"
Wet lab work-Thermosensor
From 2012.igem.org
|
|
|
| Home | Team | Team Profile | Project | Parts | Modeling |
|
Safety | Outreach | Collaboration | Attributions |
Contents |
April
4/24/12
Set up restriction digest of plasmid containing pBAD promoter, TSA, and LacZ to remove the thermosensor and insert a control thermosensor.
74-1JAR Restriction Digest
14ul ddH20
5ul NEB buffer 2
0.5ul 100x BSA
30 ul TSA plasmid pIG33
2ul PST1
2ul HindIII
ran product on low melt gel
74-1JAR Ligation
6.5ul ddH2O
1.5ul T4 DNA ligase
1 ul T4 DNA Ligase
3 ul vector (GS 74-1)
3 ul insert (TS control)
At room temp 30 min
Transformation
May
5/15/2012
Today we started the random mutagenesis screen. We used Protocol 2 for GBI Mutagenesis
First I (John) made 40 μL of 10 mM C/T stock
Protocol:
4 μL C 100 mm stock
4 μL T 100 mm stock
32 μL ddH2O
Then we made 50 μL of 2 mM G/A stock
Protocol:
1 μL G 100 mm stock
1 μL A 100 mm stock
48 μL ddH2O
Then we did the Mutagenesis (Protocol 2 for GBI Mutagenesis) (5x)
106 μL dd H2O
20 μL 10X ThermoPol buffer
15 μL 10 mM C/T stock
5 μL 2 mM G/A stock
15 μL JG54 (primer)
15 μL JG47 (primer)
10 μL template (TSA-Wild type and 5-3 in the other-there are 2 test tubes - this is the only difference between the two)
2 μL Taq Polymerase (NEB)
20 μL 5 mM MnCl2 (added at the very end)
(This entire protocol was the original mix x5)
5/18/2012
Today we did the random mutagenesis screen again, making much more and putting it into 20 tubes. Here is the Protocol 2 for GBI Mutagenesis (15x)
First I (John) made 200 μL of 10 mM C/T stock
Protocol:
20 μL C 100 mm stock
20 μL T 100 mm stock
160 μL ddH2O
Then we made 100 μL of 2 mM G/A stock
Protocol:
2 μL G 100 mm stock
2 μL A 100 mm stock
96 μL ddH2O
Then we did the Mutagenesis (Protocol 2 for GBI Mutagenesis)
318 μL dd H2O
60 μL 10X ThermoPol buffer
45 μL 10 mM C/T stock
15 μL 2 mM G/A stock
45 μL JG54 (primer)
45 μL JG47 (primer)
30 μL template (TSA-Wild type and 5-3 in the other-there are 2 test tubes - this is the only difference between the two)
6 μL Taq Polymerase (NEB)
60 μL 5 mM MnCl2 (added at the very end)
(This entire protocol was the original mix x5)
This was done for the 2 different templates and put into 20 tubes (30 μL per tube) per template. This gives us a total of 40 tubes.
5/25/2012
Today we ran it out on a gel. Here is the order: ladder, control, TSA, 5-3.
Here it is: (left)
5/29/2012
Restriction Digest today (Jordan and John)
For plasmid backbone (vector):
10 μL buffer
1 μL BSA
83 μL plasmid (pIG33 TSA)
3 μL each enzyme (PstI and HindIII)
For insert:
16.5 μL H2O
25 μL buffer
2.5 μL BSA
200 μL insert (TSA and 5-3)
6 μL each enzyme (PstI and HindIII)
Put them to incubate at 37°C for 2 hours.
5/31/2012
Ran out the restriction digests on a low melt agarose gel.
Not sure if the restriction enzymes cut.... Faint bands at around 200 bp, so I think it did. Cut out the distinct bands from the gel.
Next step: ligation and transformation. (Be sure to set up backbone-only control for the ligation to compare transformation efficiency.)
June
6/1/2012
Ligation reaction
6.5 μL sterile H20
1.5 μL 10X ligase buffer
3 μL vector
3 μL insert
1 μL T4 DNA Ligase
Gel slices were gathered in two separate tubes for the mutated TSA insert and the backbone (pIG 33).
Did a negative control (ligation with just the backbone, no insert.)
Next step: transform them into DH5α! Test negative control ligation's transformation efficiency versus the ligations with the insert's.
E. coli Transformation:
Thaw DH5α on ice (25 μL per transformation)
Add 2 μL of ligation reaction to each tube of competent E. coli.
Heatshock for 1 min. @ 42°C and place back on ice.
Add 500 μL LB to each tube.
Incubate @ 37 °C for 30 min.
Plate on LB + amp.
6/4/2012
The plates did not look right, so we are redoing the ligation (John and Jordan) with Dr. Grose. We think maybe the gel wasn't cut thin enough.
First we made a master mix (x5)
32.5 μL dd H2O
7.5 μL 10X ligase buffer (includes ATP)
5 μL T4 DNA ligase
We added 9 microliters of this master mix to each of the 5 tubes.
Then we added vector and insert appropriately to each one (TSA-1, TSA-2, 5-3 and controls for each of 2 backbone mixes).
6/5/2012
The plates looked better, but we are worried the backbone didn't turn out right, so we are redoing that. The insert should be fine, though.
Restriction digest on backbone:
10 μL buffer
1 μL BSA
83 μL plasmid (pIG33 TSA)
3 μL each enzyme (PstI and HindIII)
6/8/2012
After redoing the restriction digest of the backbone and getting a much thinner slice of gel, the ligations work many times better. The next step is a small trial screen.
Screen procedure:
E. coli transformations of ligation reaction into DH5α.
Plate the transformations on LB+amp+arabinose+xgal.
Two ways to screen plates (want to do both):
1.Grow for about 2 days at 30 °C.
Mark all clear colonies or mark all blue colonies. (Make some way to keep track of the colonies.)
Switch plates to 37 °C and check every couple of hours.
2.Grow plates for 1 day at 37 °C
Switch plates to 42 °C. Check previously marked clear colonies for color change.
Ones that turn blue are the interesting ones. Keep your eyes on those!!
6/11/12
Growing Plates at 37°C for 2 days didn't work very well, but 30°C worked, we will shift them at 37°C and go ahead with a screen @ 30°C.
Ligation:
30 μL ligation reactions of TSA-1, TSA-2, and 5-3.
6/18/12
Did E. coli transformation of the 30 μL ligation reactions of TSA-1, TSA-2, and 5-3. (Did around 40 plates total, around 12 - 14 plates for each one.
Placed most at 30°C but put a few in at 37°C.
6/19/12
Checked the plates. The plates being screened at 30°C are not nearly grown up enough to check. The 37°C plates did grow up, but the colonies are not large.
Placed a test plate of TSA-1, TSA-2, and 5-3 in the 37°C. (They were grown over the weekend at 30°C. Marked the white/not blue colonies with black sharpie. Check periodically throughout the day.
Put in: 10:30 a.m.
Checking times:
1. 12:30 p.m.
2. 2:30 p.m.
3. 4:30 p.m.
More Ligations
30 μl ligations of TSA-1, TSA-2, and 5-3.
13 μL H20
3 μL 10X Ligase Buffer
6 μL vector
6 μL insert
2 μL T4 DNA Ligase
6/21/12
Thermosensor screen: shift plates grown at 30 to the 42. Check periodically.
Timetable is as follows:
1st-> 12:00 p.m.
2nd-> 5:00 p.m.
3rd-> Friday morning 10:00 a.m.
Color code:
Black-> colony blue initially
Purple-> 12:00 pm blue (4:00 pm)
Red-> 5:00 pm blue (8:00 am)
Green-> 10:00 am blue (12:00 am)
Orange-> white initially
6/27/2012
12:00 initial: Black
2:00 pm: John, Green
4:00 pm: Jordan, Red
6:00 pm: Brooke, Yellow
8:00 pm: Jordan, Blue
10:00 pm: Brooke, brown
Next day
8:00 am: Jordan, Purple
2:00 pm: All of us! Orange
July
7/9/2012
We patched green red and yellow onto plates, then identified which ones had a good change from 30 to 37 and 37 to 41. Then we took these and streaked them out on plates again.
7/10/2012
3 ligations today (with a new mutagenic PCR that Dr. Grose used)
-Just backbone
-backbone and TSA
-backbone and 5-3
13 μL H20
3 μL 10X Ligase Buffer
6 μL vector
6 μL insert
2 μL T4 DNA Ligase
Then we transformed the vectors into E. Coli!!!
Thaw DH5α on ice (25 μL per transformation)
Add 2 μL of ligation reaction to each tube of competent E. coli.
Heatshock for 1 min. @ 42°C and place back on ice.
Add 500 μL LB to each tube.
Incubate @ 37 °C for 30 min.
Plate on LB + amp.
7/10/2012
Plates were checked with controls, and the following appear to be good candidates for the database:
5-3G9, 5-3G10, 5-3G11, 5-3R2, 5-3P1, 5-3P2, 5-3P3, 5-3P4, 5-3P5, 5-3P6, 5-3P8, 5-3P10, 5-3P12
Need to make overnights of these and purify plasmids when possible.
7/16/2012
12:00 initial: Black
3:00 pm: Jordan, Green
5:00 pm: Karl, Red
7:00 pm: Dean, Yellow
9:00 pm: Brooke, Blue
Next day
8:00 am: Jordan, Purple
12:00 pm: All of us! Orange
7/25/2012
Catch up:
Lots more patching and streaking
We did a new screen using special Grose PCR methods (see Dr. Grose for details).
More patching and streaking.
We are going to start doing Beta-Gal Assays. Today we are preparing 3 (one is a blank-to assure that contamination does not occur) overnights.
Protocol: 6 mL of LB with amp and arabinose Swipe a single colony (one from TSA, one from 5-3) and place into LB (a blank tip that was not swiped was placed in our blank LB)
Reagents for B-gal assays:
4 mg/mL ONPG (Substrate): Dissolve 4 mg substrate into 1 mL of Phosphate Buffer.
Z buffer:
Stop buffer (Phosphate buffer):
Chloroform and 0.1% SDS
Assay Protocol
Day 1: Start overnight cultures in LB+amp+arabinose
Day 2: Dilute cells early 1/100 in more LB+amp+arabinose and incubate at 30, 35, & 37 C (and in the future at 40) until they reach mid-log phase (should take 3 hr and 45 min for 30 C, 3 hr for 37 C, somewhere in between for 35 C and somewhere less than 3 for 40 C). You also need to make ONPG fresh the day the assays are to be done.
Preparation of cells:
Incubate cultures on ice for 20 minutes to stop growth and wash as follows:
Pellet 5 mL of cells at 4 C by centrifuging at 4,000 rpm (protocol says in Sorval SS34 rotor) for 10 min.
Pour off supernatant
Resuspend the cell pellet into 1.1 mL of chilled Z buffer.
Measure OD600 of cultures by diluting 100 μL into 900 of Z buffer.
Next, permeabilize 1 mL of cells by adding 100 uL chloroform and 50 uL 0.1% SDS. Note: Chloroform is easier to pippete if the air in the pippete tip is saturated-do this by drawing up and releasing chloroform several times.
Vortex and equilibrate the tubes 5 minutes in a 28 C water bath.
Assay
To start the reaction, add 0.2 mL substrate ONPG (o-nitrophenyl-B-D-galactoside)
Vortex and RECORD THE TIME OF ADDITION PRECISELY WITH TIMER OR STOPWATCH. This may take anywhere from 30 minutes to overnight, depending on the temperatures of incubation and the assayed thermoswitch.
Incubate cells at various temperatures.
Stop the reaction after yellow color develops by adding 0.5 mL 1 M Na2CO3.
Vortex and RECORD THE TIME PRECISELY.
Transfer to a new tube, spin 5 minutes at maximum speed to remove debris and chloroform.
Record the OD420 and OD550 for each tube.
Finish calculations.
7/26/2012
We calibrated the spectrophotometer, then measured the amount of bacteria. They were at 1.04 (mid-log phase is between .5 and 1, so we are barely okay). We did it wrong, though, so we are redoing it tomorrow (forgot to grow at different temperatures (30, 35 and 37).
We pulled them out at mid-log phase (.5-1) (around 3 hours - some took longer than others) and put them on ice for 20 min.
We made ONPG mixture (8 mg of ONPG and s mL of the phosphate buffer).
We made .1% SDS.
We then Followed the protocol exactly (see above)
Mid-log phases: ( times started at 9:45 a.m.)
5-3 30 C .064 2:15 p.m.
5-3 35 C .057 1:12 p.m.
5-3 37 C .109 1:10 p.m.
TSA 30 C .051 2:16 p.m.
TSA 35 C .051 1:40 p.m.
TSA 37 C .079 1:10 p.m.
OD600's
5-3 30 C .195
5-3 35 C .175
5-3 37 C .298
TSA 30 C .217
TSA 35 C .359
TSA 37 C .212
Reaction (adding ONPG)
5-3 30 C (start time = 3:11) (end time = 1:02) (OD420 = .16) (OD550 = .04) (T = 4206 minutes) (V = 1.75) (V measured at end)
5-3 35 C (start time = 3:12) (end time = 5:36) (OD420 = .630) (OD550 = .018) (T = 145 minutes) (V = 1.9 mL)
5-3 37 C (start time = 3:12) (end time = 5:36) (OD420 = .569) (OD550 = .017) (T = 145 minutes) (V = 1.9 mL)
TSA 30 C (start time = 3:11) (end time = 8:12) (OD420 = .559) (OD550 = .009) (T = 1021 minutes) (V = 1.75 mL)
TSA 35 C (start time = 3:11) (end time = 5:36) (OD420 = 1.381) (OD550 = .015) (T = 145 minutes) (V = 1.8 mL)
TSA 37 C (start time = 3:11) (end time = 5:36) (OD420 = .519) (OD550 = .011) (T = 145 minutes) (V = 1.85 mL)
Miller Units = 1000*(OD420-1.75*OD550)/(T*V*OD600)
5-3 30 C = 1000*(.16-1.75*.04)/(4206*1.75*.195) = .0627
5-3 35 C = 1000*(.63-1.75*.018)/(145*1.9*.175) = 12.4138
5-3 37 C = 1000*(.569-1.75*.017)/(145*1.9*.298) = 6.5683
TSA 30 C = 1000*(.559-1.75*.009)/(1021*1.75*.217) = 1.4011
TSA 35 C = 1000*(1.381-1.75*.015)/(145*1.8*.359) = 14.4585
TSA 37 C = 1000*(.519-1.75*.011)/(145*1.85*.212) = 8.7877
7/30/2012
More transformations of same ligations from PCR that Dr. Grose did (5-3 and TSA)
Let them grow
August
8/2/2012
More Beta-gal assays today on 12 different samples we had saved from screens before.
We grew up the 12 + 1 control in 30, 35 and 37 and tested for mid-log phase. They started growing at 9:15 a.m. and we checked for mid-log phase at 12:13 p.m.
For 35 two of the mid log phases (OD 600) were .237 and .497 (way too far gone)
For 37 two of the mid log phases were .101 and .060 (right in mid-log phase)
For 30 one of the mid log phases was .012
Only the 37's are ready at this point, so we are doing the assay with them (same protocol as above). Here are the 13 different species:
TSA 37 (OD600 = .159) (start time = 2:17 p.m.)
P1 37 (OD600 = .125) (start time = 2:17 p.m.)
P2 37 (OD600 = .161) (start time = 2:15 p.m.)
P3 37 (OD600 = .095) (start time = 2:18 p.m.)
P4 37 (OD600 = .054) (start time = 2:18 p.m.)
P5 37 (OD600 = .129) (start time = 2:16 p.m.)
P8 37 (OD600 = .101) (start time = 2:16 p.m.)
P10 37 (OD600 = .080) (start time = 2:17 p.m.)
P12 37 (OD600 = .202) (start time = 2:19 p.m.)
G9 37 (OD600 = .107) (start time = 2:18 p.m.)
G10 37 (OD600 = .133) (start time = 2:19 p.m.)
G12 37 (OD600 = .092) (start time = 2:19 p.m.)
5-3 37 (OD600 = .157) (about a .06 difference when it was turned) (start time = 2:19 p.m.)
We checked the reading on one of the 30's again (1:14): .023 They still need more time.
We think some of the OD600 readings were taken wrong, so we may correct for lower values at the end.
TSA 37 (1.5 mL) (OD550 = .031, OD420 = .731) (stop time = 4:12 p.m.)
P1 37 (1.5 mL) (OD550 = .032, OD420 = 1.686 ) (stop time = 4:12 p.m.)
P2 37 (1.5 mL) (OD550 = .035, OD420 = .351 ) (stop time = 4:13 p.m.) DILUTED 9:1
P3 37 (1.5 mL) (OD550 = .040 , OD420 = .136 ) (stop time = 4:08 p.m.) DILUTED 9:1
P4 37 (1.5 mL) (OD550 = .033 , OD420 = .113 ) (stop time = 4:13 p.m.) DILUTED 9:1
P5 37 (1.5 mL) (OD550 = .046 , OD420 = .770 ) (stop time = 4:15 p.m.)
P8 37 (1.5 mL) (OD550 = .048 , OD420 = 1.650 ) (stop time = 4:15 p.m.)
P10 37 (1.5 mL) (OD550 = .044 , OD420 = 1.031 ) (stop time = 4:09 p.m.)
P12 37 (1.5 mL) (OD550 = .039 , OD420 = .303 ) (stop time = 4:10 p.m.) DILUTED 9:1
G9 37 (1.5 mL) (OD550 = .030 , OD420 = .228 ) (stop time = 4:14 p.m.) DILUTED 9:1
G10 37 (1.5 mL) (OD550 = .038 , OD420 = .130 ) (stop time = 4:07 p.m.) DILUTED 9:1
G12 37 (1.5 mL) (OD550 = .028 , OD420 = .188 ) (stop time = 4:11 p.m.) DILUTED 9:1
5-3 37 (1.5 mL) (OD550 = .033 , OD420 = .510 ) (stop time = 4:11 p.m.)
This B-gal basically failed, so we are doing it again
8/7/2012
Redoing that same B-gal (started growing at 8 or 9 in the morning. All other times are p.m.) (V = 1.75)
TSA 37 (start = 4:30) (end = 5:04) (T = 34) (OD600 = 0.354) (OD550 = .012) (OD420 = .086)
5-3 37 (start = 4:29) (end = 5:04) (T = 35) (OD600 = 0.294) (OD550 = -.002) (OD420 = .092)
P1 37 (start = 4:30) (end = 5:04) (T = 34) (OD600 = 0.265) (OD550 = .003) (OD420 = .093)
P2 37 (start = 4:29) (end = 5:02) (T = 33) (OD600 = 0.237) (OD550 = -.002) (OD420 = .150)
P3 37 (start = 4:26) (end = 5:05) (T = 39) (OD600 = 0.264) (OD550 = .006) (OD420 = .176)
P4 37 (start = 4:30) (end = 5:03) (T = 33) (OD600 = 0.256) (OD550 = -.024) (OD420 = .109)
P5 37 (start = 4:28) (end = 5:04) (T = 36) (OD600 = 0.263) (OD550 = -.005) (OD420 = .096)
P8 37 (start = 4:31) (end = 5:03) (T = 32) (OD600 = 0.290) (OD550 = .008) (OD420 = .127)
P10 37 (start = 4:29) (end = 5:03) (T = 34) (OD600 = 0.246) (OD550 = .011) (OD420 = .090)
P12 37 (start = 4:27) (end = 5:05) (T = 38) (OD600 = 0.266) (OD550 = .002) (OD420 = .142)
G9 37 (start = 4:27) (end = 5:04) (T = 37) (OD600 = 0.282) (OD550 = .005) (OD420 = .144)
G10 37 (start = 4:27) (end = 5:05) (T = 38) (OD600 = 0.272) (OD550 = -.025) (OD420 = .086)
G12 37 (start = 4:28) (end = 5:05) (T = 37) (OD600 = 0.217) (OD550 = .011) (OD420 = .077)
TSA 35 (start = 4:28) (end = 8:41) (T = ) (OD600 = .282) (OD550 = -.003) (OD420 = .482)
5-3 35 (start = 4:31) (end = 8:41) (T = ) (OD600 = .240) (OD550 = .008) (OD420 = .431)
P1 35 (start = 4:29) (end = 5:06) (T = 37) (OD600 = .286) (OD550 = .015) (OD420 = .049)
P2 35 (start = 4:30) (end = 5:06) (T = 36) (OD600 = .260) (OD550 = -.024) (OD420 = .101)
P3 35 (start = 4:29) (end = 5:06) (T = 37) (OD600 = .285) (OD550 = -.026) (OD420 = .104)
P4 35 (start = 4:36) (end = 5:05) (T = 29) (OD600 = .263) (OD550 = .010) (OD420 = .076)
P5 35 (start = 4:36) (end = 5:06) (T = 30) (OD600 = .255) (OD550 = .010) (OD420 = .041)
P8 35 (start = 4:26) (end = 5:07) (T = 41) (OD600 = .221) (OD550 = -.014) (OD420 = .054)
P10 35 (start = 4:28) (end = 5:07) (T = 39) (OD600 = .296) (OD550 = -.014) (OD420 = .035)
P12 35 (start = 4:26) (end = 5:07) (T = 41) (OD600 = .262) (OD550 = .018) (OD420 = .076)
G9 35 (start = 4:37) (end = 5:06) (T = 29) (OD600 = .289) (OD550 = .017) (OD420 = .081)
G10 35 (start = 4:28) (end = 5:07) (T = 39) (OD600 = .276) (OD550 = -.003) (OD420 = .028)
G12 35 (start = 4:27) (end = 5:07) (T = 40) (OD600 = .165) (OD550 = -.006) (OD420 = .010)
TSA 30 (start = 6:38) (end = 8:40) (T = ) (OD600 = .215) (OD550 = .004) (OD420 = .694) (not diluted)
5-3 30 (start = 6:37) (end = ) (T = ) (OD600 = .218) (OD550 = ) (OD420 = )
P1 30 (start = 6:39) (end = 8:24) (T = ) (OD600 = .284) (OD550 = -.011) (OD420 = .036)
P2 30 (start = 6:38) (end = 7:51) (T = ) (OD600 = .196) (OD550 = .010) (OD420 = .082)
P3 30 (start = 6:37) (end = 7:51) (T = ) (OD600 = .176) (OD550 = .006) (OD420 = .048)
P4 30 (start = 6:38) (end = 7:52) (T = ) (OD600 = .263) (OD550 = .015) (OD420 = .094)
P5 30 (start = 6:35) (end = 8:24) (T = ) (OD600 = .195) (OD550 = -.008) (OD420 = .057)
P8 30 (start = 6:34) (end = 7:51) (T = ) (OD600 = .190) (OD550 = .009) (OD420 = .094)
P10 30 (start = 6:39) (end = 8:25) (T = ) (OD600 = .196) (OD550 = -.015) (OD420 = .045)
P12 30 (start = 6:35) (end = 7:51) (T = ) (OD600 = .208) (OD550 = -.002) (OD420 = .067)
G9 30 (start = 6:36) (end = 7:50) (T = ) (OD600 = .296) (OD550 = .013) (OD420 = .046)
G10 30 (start = 6:36) (end = 8:39) (T = ) (OD600 = .232) (OD550 = .000) (OD420 = .584) (not diluted)
G12 30 (start = 6:36) (end = 8:25) (T = ) (OD600 = .159) (OD550 = -.015) (OD420 = .042)
September
September 17, 2012
Cloning for the iGEM registry All of our 11 new thermosensors using the following primers as well as the AraF and MglB mutant lactate sensors.
BI239 Prefix GBP,MglB forward ggcgaattcgcggccgcttctagATGAATAAGAAGGTGTTAACCCTG BI240 Suffix GGBP,MglB GGCCTG CAG CGG CCG CTA CTA GTATTATTTCTTGCTGAATTCAGCCAGG BI241 Prefix AraF ggcgaattcgcggccgcttctagATG CAC AAA TTT ACT AAA GCC C
BI242 iGEM suffix AraF reverse GCC CTG CAG CGG CCG CTA CTA GTA TTA CTT ACC GCC TAA ACC TTT TTT C BI243 Prefix TS forward ggcgaattcgcggccgcttctagagTTTAGCGTGACTTTCTTTCAACAGC BI244 suffix TS reverse gccCTG CAG CGG CCG CTA CTA GTATTGAGCGTTCATGTCTCATCC
Sept 18, 2012
Ran all phusion PCR’s on gel…they all look great. Set up EcoRI/PSTI digests (also digest pSB1C3 purified by last years team.
Sept 19, 2012
Digests were run on gel. All digests look great! Cut out bands and ligate .
Sept 20, 2012
Transform all ligations into DH5alpha – remember to select on LB-CAM NOT AMP!!!!
Sept 21, 2012
Need to retransform, no colonies on plates!
Sept 22
Retransformation looks great!
Sept, 24
Clony PCR of all putative clones for registry. Most cloning gave 80% efficiency (see gel). Set up overnights to purify plasmids.
Sept 25
Purify plasmids and submit for sequencing!
