Team:SUSTC-Shenzhen-B/comment

From 2012.igem.org

(Difference between revisions)
Line 11: Line 11:
         <div id="templatemo_main">
         <div id="templatemo_main">
             <div class="col col23">
             <div class="col col23">
 +
<font face="Arial, Helvetica">
                 <h2>Comments</h2>
                 <h2>Comments</h2>
                 <div class="cleaner h40"></div>
                 <div class="cleaner h40"></div>
                 <h3>BGI reasercher</h3>
                 <h3>BGI reasercher</h3>
-
                <p>I am a scientist in BGI, the unit of synthetic biology. This is my first time using your TTEC website.</p>
+
<p>Hi, I am K2, the instructor of Team Shenzhen. As I am a researcher in C.Dog project, I have tested some well measured terminators in C.Dog, via TTEC. As the algorithm of TTEC is being advanced, the simulation results seem to be much more reliable now.
-
<p>I input the sequence as follows:</p>
+
Furthermore, as part of our iGEM project YAO#1.0, younsters in our team have annoted several terminators in yeast mitochondiral genome. Then we caculate the termination efficency and 2nd structure via TTEC, and we wish the data can be vertified by our on-going experiments :)</p>  
-
<p>AGAGAATATAAAAAGCCAGATTATTAATCCGGCTTTTTTATTATTT</p>
+
-
<p>Then , the programme gave me the predicted efficiency and the structure of the terminator. Comparing the predicted efficiency value with the measured one, they are almost the same. </p>
+
-
<p>Precise and reliable as the software is, I really enjoy this searching experience. Obviously, I hope more researchers can use this software to simplify their work and this software will be stronger!</p>  
+
<br>
<br>
Line 24: Line 22:
                 <div class="cleaner h40"></div>
                 <div class="cleaner h40"></div>
-
               
+
 
-
            </div>
+
-
            <div class="col col13 no_margin_right">
+
-
                <h2>Pictures</h2>
+
-
                <img src=" https://static.igem.org/mediawiki/2012/2/20/He.JPG" class="img_fl img_border" />
+
-
                <img src="https://static.igem.org/mediawiki/2012/1/1e/Yideng.PNG" class="img_fl img_border" />
+
-
                <img src="https://static.igem.org/mediawiki/2012/1/13/Rui.JPG" class="img_fl img_border" />
+
              
              
                  
                  
-
 
+
</font>

Revision as of 11:36, 25 September 2012

SUSTC iGEM Theme - Free CSS Template

SUSTC iGEM Theme - Free CSS Template

Comments

BGI reasercher

Hi, I am K2, the instructor of Team Shenzhen. As I am a researcher in C.Dog project, I have tested some well measured terminators in C.Dog, via TTEC. As the algorithm of TTEC is being advanced, the simulation results seem to be much more reliable now. Furthermore, as part of our iGEM project YAO#1.0, younsters in our team have annoted several terminators in yeast mitochondiral genome. Then we caculate the termination efficency and 2nd structure via TTEC, and we wish the data can be vertified by our on-going experiments :)