Team:SEU O China/Notebook

From 2012.igem.org

(Difference between revisions)
 
(32 intermediate revisions not shown)
Line 12: Line 12:
     <div class="col_list">
     <div class="col_list">
         <center>
         <center>
 +
<ul type="none">
 +
    <li id="pr">Protocols</li>
 +
</ul><br>
 +
        <h2> Pre-experiment</h2>
<ul type="none">
<ul type="none">
    <li id="m3">March</li>
    <li id="m3">March</li>
Line 17: Line 21:
    <li id="m5">May</li>       
    <li id="m5">May</li>       
</ul><br>
</ul><br>
 +
        <h2> June</h2>
 +
<ul type="none">
 +
    <li id="6w3">Week3</li>
 +
    <li id="6w4">Week4</li>
 +
    <li id="6w5">Week5</li>     
 +
</ul><br>
 +
        <h2> July</h2>
 +
<ul type="none">
 +
    <li id="7w1">Week1</li>
 +
    <li id="7w2">Week2</li>
 +
    <li id="7w3">Week3</li>   
 +
    <li id="7w4">Week4</li>
 +
    <li id="7w5">Week5</li>     
 +
</ul><br>
 +
        <h2> August</h2>
 +
<ul type="none">
 +
    <li id="8w1">Week1</li>
 +
    <li id="8w2">Week2</li>
 +
    <li id="8w3">Week3</li>   
 +
    <li id="8w4">Week4</li>
 +
    <li id="8w5">Week5</li>     
 +
</ul><br>
 +
        <h2> September</h2>
 +
<ul type="none">
 +
    <li id="9w1">Week1</li>
 +
    <li id="9w2">Week2</li>
 +
    <li id="9w3">Week3</li>       
 +
</ul><br>
 +
         </center>
         </center>
     </div><!-- end nav -->   
     </div><!-- end nav -->   
Line 24: Line 57:
<div id="col_left">
<div id="col_left">
 +
 +
<div class="content" id="prcontent">
 +
<h3>Protocols</h3><br>
 +
</html>
 +
'''LB Medium:'''
 +
 +
Liquid:
 +
*10 g of tryptone,
 +
*5 g of yeast extract,
 +
*10 g of NaCl,
 +
*1 liter of distilled water
 +
 +
Solid:
 +
*10 g of tryptone,
 +
*5 g of yeast extract,
 +
*10 g of NaCl,
 +
*15 g of agar,
 +
*1 liter of distilled water
 +
 +
 +
 +
'''Biobrick Assembly Restriction Digest:'''
 +
 +
For a double digest:
 +
 +
#To a pcr tube, add 15 ul of miniprepped plasmid or purified PCR product
 +
#Add 3 ul of the appropriate buffer
 +
#Add 1ul of each enzyme.
 +
#Incubate at 4˚C overnight.
 +
 +
 +
 +
'''Biobrick Assembly Ligation:'''
 +
#In a PCR tube, add restriction digested and PCR purified insert to backbone in a 4:1 molar ratio, usually 1 ul backbone with 4 ul insert works.
 +
#Add 10ul T4 ligase buffer
 +
#Add 1 ul T4 ligase
 +
#Create a negative control replacing the insert with water
 +
#Add reactions to thermal cycler, and leave at 4˚C overnight.
 +
#Use 2 ul of the ligation reactions to transform cells.
 +
 +
 +
 +
'''PCR/Gel Extraction'''
 +
 +
Fresh TAE buffer as running buffer is recommended. Reusing running buffer will result the increase of the pH and then reduce yields.
 +
 +
#For cycle-pure (PCR reaction): Add 2 volumes of Buffer GC to 1 volume of the PCR reaction and mix completely by vortexing. Briefly spin the tube to collect any drops from the inside wall and tube lid. For PCR products less than 200 bp, add 5 volumes of Buffer GC to 1 volume of PCR reaction
 +
#For agarose gel: Excise the DNA fragment from the agarose gel and weigh it in a 1.5 mL microtube. Add 1 volume of Buffer GC to 1 volume of gel to the 1.5 mL microtube and incubate the mixture at 55-60°C for 8 min. Mix the tube by tapping the bottom every 2 min till the gel has melted completely. Cool the tube to room temperature.'' Note: A gel slice of 100 mg approximately equals to 100 μL.  For DNA fragment less than 200 bp, add 1 volume of isopropanol.''
 +
#Transfer up to 700 μL DNA/Buffer GC mixture to a spin column with a collection tube. Centrifuge at 13,000 x g for 1 min at room temperature. Discard the flow-through and put the column back to the collection tube. Repeat this step to process the remaining solution.
 +
#Add 300 μL of Buffer GC into the DNA Mini Column. Centrifuge at 13,000 x g for 30 to 60 seconds at room temperature to wash the DNA Mini Column.
 +
#Add 650 μL DNA Wash Buffer to the column and centrifuge at 13,000 x g for 30 s at room temperature. Discard the flow through and insert the column, with the lid open, back to the collection tube. Repeat step “4”. ''Note: Ensure that ethanol has been added to DNA Wash Buffer as instructed .''
 +
#Centrifuge the empty DNA column, with the lid open, at 13,000 x g for 2 min to dry the ethanol residue in the matrix. ''Note: The residual ethanol will be removed more efficiently with the column lid open during centrifugation.''
 +
#Place the column into a clean 1.5 mL micocentrifuge tube and add 30-50 μL pre-warmed (60oC) Elution Buffer or ddH2O to the center of the column. Incubate at room temperature for 1 min. Centrifuge at 13,000 x g for 1 min
 +
 +
 +
 +
'''Miniprep Plasmids'''
 +
#Inoculate 1-4 mL LB containing appropriate antibiotic with a fresh colony from a freshly streaked selective plate. Incubate at 37°C for 14-16 hours with vigorous shaking. ''Note: Prolonged incubation (> 16 hours) is not recommended since the E.coli starts to lyse and the plasmid yields may be reduced. Do not grow the culture directly from the glycerol stock. This protocol is optimized for E. coli strain cultured in LB medium. When using TB or 2xYT medium, special care needs to be taken to ensure the cell density doesn’t exceed 3.0 (OD600). Buffers need to be scaled up proportionally if over amount of cultures are being processed.''
 +
#Harvest the bacterial culture by centrifugation for 1 min at 10,000 rpm. Pour off the supernatant and blot the inverted tube on a paper towel to remove residue medium. Remove the residue medium completely. ''Note: Residue medium will cause,''
 +
#*Poor cell lysis and thus lower DNA yield.
 +
#*Loose pellet after centrifugation in step 6.
 +
#Add 250 μL Buffer A1 (Add RNase A to Buffer A1 before use) and completely resuspend bacterial pellet by vortexing or pipetting. ''Note: Complete resuspension is critical for bacterial lysis and lysate neutralization.''
 +
#Add 250 μL Buffer B1, mix gently by inverting the tube 10 times (do not vortex), and incubate at room temperature for 5 minutes. ''Note: Do not incubate for more than 5 minutes. Note: Buffer B1 precipitates (cloudy look) below room temperature. Warm up Buffer B1 at 50°C to dissolve precipitation before use.''
 +
#Add 350 μL Buffer N1, mix completely by inverting/shaking the vial for 5 times and sharp hand shaking for 2 times. ''Note: Incubating the lysate in ice for 1 min will improve the yield. It is critical to mix the solution well. If the mixture still appears conglobated, brownish or viscous, more mixing is required to completely neutralize the solution.''
 +
#Centrifuge the lysate at 13,000 rpm for 10 minutes at room temperature. ''Note: If the lysate doesn’t appear clean, reverse the tube angle, centrifuge for 5 more minutes and then transfer the clear lysate to DNA column. ''
 +
#Carefully transfer the clear lysate into a DNA column with a collection tube, avoid the precipitations, spin at 13,000 rpm for 1 minute, discard the flow-through and put the column back to the collection tube.
 +
#Optional: Add 500 μL Buffer KB into the spin column, centrifuge at 13,000 rpm for 1 minute. Remove the spin column from the tube and discard the flow-through. Put the column back to the collection tube. ''Note: Buffer KB is recommended for endA+ strains such as HB101, JM101, TG1 or their derived strains. It is not necessary for isolating DNA from endA- strains such as Top 10 and DH5a.''
 +
#Add 650 μL DNA Wash Buffer (Add ethanol to DNA wash buffer before use) into the spin column, centrifuge at 13,000 rpm for 1 minute at room temperature. Remove the spin column from the tube and discard the flow-through. Repeat step “9” to improve the recovery.
 +
#Reinsert the spin column, with the lid open, into the collection tube and centrifuge for 2 minutes at 13,000 rpm. ''Note: Residual ethanol can be removed more efficiently with the column lid open. It is critical to remove residual ethanol completely.''
 +
#Carefully transfer the spin column into a sterile 1.5 mL tube and add 50-100 μL (> 50 μL) Sterile ddH20 or Elution Buffer into the center of the column and let it stand for 2 minutes. Elute the DNA by centrifugation at 13,000 rpm for 1 minute. Reload the eluate into the column and elute again. ''Note: If ddH2O is applied, please make sure the pH is no less than 7.0 (7.0-8.5 is preferred). NaOH could be used to adjust the pH of ddH2O. The DNA is ready for downstream applications such ascloning/subcloning, RFLP, library screening, in vitro translation, sequencing, transfection of robust cells such as HEK293 cells. Note: It’s highly recommended to remove the endotoxin (PD1212) if the DNA is used for endotoxin-sensitive cell lines, primary cultured cells or micro-injection. ''
 +
#The DNA concentration can be calculated as follows, Concentration (μg/mL) = OD260nm x 50 x dilution factor.
 +
 +
 +
 +
'''Transforming DNA from Distribution Plates:'''
 +
#Thaw competent cells on ice.
 +
#Add 10 microliters of pure water to each well of DNA from plates, pipette up and down.
 +
#Transfer into storage tube.
 +
#Pipette 1-2 microliters of the DNA into the competent cell tubes.
 +
#Stir with pipette tip, gently flick tube.
 +
#Leave on ice for 30 minutes.
 +
#Heat Shock for 45 sec by using a water bath set to 42°C and then chill on ice for 2 min.
 +
#Pipette 500 micro Liters of S.O.C. (LB + glucose) into 14ml culture tubes; transfer the competent cells into these tubes and incubate in a 37 degree shaker for 40-60 minutes before plating.
 +
#For source plate DNA, plate 100 microliters.
 +
 +
 +
 +
'''Taq PCR'''
 +
 +
Set up tubes with 7 ul H20, 1 ul template, 1 ul forward primer, 1 ul reverse primer, 10 ul PCR mix
 +
*94°C for 1:30 min
 +
*35 cycles of:
 +
**94°C for 0:30 min
 +
**54°C for 1:00 min
 +
**72°C for 1:00 min/Kb
 +
*Final extension: 72°C for 6:00 min
 +
 +
'''Colony PCR'''
 +
#Suspend colonies in 5 ul H20
 +
#Lyse with 98°C incubation for 10 minutes
 +
#Use 1 ul of this suspension as template
 +
#Set up tubes with 7 ul H20, 1 ul template, 1 ul forward primer, 1 ul reverse primer, 10 ul PCR mix
 +
Cycle:
 +
*2 minutes at 98°C
 +
*Run 30 cycles of:
 +
**10 seconds at 98°C
 +
**30 seconds at 55°C-65°C
 +
**40 seconds at 72°C
 +
*Final extension: 5 minutes at 72°C
 +
 +
 +
 +
'''eFusion Cloning Kit'''
 +
 +
Cloning Materials Preparation
 +
*Vector Construction: Use any one or two restriction enzyme to linearly cut the vector.
 +
*Target Fragment Construction: Add nucleotide sequences same as ones from the sticky ends to the 5' terminus of every PCR primer.
 +
 +
Recombination of Goal Segments and Vector
 +
 +
Mix inserted segments, vector and sFusase for 30min at room temperature. Then put the mixture on the ice and prepare to transform.
 +
 +
Mixture:
 +
*H20  X mL
 +
*PCR products  100-10ng  X mL
 +
*Vector  100-200ng      X mL
 +
*eFusase  3mL 
 +
**Total 15mL
 +
 +
Tranformation.
 +
 +
 +
'''Primers'''
 +
 +
R0051 (template:k091230)
 +
 +
F:tgccacctgacgtctaagaa
 +
 +
R:GGACTAGTGCAACCATTATCACCGCC
 +
 +
 +
FtsZ1 (template:complete genome)
 +
 +
F:CCGCTCGAGTTTTTATGAGGCCGACGATG
 +
 +
R:GCTCTAGAATGTGTTCAACAGCATTACC
 +
 +
 +
FtsZ5  (template:complete genome)
 +
 +
F:CCGCTCGAGCAAGAAGCGTATGGCATTCG
 +
 +
R:GCTCTAGACATCGTTCGCTGCGCCAAAC
 +
 +
 +
TBY
 +
 +
F:GCCACCATACCCACGCCGAAAC
 +
 +
R:GGACTAGTTTGCTCAGCTAGGAGGAATT
 +
 +
 +
primers for standard biobricks in PSB1A3 backbones
 +
 +
TF:tgccacctgacgtctaagaa
 +
 +
TR:attaccgcctttgagtgagc
 +
 +
 +
PT
 +
 +
F:AACTGCAGCGGCCGCTACTAGTATCGCTCAGCTAGGAGGA
 +
 +
R:CGCCAGGGTTTTCCCAGTCACGACGTTGTA
 +
 +
 +
 +
 +
'''efusion primers'''
 +
 +
 +
primers for standard biobricks in PSB1A3 backbones
 +
 +
F:gatttctggaattcgcggccgcttctagag
 +
 +
R:TTTGCCGGACTGCAGCGGCCGCTACTAGTA
 +
 +
 +
k238013+I13507
 +
 +
F:gatttctggaattcgcggccgcttctagag
 +
 +
R:attgattaacattttttactagagaaagaggaga
 +
 +
 +
FtsZ1+B0015 (template:complete genome)
 +
 +
F:ATGCCTGGCTCTAGTATTTTTATGAGGCCGACGATG
 +
 +
R:gcggccgcttctagagATGTGTTCAACAGCATTACC
 +
 +
 +
FtsZ5+B0015  (template:complete genome)
 +
 +
F:ATGCCTGGCTCTAGTACAAGAAGCGTATGGCATTCG
 +
 +
R:gcggccgcttctagagCATCGTTCGCTGCGCCAAAC
 +
 +
 +
R0051+I732820  (template:k091230)
 +
 +
F:gatttctggaattcgcggccgcttctagag
 +
 +
R:CTCCTCTTTCTCTAGTAGCAACCATTATCACCG
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
<div class="content" id="m3content">
<div class="content" id="m3content">
<h3>March</h3><br>
<h3>March</h3><br>
Line 282: Line 534:
-
</div><!--end col_left-->
+
<div class="content" id="6w3content">
 +
<h3>June Week 3</h3><br>
 +
</html>
 +
 
 +
2012-6-12 Tue
 +
 
 +
We got the paired termini fragment in the PUC vector.
 +
 
 +
 
 +
 
 +
2012-6-16 Sat
 +
 
 +
Muyuan Chen:wrote the experiment program of AHL.(BBa_T9002+F1610)
 +
 
 +
 
 +
<html>
 +
<div class="clear"></div>
</div>
</div>
 +
<div class="content" id="6w4content">
 +
<h3>June Week 4</h3><br>
 +
</html>
 +
2012-6-18  Mon
 +
PCR:  FtsZ target fragment
 +
[[File:Seuo6-18.JPG | center | 300px]]
 +
 +
Transform: F1610  R0010
 +
 +
Recovery: I13521
 +
 +
 +
 +
2012-6-19  Tue
 +
 +
Check: F1610 failed;  R0010 growed
 +
 +
Digestion: FtsZ1 FtsZ5 paired termini
 +
 +
Transform: F1610
 +
 +
Culture: R0010
 +
 +
Results: AHL failed
 +
 +
 +
 +
2012-6-20  Wed
 +
 +
Check: F1610 failed again
 +
 +
Transform FtsZ1/5+paired termini
 +
 +
Results: AHL failed
 +
 +
 +
 +
2012-6-21 Thur
 +
 +
Check: None
 +
 +
Miniprep plasmids R0010
 +
 +
Transform FtsZ1/5+paired termini
 +
 +
Culture: F1610; C0261; B0015
 +
 +
Others Found our instructor Zuhong Lu and reported our schedule.
 +
 +
 +
 +
2012-6-22  Fri
 +
 +
Check: F1610  FtsZ5+paired termini failed
 +
 +
PCR: Paired termini
 +
 +
Transform: J5526;  I13202; T9002
 +
 +
Culture: FtsZ1+paired termini; T9002
 +
 +
Results: AHL failed;
 +
We got ftsZ1+termini~
 +
 
 +
 
 +
 +
2012-6-23    Sat
 +
 +
Check: J5526 I13202 growed.
 +
 +
Miniprep plasmids T9002
 +
 +
Culture: J5526;  I13202
 +
 +
Others Muyuan Chen : Designed the toggle switch. BBa_K415301 BBa_K415300
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
 +
 +
<div class="content" id="6w5content">
 +
<h3>June Week 5</h3><br>
 +
</html>
 +
2012-6-25    Mon
 +
 +
Miniprep plasmids: I13202; J5526
 +
 +
[[File:Seuo6-25.JPG | center | 300px]]
 +
 +
Transform: I13202; K415023; K091230
 +
 +
Recovery: Pet32a
 +
 +
Culture: I13202+T9002
 +
 +
 +
 +
2012-6-26  Tue
 +
 +
Check: K415023 failed
 +
 +
Digestion: T9002; I13202
 +
 +
Transform: K415023
 +
 +
Recovery: I13202
 +
 +
Culture: I13202; K091230
 +
 +
Results: Toggle switch failed
 +
 +
 +
 +
2012-6-27  Wed
 +
 +
Digestion: T9002+I13202
 +
 +
Transform: R0082; K415301; M30109; K415023; K091230
 +
 +
Recovery: T9002
 +
 +
 +
 +
2012-6-28 Thur
 +
 +
Check: T9002 failed
 +
 +
Ligation: T9002+I13202
 +
 +
Recovery: J5526
 +
 +
Culture: R0082 K415301 M30109 K415023 K091230
 +
 +
Results: AHL maybe failed.
 +
 +
 +
 +
2012-6-29  Fri
 +
 +
Check: R0082 K415023 failed
 +
 +
Miniprep plasmids: K415301; M30109; K091230
 +
 +
Digestion: Pet32a; paired termini
 +
 +
Ligation: Pet32a+paired termini
 +
 +
Transform: R0082;  R0083;  R0084
 +
 +
Results: AHL maybe would failed.
 +
 +
 +
 +
2012-6-30  Sat
 +
 +
Check: R0082 R0083 R0084 failed
 +
 +
Miniprep plasmids: Pet32a
 +
 +
Digestion: ftsZ +paired termini; Pet32a
 +
 +
Ligation: ftsZ+paired termini+pet32a
 +
 +
Recovery: Pet32a+egfp
 +
 +
Culture: FtsZ1 +Paired termini
 +
 +
Results: Light sensor failed
 +
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
 +
 +
<div class="content" id="7w1content">
 +
<h3>July Week 1</h3><br>
 +
</html>
 +
 +
2012-7-1 Sun
 +
 +
Check: The recovery was fine
 +
 +
Ligation: FtsZ+Paired termini+pet
 +
 +
Transform: FtsZ+Paired termini+pet
 +
 +
Others: Xingyu Zhou: found the way of AHL detection.
 +
 +
Xiaodan Xu: Supplement the knowledge on the toggle switch.
 +
 +
 +
 +
2012-7-2 Mon
 +
 +
Check: We got FtsZ1+pt+pet (not confirmed)
 +
 +
PCR: R0082;
 +
 +
[[File:Seuo7-2.JPG | center | 300px]]
 +
*The marker failed. We are not sure about the result.
 +
 +
Ligation: FtsZ+Paired termini+pet
 +
 +
Transform: Ftsz1+pt+pet R0082 R0083 I13507 J5526 J4450 R0011
 +
 +
Recovery: T9002 I13202 M30109
 +
 +
Culture: R0084 ftsz+pt
 +
 +
 +
 +
2012-7-3  Tue
 +
 +
Check: The FtsZ5 failed. J5526 didn’t turn red.
 +
 +
Miniprep plasmids: T9002 I13202 M30109 R0084 FtsZ1
 +
 +
[[File:Seuo7-3-1.JPG | center | 300px]]
 +
*ftsZ1 R0084 failed
 +
 +
PCR: T9002; 
 +
 +
[[File:Seuo7-3-2.JPG | center | 300px]]
 +
*The density was too low.
 +
 +
Digestion: T9002+I13202
 +
 +
Transform: p0451 r0051 i732820 i13973
 +
 +
Recovery: R0083 I13507 R0011 R0084 FtsZ1 J04450
 +
 +
Others Muyuan Chen: Sorted out all the kits we might need.
 +
 +
 +
 +
2012-7-4 Wed
 +
 +
Check: I13507 failed
 +
 +
Miniprep plasmids: R0011 R0084 FtsZ1 J04450 r0083
 +
 +
[[File:Seu7-4-1.JPG | center | 300px]]
 +
*Only J04450 R0084 FtsZ1 succeeded.
 +
 +
PCR: P0451  I732830  R0051  I13973  R0084
 +
 +
[[File:Seuo7-4-2.JPG | center | 300px]]
 +
*Didn’t get R0051
 +
 +
Ligation: FtsZ+Paired termini+pet
 +
 +
Transform: I13507 J23039 R0062 J37033
 +
 +
Culture: P0451 i732820 R0051 I13973
 +
 +
 +
 +
2012-7-5 :Thur
 +
 +
Check: R0051 failed
 +
 +
Miniprep plasmids: P0451 I732820 I13973 R0084 M30109 I13202 T9002
 +
 +
[[File:Seuo7-5-1.JPG | center | 300px]]
 +
*R0084 M30109 failed
 +
 +
PCR: I13507 R0062 J37033 J23039 T9002
 +
 +
Digestion: T9002 I13202 R0084 M30109
 +
 +
Transform: R0051 R0011
 +
 +
Recovery: Paired termini  Pet
 +
 +
Others Xintong Ling: Started the simulation of colony.
 +
 +
 +
 +
2012-7-6  Fri
 +
 +
Check: The transformation failed all! We didn’t find out the cause.
 +
 +
Miniprep plasmids: I13973 J37033 J23039 R0084 M30109 I13507 Paired termini pet32a
 +
 +
[[File:Seuo7-6-1.JPG | center | 300px]]
 +
*R0084 M30109 failed
 +
 +
PCR FtsZ1/5 r0062
 +
 +
[[File:Seuo7-6-2.JPG | center | 300px]]
 +
*All succeeded
 +
 +
Digestion: Pet+paired termini
 +
 +
Ligation: T9002+I13202
 +
 +
Transform: R0051 R0011
 +
 +
Others:
 +
*We had a short meeting, talked about our project again.
 +
*Today the lab had power failure at noon.
 +
 +
 +
 +
2012-7-7  Sat
 +
 +
Check: none failed
 +
 +
Miniprep plasmids: R0084 R0062
 +
 +
[[File:Seuo7-7-1.JPG | center | 300px]]
 +
*We got the two plasmids
 +
 +
PCR: R0051 R0011
 +
 +
[[File:Seuo7-7-2.JPG | center | 300px]]
 +
*R0011 failed
 +
 +
Ligation: PET+Paired termini
 +
 +
Transform: T9002+I13202
 +
 +
Others Xingyu Zhou: Sorted out the experiment protocols.
 +
 +
Kai Gui: figured out the diffusion parameters.
 +
 +
 +
 +
2012-7-8 Sun
 +
 +
Check: T9002+I13202 failed.
 +
 +
Our holiday~
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
 +
 +
<div class="content" id="7w2content">
 +
<h3>July Week 2</h3><br>
 +
</html>
 +
2012-7-9  Mon
 +
 +
Miniprep plasmids R0011
 +
 +
[[File:Seuo7-9.JPG | center | 300px]]
 +
*R0011 failed
 +
 +
Transform: R0082  R0083  J23039  R0011  R0051
 +
 +
Recovery: P0451 K091230 I13202 I13973 R0062 I13407 T9002 PET+paired termini
 +
 +
Others Check the materials in our lab.
 +
 +
Kai Gui: Solve the diffusion equation.
 +
 +
 +
 +
2012-7-10  Tue
 +
 +
Check: R0051 failed.
 +
 +
Miniprep plasmids: M30109 T9002 I13202 R0084 R0010 K091230 P0451
 +
[[File:Seuo7-10-1.JPG | center | 300px]]
 +
 +
PCR: R0082 R0083 J23039 R0011 R0051
 +
 +
[[File:Seuo7-10-2.JPG | center | 300px]]
 +
*J23039 failed due to the high temperature.
 +
 +
Transform: I15008  S03419  K081024
 +
 +
Recovery: R0082 R0083 PET+PT T9002 P0451 I13507 R0010
 +
 +
 +
 +
2012-7-11  Wed
 +
 +
Check: J23039  R0082 failed
 +
 +
Miniprep plasmids: PET+PT I13507 R0010 T9002 P0451
 +
 +
[[File:Seuo7-11-1.JPG | center | 300px]]
 +
*R0010’s density was too low. P0451 was wrong.
 +
 +
PCR: I15008  S03419  K081024  I13202  PET I13507  R0010  P0451    T9002
 +
 +
[[File:Seuo7-11-2.JPG | center | 300px]]
 +
*T9002 was wrong, all the colony was wrong.
 +
 +
Digestion: I13202 T9002 R0011 P0451 R0084  M30109
 +
 +
Transform: R1051 P0151 R0083 I763026 I763035 P0440
 +
 +
Culture: I15008 S03419 K081024 R0082 J23039 M30109 PET+PT
 +
 +
Others Xingyu Zhou & Xuelong Fan & Shen Gao & Xiaodan Xu: Improved our experiment methods.
 +
 +
 +
 +
2012-7-12  Thur
 +
 +
Check: R0082 S03419 I15008 failed
 +
 +
Miniprep plasmids Pet
 +
[[File:Seuo7-12-1.JPG | center | 300px]]
 +
 +
PCR: M30109  J23039  K081024  PET ftsZ1/5
 +
 +
Ligation: T9002+I13202      R0010+P0451
 +
 +
Transform: R1051  I15008  S03419
 +
 +
Recovery: I13202  T9002  R0010  P0451
 +
 +
Culture: P0151  P0440  I763026  R0082  I763035
 +
 +
 +
 +
2012-7-13  Fri
 +
 +
Check: R1051 failed
 +
 +
Miniprep plasmids P1051  P0440  I763035  I763026  R0082  I13202  T9002  R0010  P0451
 +
 +
[[File:Seuo7-13-1.JPG | center | 300px]]
 +
*I13202 failed
 +
 +
PCR: P1051  P0440  I763035  I763026  R0082  I13202  T9002  R0010  P0451
 +
 +
*I763026  I13202  r0010 failed
 +
 +
Transform: R1051  K081024
 +
 +
Culture: I15008 S03419
 +
 +
 +
2012-7-15  Sun
 +
 +
We had our holiday~
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
 +
 +
<div class="content" id="7w3content">
 +
<h3>July Week 3</h3><br>
 +
</html>
 +
2012-7-16 Mon
 +
 +
Miniprep plasmids: R0051 M30109 J5526 S03419 P0440 R0010 I763026 R1051
 +
 +
[[File:Seuo7-16.JPG | center | 300px]]
 +
*P0451’s strip was too light
 +
 +
Transform: I15008 J04450
 +
 +
Recovery: R0082  I13507  DH5
 +
 +
Others:
 +
*Zhengyang Jia: sorted out the experiment main points about the digestion.
 +
*Xingyu Zhou: started to collect ideas for human practice.
 +
 +
 +
 +
2012-7-17  Tue
 +
 +
Check: All growed
 +
 +
Digestion R0010 P0451 P0151 P0440 R0082 R0084 M30109
 +
 +
Transform K081024
 +
 +
Recovery K091230  PET+PT I13507
 +
 +
Culture: I763035 R0010 PET
 +
 +
Others Xintong Ling: Summarized the previous iGEM model and asked some questions.
 +
 +
 +
 +
2012-7-18  Wed
 +
 +
Check:  All growed
 +
 +
Miniprep plasmids: I15008 I763035 J04450 T9002 I13202 M30109 PET+PT+FtsZ1 I15008  I13202  M30109 failed
 +
 +
[[File:Seuo7-18-1.JPG | center | 300px]]
 +
 +
PCR: J04450  I15008  I763035  T9002  I13202  I13507  R0010
 +
 +
[[File:Seuo7-18-2.JPG | center | 300px]]
 +
*R0010  I15008 failed
 +
 +
Transform: Pet+pt pet+FtsZ1 k091230
 +
 +
Recovery: I763035  I15008  I13202
 +
 +
Culture: Pet+pt  FtsZ1  k091230
 +
 +
Others Xingyu Zhou: Found some AHL substitute Kits.
 +
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
 +
 +
<div class="content" id="7w4content">
 +
<h3>July Week 4</h3><br>
 +
</html>
 +
 +
2012-7-23  Mon
 +
 +
Check: None
 +
 +
Transform: F2620  R0040  K082034
 +
 +
Recovery: K091230  I732820  R0010  R0062  PET+PT  PET  I13202
 +
 +
Others: We had a meeting talking about our schedule.
 +
 +
 +
 +
2012-7-24  Tue
 +
 +
Check: All growed
 +
 +
Miniprep plasmids: I732820  R0062  K091230  R0010  R0062  PET+PT+FtsZ1(we called it TBY~) R+P0451 I13202
 +
 +
[[File:Seuo7-24.JPG | center | 300px]]
 +
*R+P0451 failed
 +
 +
PCR: I732820 R0062  K091230  I+T9002 R+P0451 F2620
 +
*I+T9002 failed
 +
 +
Digestion: F2620  I13202  K091230 R+P0451 R0062 I+T9002
 +
 +
Transform: K082034
 +
 +
 +
 +
2012-7-25  Wed
 +
 +
Check: All growed.
 +
 +
PCR: FtsZ1/5 tby R0051
 +
 +
[[File:Seuo7-25.JPG | center | 300px]]
 +
 +
Digestion: Tby ftsz1/5 B0015 R0051 I732820
 +
 +
Ligation: I13202 +F2620  R+P+K091230 I+T+R0062
 +
 +
Culture: K082034
 +
 +
Others Xuelong Fan: Changed the project of light sensor due to too many times of failure.
 +
 +
 +
 +
2012-7-26  Thur
 +
 +
Check: None
 +
 +
Miniprep plasmids K082034  B0015  F2620  R0040
 +
 +
[[File:Seuo7-26-1.JPG | center | 300px]]
 +
 +
PCR R0051
 +
 +
[[File:Seuo7-26-2.JPG | center | 300px]]
 +
 +
Digestion: Pet+FtsZ1/5    FtsZ1/5+B0015
 +
 +
Ligation: TBY+PSB  R0051+I732820  FtsZ1/5+PSB
 +
 +
Transform: I13202+F2620  R+P+K091230  I+T+R0062
 +
 +
 +
 +
2012-7-27  Fri
 +
 +
Check: The transformed Kits all growed.
 +
 +
Ligation: ftsZ1/5+pet    I+T9002+R0062
 +
 +
Transform: R0051+I732820  I+T9002+R0062 ftsZ1/5+PSB
 +
 +
Others: Xingyu Zhou: proposed the idea of making the video about syhthetic biology to finish our human practice.
 +
 +
 +
 +
2012-7-28  Mon
 +
 +
Check: All growed.
 +
 +
Miniprep plasmids: I13202+F2620 R0010+P0451+K091230 I13202+T9002+R0062
 +
 +
[[File:Seuo7-28.JPG | center | 300px]]
 +
 +
Culture: Tby  R0051+I732820    I13507
 +
 +
 +
 +
2012-7-29  Sun
 +
 +
Check: All growed.
 +
 +
Miniprep plasmids: FtsZ1/5  TBY  K091230  R0051+I732820
 +
[[File:Seuo7-29-1.JPG | center | 300px]]
 +
 +
PCR: R0051  I13507
 +
[[File:Seuo7-29-2.JPG | center | 300px]]
 +
 +
Digestion: R0051  I13507  J04450
 +
 +
Recovery: R+P0451  I13202+T9002  I13507
 +
 +
Others: Kai Gui: Finished the AHL diffusion simulation.
 +
 +
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
 +
 +
<div class="content" id="7w5content">
 +
<h3>July Week 5</h3><br>
 +
</html>
 +
 +
2012-7-30  Mon
 +
 +
Miniprep plasmids: I13507  R+P0451  I13202+T9002
 +
[[File:Seuo7-30.JPG | center | 300px]]
 +
 +
PCR: TBY FtsZ1/5 B0015 R+P0451 I13507
 +
 +
Digestion: TBY FtsZ1/5 B0015  I13202  F2620  I13507  K091230  R+P0451
 +
 +
Recovery: R+I13507  B0015  PET  I13202+T9002  I13202+F2620  I732820  R0010  S03419  K081024
 +
 +
 +
 +
2012-7-31  Tue
 +
 +
Check: All growed
 +
 +
Miniprep plasmids: R0010+I13507 pet I13202+T9002  I13202+F2620  I732820 B0015 R0010 S03419 K081024 I13202+T9002+R0062
 +
[[File:Seuo7-31-1.JPG | center | 300px]]
 +
 +
PCR: FtsZ1/5  S03419  K081024  I13202+T9002+R0062
 +
[[File:Seuo7-31-2.JPG | center | 300px]]
 +
 +
Digestion: R0051  I13507  FtsZ1/5  pet
 +
 +
Ligation: I13202+F2620+I13507  TBY+B0015  FtsZ1/5+B0015  R+P0451+K091230
 +
 +
Transform J13002  R0051+I13507
 +
 +
Recovery: K091230  I732820  I13507  K081024  S03419
 +
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
 +
 +
<div class="content" id="8w1content">
 +
<h3>August Week 1</h3><br>
 +
</html>
 +
 +
2012-8-1 Wed
 +
 +
Check: We got a perfect result of Transformation of J13002
 +
 +
Miniprep plasmids: S03419,K081024
 +
*Failed:S03419,K081024
 +
 +
Ligation: S03419(plasmids got on July 31st ,digested with EcoRI&SpeI)+B0015(digested with EcoRI&XbaI);  K081024(plasmids got on July 31st ,digested with EcoRI&SpeI)+I13507(digested with EcoRI&XbaI)
 +
 +
Recovery I15008
 +
 +
Others Filter S03419 and K081024 with Amp+ solid LB media to guarantee the availability of these two kits.
 +
 +
 +
 +
2012-8-2 :Thur
 +
 +
Check: We got a perfect result of the filtration of S03419&K081024
 +
 +
Miniprep plasmids: J13002,I15008
 +
 +
PCR J13002
 +
*The signal of the result is too weak.
 +
 +
Digestion: I15008(XbaI+PstI) failed
 +
 +
Transform: S03419+B0015 K081024+I13507
 +
 +
Culture: S03419&K081024
 +
 +
 +
 +
2012-8-3  Fri
 +
 +
Check: The transformation succeeded.
 +
 +
Recovery J13002,I15008
 +
 +
Culture: S03419+B0015
 +
 +
Pick up the red monoclones of K+I
 +
 +
Plasmid Sequencing:  Failed:R0010,J13002,I15008, K081024;  Suceeded: S03419,
 +
 +
 +
 +
2012-8-4  Sat
 +
 +
Check: The broths seem to be good but I15008 failed.
 +
 +
Miniprep plasmids: S+B,J13002,K+I
 +
 +
Recovery: R0010
 +
 +
 +
 +
2012-8-5 Sun
 +
 +
Miniprep plasmids: R0010
 +
 +
Digestion: R0010(E+S)  SB(E+X)  pSB2K3(E+P)  KI
 +
*R0010 & SB failed at the second digestion.
 +
*pSB2K3 &KIsucceeded.
 +
 +
Recovery R0010
 +
 +
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
 +
 +
<div class="content" id="8w2content">
 +
<h3>August Week 2</h3><br>
 +
</html>
 +
2012-8-06 Mon
 +
 +
Check: The Digestion of R&S failed yesterday.
 +
 +
Digestion: R0010(E-S) S03419(E-X)
 +
 +
Ligation: KI+pSB2K3
 +
 +
Culture: K+I
 +
 +
Plasmid Sequencing: R0010,SB(04th,Aug),KI(04th,Aug)
 +
 +
 +
 +
2012-8-7  Tue
 +
 +
Check: The Result seem to be pretty nice.
 +
 +
Ligation: R0010+SB
 +
 +
Recovery: R0010,SB,I15008
 +
 +
Culture Pick out a monoclone of KI(pSB2K3)
 +
 +
Plasmid Sequencing:  J13002
 +
 +
 +
 +
2012-8-8 Wed
 +
 +
Check: We got quite reliable E.Coli strains that contain KI and S03419
 +
 +
Miniprep plasmids: KI（pSB2K3）,R0010,J13002
 +
 +
PCR: R0010
 +
 +
Recovery: K081024,SB,S03419
 +
 +
Plasmid sequencing:  K081024
 +
 +
 +
 +
2012-8-9 Thur
 +
 +
Miniprep plasmids: SB,I15008,R0010,J13002
 +
 +
PCR: R0010,I15008,J13002,SB Succeed:R0010,J13002
 +
*Failed:I15008,SB
 +
 +
Digestion: J13002(S-P)  I15008(X-P)  R0010(E-S)  SB(E-X)
 +
 +
 +
 +
2012-8-10  Fri
 +
 +
Check: The time for digestion is not adequate so we need to try it again.
 +
 +
Digestion: J13002(S-P)  I15008(X-P)  R0010(E-S)  SB(E-X)
 +
 +
 +
 +
2012-8-11  Sat
 +
 +
Check: This part of record is missing
 +
 +
 +
 +
2012-8-12 Sun
 +
 +
Digestion: R0010 & SB failed at the second digestion. pSB2K3 &KIsucceeded.
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
 +
<div class="content" id="8w3content">
 +
<h3>August Week 3</h3><br>
 +
</html>
 +
2012-8-16 Wed
 +
 +
Recovery: K091230 I732820 B0015 I13202 F2620
 +
 +
 +
 +
2012-8-17 Fri
 +
 +
Miniprep plasmids: B0015 I732820 F2620
 +
*F2620 failed
 +
 +
Digestion: B0015 I732820
 +
 +
 +
 +
2012-8-18 Sat
 +
 +
Miniprep plasmids: B0015 F2620
 +
 +
Digestion: B0015 F2620
 +
 +
PCR: PT Ftsz5 R0051(from K091230)
 +
 +
E-Fusion: Ftsz5&B0015  R0051&I732820
 +
 +
 +
 +
2012-8-19 Sun
 +
 +
E-Fusion: PT&B0015  I13202&F2620
 +
 +
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
 +
<div class="content" id="8w4content">
 +
<h3>August Week 4</h3><br>
 +
</html>
 +
 +
2012-8-20 Mon
 +
 +
PCR: I13202&F2620 F2620 J04450 R0010&P0451 I13507
 +
 +
Recovery: K238013
 +
 +
 +
 +
2012-8-21 Tue
 +
 +
Miniprep plasmids: K238013 I13507  R0010+p0451 B0015  PT
 +
 +
[[File:Seuo8-21.jpg|center|300px]]
 +
 +
E-Fusion: K238013&I13507
 +
 +
 +
2012-8-24  Fri
 +
 +
Miniprep plasmids：I13202  I13507  R+I
 +
 +
[[File:Seuo8-24.jpg|center|300px]]
 +
 +
 +
 +
 +
2012-8-25  Sat
 +
 +
Miniprep plasmids：K091230
 +
 +
[[File:Seuo8-25.jpg|center|300px]]
 +
 +
 +
 +
2012-8-26  Sun
 +
 +
Miniprep plasmids：B0015
 +
 +
Digestion: F2620
 +
 +
Recovery: I13507 TBY
 +
 +
[[File:Seuo8-26.jpg|center|300px]]
 +
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
 +
 +
<div class="content" id="8w5content">
 +
<h3>August Week 5</h3><br>
 +
</html>
 +
 +
2012-8-27  Mon
 +
 +
PCR: K116638 I13507
 +
 +
Miniprep plasmids:TBY  K238013
 +
 +
[[File:Seuo8-27.jpg|center|300px]]
 +
 +
 +
 +
2012-8-28  Tue
 +
 +
Miniprep plasmids: K091230  R+P  PT
 +
 +
[[File:Seuo8-28.jpg|center|300px]]
 +
 +
Digestion: I732820
 +
 +
Recovery: R+P pSB1C3
 +
 +
 +
 +
2012-8-29  Wed
 +
 +
Miniprep plasmids：R0051
 +
 +
[[File:Seuo8-29.jpg|center|300px]]
 +
 +
 +
 +
2012-8-30  Thur
 +
 +
PCR: K238013&I13507 Ftsz1+B0015
 +
 +
 +
2012-8-31 Fri
 +
 +
Miniprep plasmids: K238013 F2620 I732820 B0015 S+B R+P psb1c3
 +
 +
[[File:Seuo8-31.jpg|center|300px]]
 +
 +
PCR: I13507 K116638 R0051 R+P
 +
 +
Digestion: K238013 F2620 I732820 B0015 S+B R+P psb1c3
 +
 +
Recovery: R0010 P0451
 +
 +
 +
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
 +
<div class="content" id="9w1content">
 +
<h3>September Week 1</h3><br>
 +
</html>
 +
 +
2012-9-1 Sat
 +
 +
Miniprep plasmids：B0015  RSB  R+I
 +
 +
[[File:Seuo9-1.jpg|center|300px]]
 +
 +
Digestion: K238013 F2620 I732820 P0451 B0015
 +
 +
PCR: R+I
 +
 +
E-Fusion: K238013&I13507 K116638&F2620 R0051&I732820
 +
 +
 +
 +
2012-9-2  Sun
 +
 +
E-Fusion: Ftsz1&B0015 Ftsz5&B0015-pSB1C3
 +
 +
Transformation: TBY-BL21
 +
 +
 +
 +
 +
 +
 +
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
 +
 +
<div class="content" id="9w2content">
 +
<h3>September Week 2</h3><br>
 +
</html>
 +
 +
 +
 +
2012-9-3    Mon
 +
 +
Miniprep plasmids: K238013 F2620 I732820
 +
 +
Digestion: S+B
 +
 +
 +
 +
2012-9-5    Wed
 +
 +
Miniprep plasmids：F2620  I732820  K238031  PSB1C3
 +
 +
[[File:Seuo9-5.jpg|center|300px]]
 +
 +
Digestion: K238013 F2620
 +
 +
 +
 +
2012-9-6    Thur
 +
 +
PCR: R+P I13507 K116638 P0451 B0015 S+B
 +
 +
Digestion:  pSB1C3 K238013 F2620 B0015
 +
 +
E-Fusion: I13507&K238013 K116638&F2620 R0051&I732820
 +
 +
Recovery: R+P S+B K+I K238013 B0015
 +
 +
 +
 +
 +
2012-9-7    Fri
 +
 +
Miniprep plasmids: K238013 F2620 B0015
 +
 +
Digestion: B0015 F2620 PT R+P P0451 pSB1C3 K238013
 +
 +
PCR: S+B R+P K+I P0451 PT
 +
 +
 +
 +
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
 +
<div class="content" id="9w3content">
 +
<h3>September Week 3</h3><br>
 +
</html>
 +
 +
2012-9-10  Monday
 +
 +
PCR: Ftsz5+B0015 R+P K+I PT S+B TBY
 +
 +
E-Fusion: (Ftsz5+B0015 R+P K+I PT S+B TBY)&pSB1C3
 +
 +
 +
 +
2012-9-12  Wed
 +
 +
Miniprep plasmids：PSB1C3  R+P
 +
 +
[[File:Seuo9-12.jpg|center|300px]]
 +
 +
 +
 +
 +
 +
 +
<html>
 +
<div class="clear"></div>
 +
</div>
 +
 +
</div><!--end col_left-->
 +
</div>
</body>
</body>

Latest revision as of 12:37, 26 September 2012

header1
header2


Notebook





  • Protocols

Pre-experiment

  • March
  • April
  • May

June

  • Week3
  • Week4
  • Week5

July

  • Week1
  • Week2
  • Week3
  • Week4
  • Week5

August

  • Week1
  • Week2
  • Week3
  • Week4
  • Week5

September

  • Week1
  • Week2
  • Week3

Protocols


LB Medium:

Liquid:

  • 10 g of tryptone,
  • 5 g of yeast extract,
  • 10 g of NaCl,
  • 1 liter of distilled water

Solid:

  • 10 g of tryptone,
  • 5 g of yeast extract,
  • 10 g of NaCl,
  • 15 g of agar,
  • 1 liter of distilled water


Biobrick Assembly Restriction Digest:

For a double digest:

  1. To a pcr tube, add 15 ul of miniprepped plasmid or purified PCR product
  2. Add 3 ul of the appropriate buffer
  3. Add 1ul of each enzyme.
  4. Incubate at 4˚C overnight.


Biobrick Assembly Ligation:

  1. In a PCR tube, add restriction digested and PCR purified insert to backbone in a 4:1 molar ratio, usually 1 ul backbone with 4 ul insert works.
  2. Add 10ul T4 ligase buffer
  3. Add 1 ul T4 ligase
  4. Create a negative control replacing the insert with water
  5. Add reactions to thermal cycler, and leave at 4˚C overnight.
  6. Use 2 ul of the ligation reactions to transform cells.


PCR/Gel Extraction

Fresh TAE buffer as running buffer is recommended. Reusing running buffer will result the increase of the pH and then reduce yields.

  1. For cycle-pure (PCR reaction): Add 2 volumes of Buffer GC to 1 volume of the PCR reaction and mix completely by vortexing. Briefly spin the tube to collect any drops from the inside wall and tube lid. For PCR products less than 200 bp, add 5 volumes of Buffer GC to 1 volume of PCR reaction
  2. For agarose gel: Excise the DNA fragment from the agarose gel and weigh it in a 1.5 mL microtube. Add 1 volume of Buffer GC to 1 volume of gel to the 1.5 mL microtube and incubate the mixture at 55-60°C for 8 min. Mix the tube by tapping the bottom every 2 min till the gel has melted completely. Cool the tube to room temperature. Note: A gel slice of 100 mg approximately equals to 100 μL. For DNA fragment less than 200 bp, add 1 volume of isopropanol.
  3. Transfer up to 700 μL DNA/Buffer GC mixture to a spin column with a collection tube. Centrifuge at 13,000 x g for 1 min at room temperature. Discard the flow-through and put the column back to the collection tube. Repeat this step to process the remaining solution.
  4. Add 300 μL of Buffer GC into the DNA Mini Column. Centrifuge at 13,000 x g for 30 to 60 seconds at room temperature to wash the DNA Mini Column.
  5. Add 650 μL DNA Wash Buffer to the column and centrifuge at 13,000 x g for 30 s at room temperature. Discard the flow through and insert the column, with the lid open, back to the collection tube. Repeat step “4”. Note: Ensure that ethanol has been added to DNA Wash Buffer as instructed .
  6. Centrifuge the empty DNA column, with the lid open, at 13,000 x g for 2 min to dry the ethanol residue in the matrix. Note: The residual ethanol will be removed more efficiently with the column lid open during centrifugation.
  7. Place the column into a clean 1.5 mL micocentrifuge tube and add 30-50 μL pre-warmed (60oC) Elution Buffer or ddH2O to the center of the column. Incubate at room temperature for 1 min. Centrifuge at 13,000 x g for 1 min


Miniprep Plasmids

  1. Inoculate 1-4 mL LB containing appropriate antibiotic with a fresh colony from a freshly streaked selective plate. Incubate at 37°C for 14-16 hours with vigorous shaking. Note: Prolonged incubation (> 16 hours) is not recommended since the E.coli starts to lyse and the plasmid yields may be reduced. Do not grow the culture directly from the glycerol stock. This protocol is optimized for E. coli strain cultured in LB medium. When using TB or 2xYT medium, special care needs to be taken to ensure the cell density doesn’t exceed 3.0 (OD600). Buffers need to be scaled up proportionally if over amount of cultures are being processed.
  2. Harvest the bacterial culture by centrifugation for 1 min at 10,000 rpm. Pour off the supernatant and blot the inverted tube on a paper towel to remove residue medium. Remove the residue medium completely. Note: Residue medium will cause,
    • Poor cell lysis and thus lower DNA yield.
    • Loose pellet after centrifugation in step 6.
  3. Add 250 μL Buffer A1 (Add RNase A to Buffer A1 before use) and completely resuspend bacterial pellet by vortexing or pipetting. Note: Complete resuspension is critical for bacterial lysis and lysate neutralization.
  4. Add 250 μL Buffer B1, mix gently by inverting the tube 10 times (do not vortex), and incubate at room temperature for 5 minutes. Note: Do not incubate for more than 5 minutes. Note: Buffer B1 precipitates (cloudy look) below room temperature. Warm up Buffer B1 at 50°C to dissolve precipitation before use.
  5. Add 350 μL Buffer N1, mix completely by inverting/shaking the vial for 5 times and sharp hand shaking for 2 times. Note: Incubating the lysate in ice for 1 min will improve the yield. It is critical to mix the solution well. If the mixture still appears conglobated, brownish or viscous, more mixing is required to completely neutralize the solution.
  6. Centrifuge the lysate at 13,000 rpm for 10 minutes at room temperature. Note: If the lysate doesn’t appear clean, reverse the tube angle, centrifuge for 5 more minutes and then transfer the clear lysate to DNA column.
  7. Carefully transfer the clear lysate into a DNA column with a collection tube, avoid the precipitations, spin at 13,000 rpm for 1 minute, discard the flow-through and put the column back to the collection tube.
  8. Optional: Add 500 μL Buffer KB into the spin column, centrifuge at 13,000 rpm for 1 minute. Remove the spin column from the tube and discard the flow-through. Put the column back to the collection tube. Note: Buffer KB is recommended for endA+ strains such as HB101, JM101, TG1 or their derived strains. It is not necessary for isolating DNA from endA- strains such as Top 10 and DH5a.
  9. Add 650 μL DNA Wash Buffer (Add ethanol to DNA wash buffer before use) into the spin column, centrifuge at 13,000 rpm for 1 minute at room temperature. Remove the spin column from the tube and discard the flow-through. Repeat step “9” to improve the recovery.
  10. Reinsert the spin column, with the lid open, into the collection tube and centrifuge for 2 minutes at 13,000 rpm. Note: Residual ethanol can be removed more efficiently with the column lid open. It is critical to remove residual ethanol completely.
  11. Carefully transfer the spin column into a sterile 1.5 mL tube and add 50-100 μL (> 50 μL) Sterile ddH20 or Elution Buffer into the center of the column and let it stand for 2 minutes. Elute the DNA by centrifugation at 13,000 rpm for 1 minute. Reload the eluate into the column and elute again. Note: If ddH2O is applied, please make sure the pH is no less than 7.0 (7.0-8.5 is preferred). NaOH could be used to adjust the pH of ddH2O. The DNA is ready for downstream applications such ascloning/subcloning, RFLP, library screening, in vitro translation, sequencing, transfection of robust cells such as HEK293 cells. Note: It’s highly recommended to remove the endotoxin (PD1212) if the DNA is used for endotoxin-sensitive cell lines, primary cultured cells or micro-injection.
  12. The DNA concentration can be calculated as follows, Concentration (μg/mL) = OD260nm x 50 x dilution factor.


Transforming DNA from Distribution Plates:

  1. Thaw competent cells on ice.
  2. Add 10 microliters of pure water to each well of DNA from plates, pipette up and down.
  3. Transfer into storage tube.
  4. Pipette 1-2 microliters of the DNA into the competent cell tubes.
  5. Stir with pipette tip, gently flick tube.
  6. Leave on ice for 30 minutes.
  7. Heat Shock for 45 sec by using a water bath set to 42°C and then chill on ice for 2 min.
  8. Pipette 500 micro Liters of S.O.C. (LB + glucose) into 14ml culture tubes; transfer the competent cells into these tubes and incubate in a 37 degree shaker for 40-60 minutes before plating.
  9. For source plate DNA, plate 100 microliters.


Taq PCR

Set up tubes with 7 ul H20, 1 ul template, 1 ul forward primer, 1 ul reverse primer, 10 ul PCR mix

  • 94°C for 1:30 min
  • 35 cycles of:
    • 94°C for 0:30 min
    • 54°C for 1:00 min
    • 72°C for 1:00 min/Kb
  • Final extension: 72°C for 6:00 min

Colony PCR

  1. Suspend colonies in 5 ul H20
  2. Lyse with 98°C incubation for 10 minutes
  3. Use 1 ul of this suspension as template
  4. Set up tubes with 7 ul H20, 1 ul template, 1 ul forward primer, 1 ul reverse primer, 10 ul PCR mix

Cycle:

  • 2 minutes at 98°C
  • Run 30 cycles of:
    • 10 seconds at 98°C
    • 30 seconds at 55°C-65°C
    • 40 seconds at 72°C
  • Final extension: 5 minutes at 72°C


eFusion Cloning Kit

Cloning Materials Preparation

  • Vector Construction: Use any one or two restriction enzyme to linearly cut the vector.
  • Target Fragment Construction: Add nucleotide sequences same as ones from the sticky ends to the 5' terminus of every PCR primer.

Recombination of Goal Segments and Vector

Mix inserted segments, vector and sFusase for 30min at room temperature. Then put the mixture on the ice and prepare to transform.

Mixture:

  • H20 X mL
  • PCR products 100-10ng X mL
  • Vector 100-200ng X mL
  • eFusase 3mL
    • Total 15mL

Tranformation.


Primers

R0051 (template:k091230)

F:tgccacctgacgtctaagaa

R:GGACTAGTGCAACCATTATCACCGCC


FtsZ1 (template:complete genome)

F:CCGCTCGAGTTTTTATGAGGCCGACGATG

R:GCTCTAGAATGTGTTCAACAGCATTACC


FtsZ5 (template:complete genome)

F:CCGCTCGAGCAAGAAGCGTATGGCATTCG

R:GCTCTAGACATCGTTCGCTGCGCCAAAC


TBY

F:GCCACCATACCCACGCCGAAAC

R:GGACTAGTTTGCTCAGCTAGGAGGAATT


primers for standard biobricks in PSB1A3 backbones

TF:tgccacctgacgtctaagaa

TR:attaccgcctttgagtgagc


PT

F:AACTGCAGCGGCCGCTACTAGTATCGCTCAGCTAGGAGGA

R:CGCCAGGGTTTTCCCAGTCACGACGTTGTA



efusion primers


primers for standard biobricks in PSB1A3 backbones

F:gatttctggaattcgcggccgcttctagag

R:TTTGCCGGACTGCAGCGGCCGCTACTAGTA


k238013+I13507

F:gatttctggaattcgcggccgcttctagag

R:attgattaacattttttactagagaaagaggaga


FtsZ1+B0015 (template:complete genome)

F:ATGCCTGGCTCTAGTATTTTTATGAGGCCGACGATG

R:gcggccgcttctagagATGTGTTCAACAGCATTACC


FtsZ5+B0015 (template:complete genome)

F:ATGCCTGGCTCTAGTACAAGAAGCGTATGGCATTCG

R:gcggccgcttctagagCATCGTTCGCTGCGCCAAAC


R0051+I732820 (template:k091230)

F:gatttctggaattcgcggccgcttctagag

R:CTCCTCTTTCTCTAGTAGCAACCATTATCACCG

March


2012-3-18 Sun

After discussion in the seminar, 13 students organized the iGEM team and set out to design our project.


2012-3-24 Sat

Our project application were admitted in our school and the registry work started.

The achievements of one week's work:

Muyuan Chen & Xuelong Fan: responsible for the fund application and team registry work.

Xingyu Zhou: designed the bio-sensor based on the asymmetric colony.

Ying Cheng & Zhu Zhu: Searched the information about quorum sensing.

Xiaodan Xu: Read the literature on E.coli's flagella and division.

Peng Cheng & Le Zhou: designed the wiki and logo.


2012-3-25 Sun

Shen Gao: improved the method of cultivation of E.coli.


2012-3-26 Tue

Muyuan Chen: Did some research on light sensor. We voted and named our team SEU_Omega~


2012-3-27 Wed

Filled the application form on the www.igem.org.


2012-3-31 Sat

Xintong Ling: Finished the simulation of diffusion equation in the rectangular case.

April


2012-4-1 Sun

Xintong Ling: finished the diffusion model based on the random containers and made a plan for further models.


2012-4-5 Thur

Muyuan Chen: Made the schedule and experiment program before our summer vacation. Found some information about toggle switch.

Xuelong Fan: Did some research on the light sensor.

Xiaodan Xu: Learnt about how to use NCBI.


2012-4-7 Sat

Had a group meeting and discussed about the future plans.

Xiaodan Xu: Found out the antisense FtsZ gene can be used to control the shape of E.coli's colony.


2012-4-9 Mon

Shen Gao: Choose Pet-32a plasmid for our experiment.


2012-4-12 Thur

Xiaodan Xu: Found a way to verification the primers.


2012-4-13 Fri

Xintong Ling: Finished the simple cell division model.


2012-4-17 Tue

Shen Gao: Learnt about the primer design.

Xingyu Zhou: Designed the quorum sensing part——the AHL system.

Muyuan Chen: Use vectorNTI to analysis plasmid.



2012-4-19 Thur

Xintong Ling:finished the Cellular Automata based on the AHL density.

Xingyu Zhou:Made the expriment plan for the AHL system and found some related kits for his plan.


2012-4-20 Fri

Muyuan Chen: Made the experiment plan for the antisense FtsZ.

Xintong Ling:improved the model of cellular automata.


2012-4-22 Sun

Shen Gao:improved the method of gel extraction and agarose gel electrophoresis.

Xingyu Zhou:Made a summary of AHL sensing system.


2012-4-24 Tue

Xintong Ling & Kai Gui:made the schedule for the further modeling.

Kai Gui:finished the model of biosensor.


2012-4-26 Thur

Xiaodan Xu:Made the experiment plan for antisense FtsZ.


2012-4-29 Sun

Xiaodan Xu:Made a list of the protection base for the restriction sites.


May


2012-5-2 Wed

Xintong Ling: modified the model of biosensor.


2012-5-3 Thur

Xiaodan Xu:Chose the target fragment of FtsZ.


2012-5-7 Mon

Muyuan Chen & Xiaodan Xu: Modified the experiment program--the promoter and the hairpin of the antisense fragment.


2012-5-8 Tue

Ying Cheng: Made the summary of the previous project.

Kai Gui: Finished the model of cellular automata based on the AHL signal diffusion.


2012-5-10 Thur

Our group discussed about the human practice.

Xingyu Zhou:Modified the experiment program of AHL part.

Xintong Ling: Summarise the previous model.

Xiaodan Xu: sorted out the kits list.


2012-5-11 Fri

Xintong Ling:modified the model of cellular automata.


2012-5-12 Sat

Xingyu Zhou:finished the complete AHL experiment program.


2012-5-13 Sun

Xiaodan Xu: Made a list of possibly useful kits.


2012-5-14 Mon

Muyuan Chen: Ordered the paired termini sequence.


2012-5-16 Wed

Xintong Ling & Kai Gui & Jun Zhang: had a meeting talking about the model.


2012-5-22 Tue

Xingyu Zhou: Found out the chemical way of the AHL detection.


2012-5-24 Thur

Xiaodan Xu: transformed the K082034 to make sure the method of Kit usage is correct.


2012-5-27 Sun

Had a group meeting and summarise the work we had done.Made the schedule for the summer vacation and everyone started the preparation for their final examinations.


2012-5-31 Thur Xingyu Zhou: Finished the budget for our project.


June Week 3


2012-6-12 Tue

We got the paired termini fragment in the PUC vector.


2012-6-16 Sat

Muyuan Chen:wrote the experiment program of AHL.(BBa_T9002+F1610)


June Week 4


2012-6-18 Mon

PCR: FtsZ target fragment

Seuo6-18.JPG

Transform: F1610 R0010

Recovery: I13521


2012-6-19 Tue

Check: F1610 failed; R0010 growed

Digestion: FtsZ1 FtsZ5 paired termini

Transform: F1610

Culture: R0010

Results: AHL failed


2012-6-20 Wed

Check: F1610 failed again

Transform FtsZ1/5+paired termini

Results: AHL failed


2012-6-21 Thur

Check: None

Miniprep plasmids R0010

Transform FtsZ1/5+paired termini

Culture: F1610; C0261; B0015

Others Found our instructor Zuhong Lu and reported our schedule.


2012-6-22 Fri

Check: F1610 FtsZ5+paired termini failed

PCR: Paired termini

Transform: J5526; I13202; T9002

Culture: FtsZ1+paired termini; T9002

Results: AHL failed; We got ftsZ1+termini~


2012-6-23 Sat

Check: J5526 I13202 growed.

Miniprep plasmids T9002

Culture: J5526; I13202

Others Muyuan Chen : Designed the toggle switch. BBa_K415301 BBa_K415300

June Week 5


2012-6-25 Mon

Miniprep plasmids: I13202; J5526

Seuo6-25.JPG

Transform: I13202; K415023; K091230

Recovery: Pet32a

Culture: I13202+T9002


2012-6-26 Tue

Check: K415023 failed

Digestion: T9002; I13202

Transform: K415023

Recovery: I13202

Culture: I13202; K091230

Results: Toggle switch failed


2012-6-27 Wed

Digestion: T9002+I13202

Transform: R0082; K415301; M30109; K415023; K091230

Recovery: T9002


2012-6-28 Thur

Check: T9002 failed

Ligation: T9002+I13202

Recovery: J5526

Culture: R0082 K415301 M30109 K415023 K091230

Results: AHL maybe failed.


2012-6-29 Fri

Check: R0082 K415023 failed

Miniprep plasmids: K415301; M30109; K091230

Digestion: Pet32a; paired termini

Ligation: Pet32a+paired termini

Transform: R0082; R0083; R0084

Results: AHL maybe would failed.


2012-6-30 Sat

Check: R0082 R0083 R0084 failed

Miniprep plasmids: Pet32a

Digestion: ftsZ +paired termini; Pet32a

Ligation: ftsZ+paired termini+pet32a

Recovery: Pet32a+egfp

Culture: FtsZ1 +Paired termini

Results: Light sensor failed


July Week 1


2012-7-1 Sun

Check: The recovery was fine

Ligation: FtsZ+Paired termini+pet

Transform: FtsZ+Paired termini+pet

Others: Xingyu Zhou: found the way of AHL detection.

Xiaodan Xu: Supplement the knowledge on the toggle switch.


2012-7-2 Mon

Check: We got FtsZ1+pt+pet (not confirmed)

PCR: R0082;

Seuo7-2.JPG
  • The marker failed. We are not sure about the result.

Ligation: FtsZ+Paired termini+pet

Transform: Ftsz1+pt+pet R0082 R0083 I13507 J5526 J4450 R0011

Recovery: T9002 I13202 M30109

Culture: R0084 ftsz+pt


2012-7-3 Tue

Check: The FtsZ5 failed. J5526 didn’t turn red.

Miniprep plasmids: T9002 I13202 M30109 R0084 FtsZ1

Seuo7-3-1.JPG
  • ftsZ1 R0084 failed

PCR: T9002;

Seuo7-3-2.JPG
  • The density was too low.

Digestion: T9002+I13202

Transform: p0451 r0051 i732820 i13973

Recovery: R0083 I13507 R0011 R0084 FtsZ1 J04450

Others Muyuan Chen: Sorted out all the kits we might need.


2012-7-4 Wed

Check: I13507 failed

Miniprep plasmids: R0011 R0084 FtsZ1 J04450 r0083

300px
  • Only J04450 R0084 FtsZ1 succeeded.

PCR: P0451 I732830 R0051 I13973 R0084

Seuo7-4-2.JPG
  • Didn’t get R0051

Ligation: FtsZ+Paired termini+pet

Transform: I13507 J23039 R0062 J37033

Culture: P0451 i732820 R0051 I13973


2012-7-5 :Thur

Check: R0051 failed

Miniprep plasmids: P0451 I732820 I13973 R0084 M30109 I13202 T9002

Seuo7-5-1.JPG
  • R0084 M30109 failed

PCR: I13507 R0062 J37033 J23039 T9002

Digestion: T9002 I13202 R0084 M30109

Transform: R0051 R0011

Recovery: Paired termini Pet

Others Xintong Ling: Started the simulation of colony.


2012-7-6 Fri

Check: The transformation failed all! We didn’t find out the cause.

Miniprep plasmids: I13973 J37033 J23039 R0084 M30109 I13507 Paired termini pet32a

Seuo7-6-1.JPG
  • R0084 M30109 failed

PCR FtsZ1/5 r0062

Seuo7-6-2.JPG
  • All succeeded

Digestion: Pet+paired termini

Ligation: T9002+I13202

Transform: R0051 R0011

Others:

  • We had a short meeting, talked about our project again.
  • Today the lab had power failure at noon.


2012-7-7 Sat

Check: none failed

Miniprep plasmids: R0084 R0062

Seuo7-7-1.JPG
  • We got the two plasmids

PCR: R0051 R0011

Seuo7-7-2.JPG
  • R0011 failed

Ligation: PET+Paired termini

Transform: T9002+I13202

Others Xingyu Zhou: Sorted out the experiment protocols.

Kai Gui: figured out the diffusion parameters.


2012-7-8 Sun

Check: T9002+I13202 failed.

Our holiday~

July Week 2


2012-7-9 Mon

Miniprep plasmids R0011

Seuo7-9.JPG
  • R0011 failed

Transform: R0082 R0083 J23039 R0011 R0051

Recovery: P0451 K091230 I13202 I13973 R0062 I13407 T9002 PET+paired termini

Others Check the materials in our lab.

Kai Gui: Solve the diffusion equation.


2012-7-10 Tue

Check: R0051 failed.

Miniprep plasmids: M30109 T9002 I13202 R0084 R0010 K091230 P0451

Seuo7-10-1.JPG

PCR: R0082 R0083 J23039 R0011 R0051

Seuo7-10-2.JPG
  • J23039 failed due to the high temperature.

Transform: I15008 S03419 K081024

Recovery: R0082 R0083 PET+PT T9002 P0451 I13507 R0010


2012-7-11 Wed

Check: J23039 R0082 failed

Miniprep plasmids: PET+PT I13507 R0010 T9002 P0451

Seuo7-11-1.JPG
  • R0010’s density was too low. P0451 was wrong.

PCR: I15008 S03419 K081024 I13202 PET I13507 R0010 P0451 T9002

Seuo7-11-2.JPG
  • T9002 was wrong, all the colony was wrong.

Digestion: I13202 T9002 R0011 P0451 R0084 M30109

Transform: R1051 P0151 R0083 I763026 I763035 P0440

Culture: I15008 S03419 K081024 R0082 J23039 M30109 PET+PT

Others Xingyu Zhou & Xuelong Fan & Shen Gao & Xiaodan Xu: Improved our experiment methods.


2012-7-12 Thur

Check: R0082 S03419 I15008 failed

Miniprep plasmids Pet

Seuo7-12-1.JPG

PCR: M30109 J23039 K081024 PET ftsZ1/5

Ligation: T9002+I13202 R0010+P0451

Transform: R1051 I15008 S03419

Recovery: I13202 T9002 R0010 P0451

Culture: P0151 P0440 I763026 R0082 I763035


2012-7-13 Fri

Check: R1051 failed

Miniprep plasmids P1051 P0440 I763035 I763026 R0082 I13202 T9002 R0010 P0451

Seuo7-13-1.JPG
  • I13202 failed

PCR: P1051 P0440 I763035 I763026 R0082 I13202 T9002 R0010 P0451

  • I763026 I13202 r0010 failed

Transform: R1051 K081024

Culture: I15008 S03419


2012-7-15 Sun

We had our holiday~

July Week 3


2012-7-16 Mon

Miniprep plasmids: R0051 M30109 J5526 S03419 P0440 R0010 I763026 R1051

Seuo7-16.JPG
  • P0451’s strip was too light

Transform: I15008 J04450

Recovery: R0082 I13507 DH5

Others:

  • Zhengyang Jia: sorted out the experiment main points about the digestion.
  • Xingyu Zhou: started to collect ideas for human practice.


2012-7-17 Tue

Check: All growed

Digestion R0010 P0451 P0151 P0440 R0082 R0084 M30109

Transform K081024

Recovery K091230 PET+PT I13507

Culture: I763035 R0010 PET

Others Xintong Ling: Summarized the previous iGEM model and asked some questions.


2012-7-18 Wed

Check: All growed

Miniprep plasmids: I15008 I763035 J04450 T9002 I13202 M30109 PET+PT+FtsZ1 I15008 I13202 M30109 failed

Seuo7-18-1.JPG

PCR: J04450 I15008 I763035 T9002 I13202 I13507 R0010

Seuo7-18-2.JPG
  • R0010 I15008 failed

Transform: Pet+pt pet+FtsZ1 k091230

Recovery: I763035 I15008 I13202

Culture: Pet+pt FtsZ1 k091230

Others Xingyu Zhou: Found some AHL substitute Kits.


July Week 4


2012-7-23 Mon

Check: None

Transform: F2620 R0040 K082034

Recovery: K091230 I732820 R0010 R0062 PET+PT PET I13202

Others: We had a meeting talking about our schedule.


2012-7-24 Tue

Check: All growed

Miniprep plasmids: I732820 R0062 K091230 R0010 R0062 PET+PT+FtsZ1(we called it TBY~) R+P0451 I13202

Seuo7-24.JPG
  • R+P0451 failed

PCR: I732820 R0062 K091230 I+T9002 R+P0451 F2620

  • I+T9002 failed

Digestion: F2620 I13202 K091230 R+P0451 R0062 I+T9002

Transform: K082034


2012-7-25 Wed

Check: All growed.

PCR: FtsZ1/5 tby R0051

Seuo7-25.JPG

Digestion: Tby ftsz1/5 B0015 R0051 I732820

Ligation: I13202 +F2620 R+P+K091230 I+T+R0062

Culture: K082034

Others Xuelong Fan: Changed the project of light sensor due to too many times of failure.


2012-7-26 Thur

Check: None

Miniprep plasmids K082034 B0015 F2620 R0040

Seuo7-26-1.JPG

PCR R0051

Seuo7-26-2.JPG

Digestion: Pet+FtsZ1/5 FtsZ1/5+B0015

Ligation: TBY+PSB R0051+I732820 FtsZ1/5+PSB

Transform: I13202+F2620 R+P+K091230 I+T+R0062


2012-7-27 Fri

Check: The transformed Kits all growed.

Ligation: ftsZ1/5+pet I+T9002+R0062

Transform: R0051+I732820 I+T9002+R0062 ftsZ1/5+PSB

Others: Xingyu Zhou: proposed the idea of making the video about syhthetic biology to finish our human practice.


2012-7-28 Mon

Check: All growed.

Miniprep plasmids: I13202+F2620 R0010+P0451+K091230 I13202+T9002+R0062

Seuo7-28.JPG

Culture: Tby R0051+I732820 I13507


2012-7-29 Sun

Check: All growed.

Miniprep plasmids: FtsZ1/5 TBY K091230 R0051+I732820

Seuo7-29-1.JPG

PCR: R0051 I13507

Seuo7-29-2.JPG

Digestion: R0051 I13507 J04450

Recovery: R+P0451 I13202+T9002 I13507

Others: Kai Gui: Finished the AHL diffusion simulation.


July Week 5


2012-7-30 Mon

Miniprep plasmids: I13507 R+P0451 I13202+T9002

Seuo7-30.JPG

PCR: TBY FtsZ1/5 B0015 R+P0451 I13507

Digestion: TBY FtsZ1/5 B0015 I13202 F2620 I13507 K091230 R+P0451

Recovery: R+I13507 B0015 PET I13202+T9002 I13202+F2620 I732820 R0010 S03419 K081024


2012-7-31 Tue

Check: All growed

Miniprep plasmids: R0010+I13507 pet I13202+T9002 I13202+F2620 I732820 B0015 R0010 S03419 K081024 I13202+T9002+R0062

Seuo7-31-1.JPG

PCR: FtsZ1/5 S03419 K081024 I13202+T9002+R0062

Seuo7-31-2.JPG

Digestion: R0051 I13507 FtsZ1/5 pet

Ligation: I13202+F2620+I13507 TBY+B0015 FtsZ1/5+B0015 R+P0451+K091230

Transform J13002 R0051+I13507

Recovery: K091230 I732820 I13507 K081024 S03419


August Week 1


2012-8-1 Wed

Check: We got a perfect result of Transformation of J13002

Miniprep plasmids: S03419,K081024

  • Failed:S03419,K081024

Ligation: S03419(plasmids got on July 31st ,digested with EcoRI&SpeI)+B0015(digested with EcoRI&XbaI); K081024(plasmids got on July 31st ,digested with EcoRI&SpeI)+I13507(digested with EcoRI&XbaI)

Recovery I15008

Others Filter S03419 and K081024 with Amp+ solid LB media to guarantee the availability of these two kits.


2012-8-2 :Thur

Check: We got a perfect result of the filtration of S03419&K081024

Miniprep plasmids: J13002,I15008

PCR J13002

  • The signal of the result is too weak.

Digestion: I15008(XbaI+PstI) failed

Transform: S03419+B0015 K081024+I13507

Culture: S03419&K081024


2012-8-3 Fri

Check: The transformation succeeded.

Recovery J13002,I15008

Culture: S03419+B0015

Pick up the red monoclones of K+I

Plasmid Sequencing: Failed:R0010,J13002,I15008, K081024; Suceeded: S03419,


2012-8-4 Sat

Check: The broths seem to be good but I15008 failed.

Miniprep plasmids: S+B,J13002,K+I

Recovery: R0010


2012-8-5 Sun

Miniprep plasmids: R0010

Digestion: R0010(E+S) SB(E+X) pSB2K3(E+P) KI

  • R0010 & SB failed at the second digestion.
  • pSB2K3 &KIsucceeded.

Recovery R0010


August Week 2


2012-8-06 Mon

Check: The Digestion of R&S failed yesterday.

Digestion: R0010(E-S) S03419(E-X)

Ligation: KI+pSB2K3

Culture: K+I

Plasmid Sequencing: R0010,SB(04th,Aug),KI(04th,Aug)


2012-8-7 Tue

Check: The Result seem to be pretty nice.

Ligation: R0010+SB

Recovery: R0010,SB,I15008

Culture Pick out a monoclone of KI(pSB2K3)

Plasmid Sequencing: J13002


2012-8-8 Wed

Check: We got quite reliable E.Coli strains that contain KI and S03419

Miniprep plasmids: KI（pSB2K3）,R0010,J13002

PCR: R0010

Recovery: K081024,SB,S03419

Plasmid sequencing: K081024


2012-8-9 Thur

Miniprep plasmids: SB,I15008,R0010,J13002

PCR: R0010,I15008,J13002,SB Succeed:R0010,J13002

  • Failed:I15008,SB

Digestion: J13002(S-P) I15008(X-P) R0010(E-S) SB(E-X)


2012-8-10 Fri

Check: The time for digestion is not adequate so we need to try it again.

Digestion: J13002(S-P) I15008(X-P) R0010(E-S) SB(E-X)


2012-8-11 Sat

Check: This part of record is missing


2012-8-12 Sun

Digestion: R0010 & SB failed at the second digestion. pSB2K3 &KIsucceeded.

August Week 3


2012-8-16 Wed

Recovery: K091230 I732820 B0015 I13202 F2620


2012-8-17 Fri

Miniprep plasmids: B0015 I732820 F2620

  • F2620 failed

Digestion: B0015 I732820


2012-8-18 Sat

Miniprep plasmids: B0015 F2620

Digestion: B0015 F2620

PCR: PT Ftsz5 R0051(from K091230)

E-Fusion: Ftsz5&B0015 R0051&I732820


2012-8-19 Sun

E-Fusion: PT&B0015 I13202&F2620


August Week 4


2012-8-20 Mon

PCR: I13202&F2620 F2620 J04450 R0010&P0451 I13507

Recovery: K238013


2012-8-21 Tue

Miniprep plasmids: K238013 I13507 R0010+p0451 B0015 PT

Seuo8-21.jpg

E-Fusion: K238013&I13507


2012-8-24 Fri

Miniprep plasmids：I13202 I13507 R+I

Seuo8-24.jpg



2012-8-25 Sat

Miniprep plasmids：K091230

Seuo8-25.jpg


2012-8-26 Sun

Miniprep plasmids：B0015

Digestion: F2620

Recovery: I13507 TBY

Seuo8-26.jpg


August Week 5


2012-8-27 Mon

PCR: K116638 I13507

Miniprep plasmids:TBY K238013

Seuo8-27.jpg


2012-8-28 Tue

Miniprep plasmids: K091230 R+P PT

Seuo8-28.jpg

Digestion: I732820

Recovery: R+P pSB1C3


2012-8-29 Wed

Miniprep plasmids：R0051

Seuo8-29.jpg


2012-8-30 Thur

PCR: K238013&I13507 Ftsz1+B0015


2012-8-31 Fri

Miniprep plasmids: K238013 F2620 I732820 B0015 S+B R+P psb1c3

Seuo8-31.jpg

PCR: I13507 K116638 R0051 R+P

Digestion: K238013 F2620 I732820 B0015 S+B R+P psb1c3

Recovery: R0010 P0451



September Week 1


2012-9-1 Sat

Miniprep plasmids：B0015 RSB R+I

Seuo9-1.jpg

Digestion: K238013 F2620 I732820 P0451 B0015

PCR: R+I

E-Fusion: K238013&I13507 K116638&F2620 R0051&I732820


2012-9-2 Sun

E-Fusion: Ftsz1&B0015 Ftsz5&B0015-pSB1C3

Transformation: TBY-BL21





September Week 2



2012-9-3 Mon

Miniprep plasmids: K238013 F2620 I732820

Digestion: S+B


2012-9-5 Wed

Miniprep plasmids：F2620 I732820 K238031 PSB1C3

Seuo9-5.jpg

Digestion: K238013 F2620


2012-9-6 Thur

PCR: R+P I13507 K116638 P0451 B0015 S+B

Digestion: pSB1C3 K238013 F2620 B0015

E-Fusion: I13507&K238013 K116638&F2620 R0051&I732820

Recovery: R+P S+B K+I K238013 B0015



2012-9-7 Fri

Miniprep plasmids: K238013 F2620 B0015

Digestion: B0015 F2620 PT R+P P0451 pSB1C3 K238013

PCR: S+B R+P K+I P0451 PT



September Week 3


2012-9-10 Monday

PCR: Ftsz5+B0015 R+P K+I PT S+B TBY

E-Fusion: (Ftsz5+B0015 R+P K+I PT S+B TBY)&pSB1C3


2012-9-12 Wed

Miniprep plasmids：PSB1C3 R+P

Seuo9-12.jpg





Retrieved from "http://2012.igem.org/Team:SEU_O_China/Notebook"