcttgagctgctcaagtcaatgcctcagcagattttcgaccttaccgtaactagcccaccttacaatattggcaaagagtacgagggtgtactgtcgatcgaggaatacatttcctggtgcgagacatggatgtcgcgcgttcatagggcgaccagcgcaggcggcgcattttggctcaatgttgggtacgtccctgtcccgaaccaaggaaaagcagtcccgattccttacctcttgtgggacaagagtccgttctacatgatccaggaagttgtctggaattacggggcgggagtggcgtctcgaaaatcgttttccccgcgcaatgaaaagtttctctggtatgtgcgcgacccgctgaattattacttcgacctcgattcggtgcgcgacccaaatgtgaaataccccaaccagaaaaagaatgggaagctcaaatgcaacccgttggggaaaaatcccactgacgtttggcagttccccaaggttacgtcgggcgcgaagagatcaagcgtggagcgcaccgcccatccggcacaattcccgtctgctgtcattgaacgggtcatcaaggcgtgcagcccttccgacggcgtcatcctggacccattcctcggttccggaacgacctcgctgaccgccagaaagcaaggccggtgcagcgtcggtatcgaaatccgcgaagactacctcgacatcgcggtgggacgcctggaggcggaggcgcaatccctcttctag"
| + | |
| - | sca1.description = "M.Sca1"
| + | |
| - | sca2 = new Object()
| + | |
| - | sca2.target = "AGTACC"
| + | |
| - | sca2.sequence = "tccgggcgggactttggatatgtgatacagtcgtccgctgcactatggaatcgactctctacattctcacagagaggaaaagccttggacaccaggcttgcagacatcaagaaggccctggggaagccgtactacgaaacctcggatgtccttctttaccacggcgacagtcttgagctgctcaagtcaatgcctcagcagattttcgaccttaccgtaactagcccaccttacaatattggcaaagagtacgagggtgtactgtcgatcgaggaatacatttcctggtgcgagacatggatgtcgcgcgttcatagggcgaccagcgcaggcggcgcattttggctcaatgttgggtacgtccctgtcccgaaccaaggaaaagcagtcccgattccttacctcttgtgggacaagagtccgttctacatgatccaggaagttgtctggaattacggggcgggagtggcgtctcgaaaatcgttttccccgcgcaatgaaaagtttctctggtatgtgcgcgacccgctgaattattacttcgacctcgattcggtgcgcgacccaaatgtgaaataccccaaccagaaaaagaatgggaagctcaaatgcaacccgttggggaaaaatcccactgacgtttggcagttccccaaggttacgtcgggcgcgaagagatcaagcgtggagcgcaccgcccatccggcacaattcccgtctgctgtcattgaacgggtcatcaaggcgtgcagcccttccgacggcgtcatcctggacccattcctcggttccggaacgacctcgctgaccgccagaaagcaaggccggtgcagcgtcggtatcgaaatccgcgaagactacctcgacatcgcggtgggacgcctggaggcggaggcgcaatccctcttctagg"
| + | |
| - | sca2.description = "M.Sca2"
| + | |
| - | methyltransferases[0] = sca1
| + | |
| - | methyltransferases[1] = sca2
| + | |
| - | addForbiddenSequence(methyltransferases,'hasTarget')
| + | |
| - | return methyltransferases
| + | |
| - | }
| + | |
| - | | + | |
| - | function getZincFingers(){
| + | |
| - | zincFingers = new Array()
| + | |
| - | rawData = document.plasmidForm.zf.value
| + | |
| - | rawData = rawData.split('>')
| + | |
| - | rawData.reverse().pop()
| + | |
| - | rawData.reverse()
| + | |
| - | for (zf in rawData){
| + | |
| - | zfFormatted = rawData[zf].split('\n')
| + | |
| - | zfDescription = zfFormatted[0]
| + | |
| - | zfTarget = zfDescription.split('|')[5]
| + | |
| - | zfSequence = ''
| + | |
| - | for (i=1;i<zfFormatted.length;i++){
| + | |
| - | zfSequence+=zfFormatted[i]
| + | |
| - | }
| + | |
| - | zfObject = new Object()
| + | |
| - | zfObject.target = zfTarget
| + | |
| - | zfObject.sequence = zfSequence
| + | |
| - | zfObject.description = zfDescription
| + | |
| - | zincFingers[zf] = zfObject
| + | |
| - | }
| + | |
| - | addForbiddenSequence(zincFingers,'hasTarget')
| + | |
| - | return zincFingers
| + | |
| - | }
| + | |
| - | | + | |
| - | function getLinkers(){
| + | |
| - | linkers = new Array()
| + | |
| - | linker1 = new Object()
| + | |
| - | linker1.sequence = "gcacccggc"
| + | |
| - | linker1.description = "Linker 1"
| + | |
| - | linker2 = new Object()
| + | |
| - | linker2.sequence = "gcaccccgccc"
| + | |
| - | linker2.description = "Linker 2"
| + | |
| - | linkers[0] = linker1
| + | |
| - | linkers[1] = linker2
| + | |
| - | addForbiddenSequence(linkers,'noTarget')
| + | |
| - | return linkers
| + | |
| - | }
| + | |
| - | | + | |
| - | function getMycTags(){
| + | |
| - | mycTags = new Array()
| + | |
| - | mycTag1 = new Object()
| + | |
| - | mycTag1.sequence = "gaacagaaactcatctctgaagaggatctg"
| + | |
| - | mycTag1.description = "Myc Tag 1"
| + | |
| - | mycTag2 = new Object()
| + | |
| - | mycTag2.sequence = "gaacagaaactcatctctgaagagaatctgaagactgagtcagt"
| + | |
| - | mycTag2.description = "Myc Tag 2"
| + | |
| - | mycTags[0] = mycTag1
| + | |
| - | mycTags[1] = mycTag2
| + | |
| - | addForbiddenSequence(mycTags,'noTarget')
| + | |
| - | return mycTags
| + | |
| - | }
| + | |
| - | | + | |
| - | function getTerminators(){
| + | |
| - | terminators = new Array()
| + | |
| - | terminator1 = new Object()
| + | |
| - | terminator1.sequence = "tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt"
| + | |
| - | terminator1.description = "B0014 containing BOO12 and BOO11 terminators"
| + | |
| - | terminator2 = new Object()
| + | |
| - | terminator2.sequence = "tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattatttt"
| + | |
| - | terminator2.description = "Terminator 2"
| + | |
| - | terminators[0] = terminator1
| + | |
| - | terminators[1] = terminator2
| + | |
| - | addForbiddenSequence(terminators,'noTarget')
| + | |
| - | return terminators
| + | |
| - | }
| + | |
| - | | + | |
| - | function getRBS(){
| + | |
| - | rbs = new Array()
| + | |
| - | rbs1 = new Object()
| + | |
| - | rbs1.sequence = "tcacacaggaaag"
| + | |
| - | rbs1.description = "BBa_B0032"
| + | |
| - | rbs2 = new Object()
| + | |
| - | rbs2.sequence = "aaaaaaaaaaaccccaa"
| + | |
| - | rbs2.description = "RBS2"
| + | |
| - | rbs[0] = rbs1
| + | |
| - | rbs[1] = rbs2
| + | |
| - | addForbiddenSequence(rbs,'noTarget')
| + | |
| - | return rbs
| + | |
| - | }
| + | |
| - | | + | |
| - | function addForbiddenSequence(array,type){
| + | |
| - | if (type == 'hasTarget'){
| + | |
| - | for (item in array){
| + | |
| - | forbiddenSequences.addSite(array[item].description,array[item].target)
| + | |
| - | }
| + | |
| - | } else{
| + | |
| - | for (item in array){
| + | |
| - | forbiddenSequences.addSite(array[item].description,array[item].sequence)
| + | |
| - | }
| + | |
| - | }
| + | |
| - |
| + | |
| - | }
| + | |
| - | | + | |
| - | function getDate(){
| + | |
| - | today = new Date()
| + | |
| - | dd = today.getDate()
| + | |
| - | mm = today.getMonth()+1
| + | |
| - | yyyy = today.getFullYear()
| + | |
| - | if(dd<10){
| + | |
| - | dd='0'+dd
| + | |
| - | }
| + | |
| - | if(mm<10){
| + | |
| - | mm='0'+mm
| + | |
| - | }
| + | |
| - | today = dd+'-'+mm.substring(0,2)+'-'+yyyy;
| + | |
| - | return today
| + | |
| - | }
| + | |
| - | | + | |
| - | function generateWhiteSpace(amount){
| + | |
| - | output = ''
| + | |
| - | for (i=0;i<amount;i++){
| + | |
| - | output += ' '
| + | |
| - | }
| + | |
| - | return output
| + | |
| - | }
| + | |
| - | | + | |
| - | function staticGenbank(name){
| + | |
| - | output = 'LOCUS'
| + | |
| - | output += generateWhiteSpace(16)
| + | |
| - | output += name
| + | |
| - | output += generateWhiteSpace(8)
| + | |
| - | output += memoryPlasmid.dna.length+' bp DNA '
| + | |
| - | output += generateWhiteSpace(3)
| + | |
| - | output += 'linear'
| + | |
| - | output += generateWhiteSpace(7)
| + | |
| - | output += getDate()+'<br>'
| + | |
| - | output += 'DEFINITION<br>'
| + | |
| - | output += 'ACCESSION<br>'
| + | |
| - | output += 'VERSION<br>'
| + | |
| - | output += 'SOURCE<br>'
| + | |
| - | output += ' ORGANISM<br>'
| + | |
| - | output += 'COMMENT<br>'
| + | |
| - | output += 'FEATURES'
| + | |
| - | output += generateWhiteSpace(13)
| + | |
| - | output += 'Location/Qualifiers<br>'
| + | |
| - | return output
| + | |
| - | }
| + | |
| - | | + | |
| - | function genbank(){
| + | |
| - | memoryPlasmidOutput = staticGenbank('memory_plasmid')
| + | |
| - | for (item in memoryPlasmid.memoryObjects){
| + | |
| - | for (key in memoryPlasmid.memoryObjects[item]){
| + | |
| - | memoryPlasmidOutput += generateWhiteSpace(5)
| + | |
| - | memoryPlasmidOutput += 'misc_feature'
| + | |
| - | memoryPlasmidOutput += generateWhiteSpace(5)
| + | |
| - | memoryPlasmidOutput += memoryPlasmid.memoryObjects[item][key].start+'...'+memoryPlasmid.memoryObjects[item][key].end+'<br>'
| + | |
| - | memoryPlasmidOutput += generateWhiteSpace(10)
| + | |
| - | memoryPlasmidOutput += '/label='+memoryPlasmid.memoryObjects[item][key].description+'<br>'
| + | |
| - | }
| + | |
| - |
| + | |
| - | }
| + | |
| - | origin = memoryPlasmid.dna
| + | |
| - | origin = origin.replace(/[atgc]{10}/g,'$& ').replace(/amp;/g,'').split(' ')
| + | |
| - | pos = 1
| + | |
| - | newString = ''
| + | |
| - | memoryPlasmidOutput += 'ORIGIN<br>'
| + | |
| - | for (i=0;i<origin.length;i++){
| + | |
| - | newString = newString+' '+origin[i]
| + | |
| - | if ((i+1)%6===0){
| + | |
| - | whiteSpace = ''
| + | |
| - | for (j=0;j<9-pos.toString().length;j++){
| + | |
| - | whiteSpace+= ' '
| + | |
| - | }
| + | |
| - | newString = whiteSpace+pos + ' ' + newString
| + | |
| - | memoryPlasmidOutput+=newString+'<br>'
| + | |
| - | newString = ''
| + | |
| - | } else if ((i+1)%6==1){
| + | |
| - | if (i!=0){
| + | |
| - | pos+=60
| + | |
| - | }
| + | |
| - | }
| + | |
| - | }
| + | |
| - | if (origin.length%6 != 0){
| + | |
| - | newString = ''
| + | |
| - | whiteSpace = ''
| + | |
| - | for (j=0;j<9-pos.toString().length;j++){
| + | |
| - | whiteSpace+= ' '
| + | |
| - | }
| + | |
| - | newString+=whiteSpace+pos
| + | |
| - | for (i=0;i<(origin.length%6);i++){
| + | |
| - | newString+=' '+origin[origin.length-origin.length%6+i]
| + | |
| - | }
| + | |
| - | memoryPlasmidOutput+=newString+'<br>'
| + | |
| - | }
| + | |
| - | restrictionPlasmidOutput = staticGenbank('restriction_plasmid')
| + | |
| - | targetSites = new Array()
| + | |
| - | for (item in memoryPlasmid.memoryObjects){
| + | |
| - | site = new Object()
| + | |
| - | site.zincFinger = memoryPlasmid.memoryObjects[item].zincFinger.featureObject.target
| + | |
| - | site.methyltransferase = memoryPlasmid.memoryObjects[item].methyltransferase.featureObject.target
| + | |
| - | targetSites[item-1] = site
| + | |
| - | }
| + | |
| - | restrictionOrigin = memoryPlasmid.features[1].sequence
| + | |
| - | for (key in targetSites){
| + | |
| - | restrictionOrigin += randomDNA(10)
| + | |
| - | restrictionPlasmidOutput += generateWhiteSpace(5)
| + | |
| - | restrictionPlasmidOutput += 'misc_feature'
| + | |
| - | restrictionPlasmidOutput += generateWhiteSpace(5)
| + | |
| - | restrictionPlasmidOutput += restrictionOrigin.length+1+'...'
| + | |
| - | restrictionOrigin += targetSites[key].zincFinger
| + | |
| - | restrictionPlasmidOutput += restrictionOrigin.length+'<br>'
| + | |
| - | restrictionOrigin += randomDNA(10)
| + | |
| - | restrictionPlasmidOutput += generateWhiteSpace(5)
| + | |
| - | restrictionPlasmidOutput += 'misc_feature'
| + | |
| - | restrictionPlasmidOutput += generateWhiteSpace(5)
| + | |
| - | restrictionPlasmidOutput += restrictionOrigin.length+1+'...'
| + | |
| - | restrictionOrigin += targetSites[key].methyltransferase
| + | |
| - | restrictionPlasmidOutput += restrictionOrigin.length+'<br>'
| + | |
| - | restrictionOrigin += targetSites[key].methyltransferase
| + | |
| - | }
| + | |
| - | restrictionOrigin = restrictionOrigin.toLowerCase()
| + | |
| - | restrictionOrigin = restrictionOrigin.replace(/[atgc]{10}/g,'$& ').replace(/amp;/g,'').split(' ')
| + | |
| - | pos = 1
| + | |
| - | newString = ''
| + | |
| - | restrictionPlasmidOutput += 'ORIGIN<br>'
| + | |
| - | for (i=0;i<restrictionOrigin.length;i++){
| + | |
| - | newString = newString+' '+restrictionOrigin[i]
| + | |
| - | if ((i+1)%6===0){
| + | |
| - | whiteSpace = ''
| + | |
| - | for (j=0;j<9-pos.toString().length;j++){
| + | |
| - | whiteSpace+= ' '
| + | |
| - | }
| + | |
| - | newString = whiteSpace+pos + ' ' + newString
| + | |
| - | restrictionPlasmidOutput+=newString+'<br>'
| + | |
| - | newString = ''
| + | |
| - | } else if ((i+1)%6==1){
| + | |
| - | if (i!=0){
| + | |
| - | pos+=60
| + | |
| - | }
| + | |
| - | }
| + | |
| - | }
| + | |
| - | if (restrictionOrigin.length%6 != 0){
| + | |
| - | newString = ''
| + | |
| - | whiteSpace = ''
| + | |
| - | for (j=0;j<9-pos.toString().length;j++){
| + | |
| - | whiteSpace+= ' '
| + | |
| - | }
| + | |
| - | newString+=whiteSpace+pos
| + | |
| - | for (i=0;i<(restrictionOrigin.length%6);i++){
| + | |
| - | newString+=' '+restrictionOrigin[restrictionOrigin.length-restrictionOrigin.length%6+i]
| + | |
| - | }
| + | |
| - | restrictionPlasmidOutput+=newString+'<br>'
| + | |
| - | }
| + | |
| - | myWindow=window.open()
| + | |
| - | myWindow.document.write(memoryPlasmidOutput)
| + | |
| - | myWindow.focus()
| + | |
| - | restrictionSiteWindow = window.open()
| + | |
| - | restrictionSiteWindow.document.write(restrictionPlasmidOutput)
| + | |
| - | restrictionSiteWindow.focus()
| + | |
| - | }
| + | |
| - | | + | |
| - | function formatPlasmidInput(backbone){
| + | |
| - | backbone = backbone.split('\n')
| + | |
| - | originBoolean = false
| + | |
| - | backboneName = ''
| + | |
| - | sequence = ''
| + | |
| - | if (backbone[0].toLowerCase().indexOf('locus') != -1){
| + | |
| - | for (i=0;i<backbone.length;i++){
| + | |
| - | if (originBoolean === true){
| + | |
| - | if (backbone[i].indexOf('//') == -1){
| + | |
| - | appendThis = backbone[i].replace(/[0-9]|\s|\n|\t/g,'')
| + | |
| - | sequence = sequence+appendThis
| + | |
| - | } else{
| + | |
| - | originalBoolean = false
| + | |
| - | }
| + | |
| - | }
| + | |
| - | if (backbone[i].indexOf('locus') != -1){
| + | |
| - | backboneName = backbone[i].split(/\s+|\t+/g)[1]
| + | |
| - | }
| + | |
| - | if (backbone[i].indexOf('origin') != -1){
| + | |
| - | originBoolean = true
| + | |
| - | }
| + | |
| - | }
| + | |
| - | } else if (backbone[0][0] == '>'){
| + | |
| - | for (i=0;i<backbone.length;i++){
| + | |
| - | if (backbone[i][0] != '>'){
| + | |
| - | appendThis = backbone[i].replace(/[0-9]|\s|\n|\t/g,'')
| + | |
| - | sequence = sequence+appendThis
| + | |
| - | } else{
| + | |
| - | backboneName = backbone[i].replace('>','')
| + | |
| - | }
| + | |
| - | }
| + | |
| - | }
| + | |
| - | memoryPlasmid.addFeature(1,sequence.length,'Backbone',sequence,backboneName,'')
| + | |
| - | return sequence
| + | |
| - | }
| + | |
| - | | + | |
| - | function feature(start,end,type,sequence,description,featureObject){
| + | |
| - | this.start = start;
| + | |
| - | this.end = end;
| + | |
| - | this.type = type;
| + | |
| - | this.sequence = sequence;
| + | |
| - | this.description = description;
| + | |
| - | this.featureObject = featureObject
| + | |
| - | }
| + | |
| - | | + | |
| - | var restrictionPlasmid = {
| + | |
| - | backboneName : '',
| + | |
| - | dna : '',
| + | |
| - | features : {},
| + | |
| - | setBackboneName : function(backboneName){
| + | |
| - | restrictionlasmid.backboneName = backboneName
| + | |
| - | },
| + | |
| - | setDNA : function(dna){
| + | |
| - | restrictionPlasmid.dna = dna
| + | |
| - | },
| + | |
| - | addFeature : function(start,end,type,sequence,description){
| + | |
| - | restrictionPlasmid.features[start] = new feature(start,end,type,sequence,description)
| + | |
| - | },
| + | |
| - | addRecognitionAreaObject : function(zfTarget,mtaseTarget){
| + | |
| - | | + | |
| - | recognitionPlasmid.zfTarget = zfTarget
| + | |
| - | recognitionPlasmid.mtaseTarget = mtaseTarget
| + | |
| - | }
| + | |
| - | }
| + | |
| - | | + | |
| - | var memoryPlasmid = {
| + | |
| - | backboneName : '',
| + | |
| - | dna : '',
| + | |
| - | features : {},
| + | |
| - | memoryObjects : {},
| + | |
| - | setBackboneName : function(backboneName){
| + | |
| - | memoryPlasmid.backboneName = backboneName
| + | |
| - | },
| + | |
| - | setDNA : function(dna){
| + | |
| - | memoryPlasmid.dna = dna
| + | |
| - | },
| + | |
| - | addMemoryObject : function(sensor,rbs,zincFinger,linker,mycTag,methyltransferase,terminator){
| + | |
| - | memoryObject = new Object()
| + | |
| - | memoryObject.sensor = sensor
| + | |
| - | memoryObject.rbs = rbs
| + | |
| - | memoryObject.zincFinger = zincFinger
| + | |
| - | memoryObject.linker = linker
| + | |
| - | memoryObject.mycTag = mycTag
| + | |
| - | memoryObject.methyltransferase = methyltransferase
| + | |
| - | memoryObject.terminator = terminator
| + | |
| - | memoryPlasmid.memoryObjects[sensor.start] = memoryObject
| + | |
| - | },
| + | |
| - | addFeature : function(start,end,type,sequence,description){
| + | |
| - | memoryPlasmid.features[start] = new feature(start,end,type,sequence,description)
| + | |
| - | }
| + | |
| - | }
| + | |
| - | | + | |
| - | function sensorObject(name,sequence){
| + | |
| - | this.name = name
| + | |
| - | this.sequence = sequence
| + | |
| - |
| + | |
| - | }
| + | |
| - |
| + | |
| - | function formatSensors(sensors){
| + | |
| - | sensorArray = new Array()
| + | |
| - | if (sensors.indexOf('LOCUS') != -1){
| + | |
| - | sensors = sensors.split('LOCUS')
| + | |
| - | sensors.reverse().pop()
| + | |
| - | for (i=0;i<sensors.length;i++){
| + | |
| - | originBoolean = false
| + | |
| - | sensorName = ''
| + | |
| - | sequence = ''
| + | |
| - | sensor = sensors[i].split('\n')
| + | |
| - | for (j=0;j<sensor.length;j++){
| + | |
| - | if (j===0){
| + | |
| - | sensorName = sensor[j]
| + | |
| - | }
| + | |
| - | if (originBoolean === true){
| + | |
| - | if (sensor[j].indexOf('//') == -1){
| + | |
| - | appendThis = sensor[j].replace(/[0-9]|\s|\n|\t/g,'')
| + | |
| - | sequence += appendThis
| + | |
| - | } else {
| + | |
| - | originBoolean = false
| + | |
| - | }
| + | |
| - | }
| + | |
| - | if (sensor[j].indexOf('ORIGIN') != -1){
| + | |
| - | originBoolean = true
| + | |
| - | }
| + | |
| - | }
| + | |
| - | sensorArray[i] = new sensorObject(sensorName,sequence)
| + | |
| - | }
| + | |
| - | } else if (sensors[0] == '>'){
| + | |
| - | sensors = sensors.split('//')
| + | |
| - | sensors.pop()
| + | |
| - | sensorName = ''
| + | |
| - | for (i=0;i<sensors.length;i++){
| + | |
| - | sensor = sensors[i].split('\n')
| + | |
| - | sequence = ''
| + | |
| - | for (j=0;j<sensor.length;j++){
| + | |
| - | if (sensor[j][0] != '>'){
| + | |
| - | appendThis = sensor[j].replace(/[0-9]|\s|\n|\t/g,'')
| + | |
| - | sequence = sequence+appendThis
| + | |
| - | } else if (sensor[j][0] == '>'){
| + | |
| - | sensorName = sensor[j].replace('>','')
| + | |
| - | }
| + | |
| - | }
| + | |
| - | sensorArray[i] = new sensorObject(sensorName,sequence)
| + | |
| - | }
| + | |
| - | }
| + | |
| - | return sensorArray
| + | |
| - | }
| + | |
| - | | + | |
| - | function formatPartsregistryPromoters(){
| + | |
| - | promoters = new Array()
| + | |
| - | $("input:checkbox[name=promoter]:checked").each(function(){
| + | |
| - | promoter = $(this).val().split(':')
| + | |
| - | promoters.push(new sensorObject(promoter[0],promoter[2]))
| + | |
| - | })
| + | |
| - | return promoters
| + | |
| - | }
| + | |
| - | | + | |
| - | function configuratePlasmid(sensorArray,number){
| + | |
| - | memoryPlasmid.features = {}
| + | |
| - | memoryPlasmid.memoryObjects = {}
| + | |
| - | backbone = document.plasmidForm.plasmid.value.toLowerCase()
| + | |
| - | methyltransferases = getMethyltransferases()
| + | |
| - | zincFingers = getZincFingers()
| + | |
| - | linkers = getLinkers()
| + | |
| - | mycTags = getMycTags()
| + | |
| - | rbs = getRBS()
| + | |
| - | terminators = getTerminators()
| + | |
| - | plasmidSequence = formatPlasmidInput(backbone)
| + | |
| - | memoryPlasmid.setDNA(plasmidSequence)
| + | |
| - | for (i=0;i<sensorArray.length;i++){
| + | |
| - | featureArray = new Array()
| + | |
| - | featureArray[0] = new feature(memoryPlasmid.dna.length+1,memoryPlasmid.dna.length+sensorArray[i].sequence.length,'Sensor',sensorArray[i].sequence,sensorArray[i].name,sensorArray[i])
| + | |
| - | memoryPlasmid.setDNA(memoryPlasmid.dna+sensorArray[i].sequence)
| + | |
| - | j = Math.floor((Math.random()*rbs.length))
| + | |
| - | featureArray[1] = new feature(memoryPlasmid.dna.length+1,memoryPlasmid.dna.length+rbs[j].sequence.length,'RBS',rbs[j].sequence,rbs[j].description,rbs[j])
| + | |
| - | memoryPlasmid.setDNA(memoryPlasmid.dna+rbs[j].sequence+randomDNA(3))
| + | |
| - | memoryPlasmid.setDNA(memoryPlasmid.dna+'atg'+randomDNA(10))
| + | |
| - | for (j=0;j<zincFingers.length;j++){
| + | |
| - | if (checkOccurrence(zincFingers[j].target.toLowerCase(),memoryPlasmid.dna) === true || checkOccurrence(zincFingers[j].sequence.toLowerCase(),memoryPlasmid.dna) === true){
| + | |
| - | continue
| + | |
| - | } else{
| + | |
| - | featureArray[2] = new feature(memoryPlasmid.dna.length+1,memoryPlasmid.dna.length+zincFingers[j].sequence.length,'Zinc Finger',zincFingers[j].sequence,zincFingers[j].description,zincFingers[j])
| + | |
| - | memoryPlasmid.setDNA(memoryPlasmid.dna+zincFingers[j].sequence)
| + | |
| - | break
| + | |
| - | }
| + | |
| - | }
| + | |
| - | j = Math.floor((Math.random()*linkers.length))
| + | |
| - | featureArray[3] = new feature(memoryPlasmid.dna.length+1,memoryPlasmid.dna.length+linkers[j].sequence.length,'Linker',linkers[j].sequence,linkers[j].description,linkers[j])
| + | |
| - | memoryPlasmid.setDNA(memoryPlasmid.dna+linkers[j].sequence)
| + | |
| - | j = Math.floor((Math.random()*mycTags.length))
| + | |
| - | featureArray[4] = new feature(memoryPlasmid.dna.length+1,memoryPlasmid.dna.length+mycTags[j].sequence.length,'Myc Tag',mycTags[j].sequence,mycTags[j].description,mycTags[j])
| + | |
| - | memoryPlasmid.setDNA(memoryPlasmid.dna+mycTags[j].sequence)
| + | |
| - | j = Math.floor((Math.random()*methyltransferases.length))
| + | |
| - | featureArray[5] = new feature(memoryPlasmid.dna.length+1,memoryPlasmid.dna.length+methyltransferases[j].sequence.length,'Methyltransferase',methyltransferases[j].sequence,methyltransferases[j].description,methyltransferases[j])
| + | |
| - | memoryPlasmid.setDNA(memoryPlasmid.dna+methyltransferases[j].sequence)
| + | |
| - | j = Math.floor((Math.random()*terminators.length))
| + | |
| - | featureArray[6] = new feature(memoryPlasmid.dna.length+1,memoryPlasmid.dna.length+terminators[j].sequence.length,'Terminator',terminators[j].sequence,terminators[j].description,terminators[j])
| + | |
| - | memoryPlasmid.setDNA(memoryPlasmid.dna+terminators[j].sequence+randomDNA(10))
| + | |
| - | memoryPlasmid.addMemoryObject(featureArray[0],featureArray[1],featureArray[2],featureArray[3],featureArray[4],featureArray[5],featureArray[6])
| + | |
| - | }
| + | |
| - | restrictionPlasmid.setDNA(memoryPlasmid.features[1].sequence)
| + | |
| - | for (item in memoryPlasmid.memoryObjects){
| + | |
| - | featureArray = new Array()
| + | |
| - | mtaseStart = restrictionPlasmid.dna.length+1
| + | |
| - | mtaseEnd = restrictionPlasmid.dna.length+memoryPlasmid.memoryObjects[item].methyltransferase.featureObject.target.length
| + | |
| - | mtaseType = 'Restriction Site'
| + | |
| - | mtaseTarget = memoryPlasmid.memoryObjects[item].methyltransferase.featureObject.target.toLowerCase()
| + | |
| - | mtaseDescription = memoryPlasmid.memoryObjects[item].methyltransferase.featureObject.description+' restriction site'
| + | |
| - | featureArray[0] = new feature(mtaseStart,mtaseEnd,mtaseType,mtaseTarget,mtaseDescription)
| + | |
| - | restrictionPlasmid.setDNA(restrictionPlasmid.dna+mtaseTarget)
| + | |
| - | zfStart = restrictionPlasmid.dna.length+1
| + | |
| - | zfEnd = restrictionPlasmid.dna.length+memoryPlasmid.memoryObjects[item].zincFinger.featureObject.target.length
| + | |
| - | zfType = 'Restriction Site'
| + | |
| - | zfTarget = memoryPlasmid.memoryObjects[item].zincFinger.featureObject.target
| + | |
| - | zfDescription = memoryPlasmid.memoryObjects[item].zincFinger.featureObject.description+' restriction site'
| + | |
| - | featureArray[1] = new feature(zfStart,zfEnd,zfType,zfTarget,zfDescription)
| + | |
| - | restrictionPlasmid.setDNA(restrictionPlasmid.dna+mtaseTarget)
| + | |
| - | restrictionPlasmid.mtaseTarget = featureArray[0]
| + | |
| - | restrictionPlasmid.zfTarget = featureArray[1]
| + | |
| - | }
| + | |
| - | //genbank()
| + | |
| - | json = createJSON()
| + | |
| - | init(json)
| + | |
| - | }
| + | |
| - | | + | |
| - | function setup(){
| + | |
| - | addForbiddenSequences()
| + | |
| - | sensors = document.plasmidForm.sensors.value.toLowerCase()
| + | |
| - | sensorArray = formatSensors(sensors)
| + | |
| - | promoters = formatPartsregistryPromoters()
| + | |
| - | sensorArray = promoters.concat(sensorArray)
| + | |
| - | tempArray = new Array()
| + | |
| - | j = 0
| + | |
| - | number = 0
| + | |
| - | for (sensor in sensorArray){
| + | |
| - | tempArray[j] = sensorArray[sensor]
| + | |
| - | j++
| + | |
| - | if (j%5 === 0 && j !== 0){
| + | |
| - | configuratePlasmid(tempArray,number)
| + | |
| - | number++
| + | |
| - | tempArray = new Array()
| + | |
| - | j = 0
| + | |
| - | }
| + | |
| - | }
| + | |
| - | if (j%5 !== 0){
| + | |
| - | configuratePlasmid(tempArray,number)
| + | |
| - | }
| + | |
| - | }
| + | |
| - | | + | |
| - | function createJSON(){
| + | |
| - | var json = {
| + | |
| - | "children": [
| + | |
| - | {
| + | |
| - | "children": [],
| + | |
| - | "data": {
| + | |
| - | "description": "Fixed polar interpolation problem when theta = pi",
| + | |
| - | "$color": "#B0AAF6",
| + | |
| - | "$angularWidth": 1000,
| + | |
| - | },
| + | |
| - | "id": "Source/Coordinates",
| + | |
| - | "name": "Backbone"
| + | |
| - | },
| + | |
| - | {
| + | |
| - | "children": [],
| + | |
| - | "data": {
| + | |
| - | "description": "Memory part",
| + | |
| - | "$color": "#B2ABF4",
| + | |
| - | "$angularWidth": 1000,
| + | |
| - | },
| + | |
| - | "id": "Source/Core",
| + | |
| - | "name": "Memory part"
| + | |
| - | },
| + | |
| - |
| + | |
| - | ],
| + | |
| - | "data": {
| + | |
| - | "$type": "none"
| + | |
| - | },
| + | |
| - | "id": "Source",
| + | |
| - | "name": "Plasmid"
| + | |
| - | };
| + | |
| - | json.children[0].children[0] = {}
| + | |
| - | json.children[0].children[0].data = {}
| + | |
| - | json.children[0].children[0].data.description = memoryPlasmid.features[1].description
| + | |
| - | json.children[0].children[0].data.$color = '#B2ABF4'
| + | |
| - | json.children[0].children[0].data.length = memoryPlasmid.features[1].end - memoryPlasmid.features[1].start
| + | |
| - | json.children[0].children[0].data.$angularWidth = 1000
| + | |
| - | json.children[0].children[0].data.type = memoryPlasmid.features[1].type
| + | |
| - | json.children[0].children[0].children = []
| + | |
| - | json.children[0].children[0].name = memoryPlasmid.features[1].description
| + | |
| - | json.children[0].children[0].id = memoryPlasmid.features[1].description
| + | |
| - | i = 0
| + | |
| - | for (memoryObject in memoryPlasmid.memoryObjects){
| + | |
| - | for (feature in memoryPlasmid.memoryObjects[memoryObject]){
| + | |
| - | json.children[1].children[i] = []
| + | |
| - | json.children[1].children[i].data = {}
| + | |
| - | json.children[1].children[i].data.description = memoryPlasmid.memoryObjects[memoryObject][feature].description
| + | |
| - | type = memoryPlasmid.memoryObjects[memoryObject][feature].type
| + | |
| - | color = '#B2ABF4'
| + | |
| - | if (type == 'Sensor'){
| + | |
| - | color = '#00FFFF'
| + | |
| - | } else if (type == 'RBS'){
| + | |
| - | color = '#FFFF00'
| + | |
| - | } else if (type == 'Zinc Finger'){
| + | |
| - | color = '#800080'
| + | |
| - | } else if (type == 'Linker'){
| + | |
| - | color = '#00FF00'
| + | |
| - | } else if (type == 'Myc Tag'){
| + | |
| - | color = '#FF00FF'
| + | |
| - | } else if (type == 'Methyltransferase'){
| + | |
| - | color = '#FFA500'
| + | |
| - | } else if (type == 'Terminator'){
| + | |
| - | color = '#FF0000'
| + | |
| - | } else{
| + | |
| - | color = '#B2ABF4'
| + | |
| - | }
| + | |
| - | json.children[1].children[i].data.$color = color
| + | |
| - | json.children[1].children[i].data.length = memoryPlasmid.memoryObjects[memoryObject][feature].end - memoryPlasmid.memoryObjects[memoryObject][feature].start
| + | |
| - | json.children[1].children[i].data.$angularWidth = 1000
| + | |
| - | json.children[1].children[i].data.type = type
| + | |
| - | json.children[1].children[i].id = i
| + | |
| - | json.children[1].children[i].name = memoryPlasmid.memoryObjects[memoryObject][feature].description
| + | |
| - | i++
| + | |
| - | }
| + | |
| - | }
| + | |
| - | return json
| + | |
| - | //end
| + | |
| - | }
| + | |
| - | | + | |
| - | </script> | + | |
| - | </head>
| + | |
| | </html> | | </html> |
| - | <div id="main-content">
| |
| - | {{Team:Amsterdam/toolForm}}
| |
| - | </div>
| |
| | {{Team:Amsterdam/Foot}} | | {{Team:Amsterdam/Foot}} |
"
