Team:St Andrews/metal-binding
From 2012.igem.org
MPLockhart (Talk | contribs) |
MPLockhart (Talk | contribs) |
||
Line 82: | Line 82: | ||
<div class="btn-group"> | <div class="btn-group"> | ||
- | + | <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#"> | |
- | + | Ni2</sub> forward | |
<span class="caret"></span> | <span class="caret"></span> | ||
</a> | </a> | ||
<ul class="dropdown-menu"> | <ul class="dropdown-menu"> | ||
- | + | <div class="span4">AATTCATGTGTACAACATGCGGTTGCGGTGAAGGCC</div> | |
</ul> | </ul> | ||
</div> | </div> | ||
Line 93: | Line 93: | ||
<div class="btn-group"> | <div class="btn-group"> | ||
<a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#"> | <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#"> | ||
- | + | Pd forward | |
<span class="caret"></span> | <span class="caret"></span> | ||
</a> | </a> | ||
<ul class="dropdown-menu"> | <ul class="dropdown-menu"> | ||
- | <div class=" | + | <div class="span3">AGCGTGACCCAGAACAAATAT</div> |
</ul> | </ul> | ||
</div> | </div> | ||
+ | <div class="btn-toolbar"> | ||
<div class="btn-group"> | <div class="btn-group"> | ||
<a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#"> | <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#"> | ||
- | + | Ni1 reverse | |
<span class="caret"></span> | <span class="caret"></span> | ||
</a> | </a> | ||
<ul class="dropdown-menu"> | <ul class="dropdown-menu"> | ||
- | + | <p><div class="span3">TCGAGGTGGTGATCGTGATGATGG</div></p> | |
</ul> | </ul> | ||
- | |||
</div> | </div> | ||
- | |||
- | |||
<div class="btn-group"> | <div class="btn-group"> | ||
<a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#"> | <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#"> | ||
- | + | Ni2</sub> reverse | |
<span class="caret"></span> | <span class="caret"></span> | ||
</a> | </a> | ||
<ul class="dropdown-menu"> | <ul class="dropdown-menu"> | ||
- | <div class=" | + | <div class="span4">TCGAGGCCTTCACCGCAACCGCATGTTGTACACATG</div> |
</ul> | </ul> | ||
- | </div> | + | </div>. |
<div class="btn-group"> | <div class="btn-group"> | ||
Line 134: | Line 132: | ||
</div> | </div> | ||
- | + | </div>. | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
</div> | </div> | ||
- | < | + | <p> |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
<p>For primer annealing in the PCR, the primer sequences were combined in the following way:</p> | <p>For primer annealing in the PCR, the primer sequences were combined in the following way:</p> |
Revision as of 21:44, 24 September 2012
Metal binding protein
Introduction
Precious and toxic metals frequently find their way into the environment. As their names suggest, such leaks are wasteful and damaging respectively. St Andrews iGEM '12 plans to take the first steps toward solving this problem using synthetic biology.
Project Description
The human race moved from the stone of the Neolithic period and into the metallurgy of the Chalcolithic period with the widespread use of metal tools in their every day work regime (Gale 1991). Little changed over the next 6,000 years. Metals are still a massive part of our everyday lives, but in quantities that dwarf previous usage. These high levels of metal requirements have left the landscape scarred.
Our project was inspired by the work done identifying the platinum and palladium particles present on roads, primarily emitted from catalytic converters (Deplanche. K., et al. 2011). In 2010, 50% of the world's platinum and palladium production was used for catalytic converters, with the largest use in Europe (Jollie 2010). Platinum and palladium appear on road surfaces in small concentrations and in minute particles, < 3 μm (Prichard, Fisher 2012). These precious elements are a finite resource! However, their eventual exhaustion can be postponed by collecting and recycling them.
We have focused on the collection process. We have worked in a similar way to Chung et al, in that we have produced a protein with a metal binding peptide on the N-terminus of an easily expressible protein (Chan Chung, Cao et al. 2008). The difference is that we used glutathione S-transferase (GST tag) rather than ubiquitin, and instead of adding the binding peptide chemically to the protein we expressed both the protein and the peptide in E. coli BL21 (DE3) cells. These cells are particularly suited to large scale protein production. The peptides sequences were taken from various sources (Seker, Demir 2011, Bae, Chen et al. 2000, Song, Caguiat et al. 2004, White, Liljestrand et al. 2007) and codon optimised for E. coli., there nucleotide sequence was modified so they could be produced by E. coli in a highly efficient manner, using an online program Protein to DNA.
We decided to go down two different routes. The first was making an array of proteins that bind specific metals, and the second was to make a protein with multiple metal binding sites for multiple metals.
With the first of the two ideas we thought that it would be possible use a column to imobilise the protein by its GST tag. A solution containing multiple metal ions would then be passed through the column and bind each metal ion specifically. Initially, palladium, platinum and nickel (Seker, Demir 2011). The reason for choosing these metals was twofold. Firstly, because platinum and palladium are particularly precious metals providing an economic argument, and secondly, because nickel columns were readily available to test this idea.
The second route would produce a protein that would act as a general metal scavenging protein. gBlocks (≤ 500 bps) were specifically designed and inserted into a pGEX-6P-1. One of them was designed to bind toxic metals; cadmium, mercury and cobalt (Seker, Demir 2011, Bae, Chen et al. 2000, Song, Caguiat et al. 2004, White, Liljestrand et al. 2007). This was done by inserting flexible linkers between the metal binding sites (Hu, Wang et al. 2007). The linkers were used because they were quite flexible. This prevented hairpins in the structure. The second gBlock designed was for precious metals, not including platinum and palladium. The corresponding gene sequences specific for gold, silver, aluminum and titanium peptides (Seker, Demir 2011) were used. The design of this differed from the other gBlock as myoglobin was hijacked, the loops removed and replaced with our metal binding peptides. .
Synthesizing Metal Binding Proteins
For detail on our laboratory procedures, please refer to our Protocols.
Sequences were found for short metal binding peptides. The gene sequences for the production of the metal binding peptides were very short. Therefore we were able to have each peptide gene synthesised as two complementary oligonucleotides. We then annealed the primers together using standard procedures. The product of this reaction had the relevant sticky ends for insertion of the sequence into the plasmid vector.
Short metal binding peptides
Primers
All primers are notated 5' to 3'.