Team:Shenzhen/Result/YAO.Suicider

From 2012.igem.org

(Difference between revisions)
Line 23: Line 23:
<ul><p>DLD3 promoter + Holin +ADH terminator</p></ul>
<ul><p>DLD3 promoter + Holin +ADH terminator</p></ul>
</div>
</div>
 +
<div class="context">
<div class="context">
<div class="context">
<h5>Identification of T7 RNAP Function in Nucleus</h5>
<h5>Identification of T7 RNAP Function in Nucleus</h5>
Line 59: Line 60:
<p>&nbsp;&nbsp;&nbsp;&nbsp;5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour. </p>  
<p>&nbsp;&nbsp;&nbsp;&nbsp;5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour. </p>  
<p>&nbsp;&nbsp;&nbsp;&nbsp;6. 3000rpm/min for 5mins, abandon the supermate, mixing the left. </p>  
<p>&nbsp;&nbsp;&nbsp;&nbsp;6. 3000rpm/min for 5mins, abandon the supermate, mixing the left. </p>  
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;7. 60μl broth spread the Amp anti-LB soli<UL>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;7. 60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight. </p> </ul>
-
<LI>March 12th, 2012 </li>
+
-
<P>Events:</P>
+
-
<P>March 12th. The first iGEM meeting was a very serious one, and there were only 5 members: Kang Chen Zhang Ou and Gong ,respectively.</P>
+
-
<P>We decided to build a list about the whole previous iGEM projects and divided it into five parts: America for Kang and Chen, Europe for Zhang and Ou, Asia for Gong. All of us were in charge of scanning the projects, summarized them and gave the other members a brief description. Each one for one minute.</P>
+
-
</UL>
+
-
<UL>
+
-
<LI>March 15th – April 13th, 2012</li>
+
-
<P>Events:</P>
+
-
<P>Though a recruitment talk with the other classmate in BGI, nearly 20 students and two instructors became members of us. We established a team consisted of eight schools—SCUT, SCNU, SCU, UESTC, WHU, HUST, SEU, UST.</P>
+
-
<P>We continued to sum up the projects from 2008 to 2011, and in the meanwhile, we separated the whole into more parts and assigned to the other members.</P>
+
-
<P>Finally, we finished the summary. </P>
+
-
<P>And we also discussed what we should do, we originally put up with 4 schemes: Schrodinger’s cat—randomly producing 0 and 1; Density sensing application--based on the result of JIandong Wang’s research; Christmas tree—sparks different colors ceaselessly; Yeast artificial organelle—transform mitochondria into a biofactory. The former 3 projects were gave up due to the similarity to the previous iGEM projects. We lay down our consideration on Yeast artificial organelle.</P>
+
-
<P>Chen Yu search more articles about mitochondria transgene and mitochondrial signaling pathways he can and pack it as a file of endnote.</P>
+
-
<P>We clarify our projects as a combination of five modules: NAD+/NADH Sensor, self-killer, post-invader, sel-control transporter and artemisinin producer.</P>
+
-
<P>We divided our group into five parts according to the modules and select two members of each modules to make up two new squads—modeling construction and lab experiments.</P>
+
-
</UL>
+
-
2012/3/7
+
-
MISSION START
+
-
1.
+
-
TEAM BUILDING: OICQ GROUP;
+
-
2.
+
-
ARRANGEMENTS FOR THE FIRST SEMINAR.
+
-
2012/3/8 noon
+
-
THE FIRST SEMINAR:
+
-
1.
+
-
Discussion about our project;
+
-
2.
+
-
Registration for iGEM 2012 and self-introduce.
+
-
2012/3/14
+
-
THE SECOND SEMINAR:
+
-
1.
+
-
Discussion about our project;
+
-
2.
+
-
Task assignment for latter seminar mainly about previous teams’ projects;
+
-
3.
+
-
New member’s introduction.
+
-
2012/3/15
+
-
Group email application succeeded.
+
-
2012/3/17
+
-
Quan ZHOU withdrew from the team.
+
-
2012/3/18
+
-
Jianhui GONG made a list of all projects of iGEM 2008-2011 and assigned each one’s seminar
+
-
task.
+
-
2012/3/19
+
-
THE THIRD SEMINAR:
+
-
1.
+
-
Introduction of new members;
+
-
2.
+
-
Rearrangements for everyone’s task.
+
-
2012/3/22
+
-
THE FOURTH SEMINAR: Introduction of a few projects of iGEM 2008-2011.
+
-
2012/3/26
+
-
THE FIFTH SEMINAR: Introduction of a few projects of iGEM 2008-2011.
+
-
2012/3/29
+
-
THE SIXTH SEMINAR:
+
-
1.
+
-
Introduction of a few projects of iGEM 2008-2011;
+
-
2.
+
-
Introduction of new members;
+
-
3.
+
-
Rearrangements for everyone’s task again.
+
-
2012/4/5
+
-
THE SEVENTH SEMINAR: Introduction of a few projects of iGEM 2008-2011.
+
-
2012/4/7
+
-
TEAM BUILDING ACTIVITY: KTV and dine outside together.
+
-
2012/4/10
+
-
THE EIGTHTH SEMINAR: Each modules and logo designed.</ul></div>d plat, 37℃ inversed culture in incubation overnight. </p> </ul>
+
<ul><p>10. Colony PCR: </p>  
<ul><p>10. Colony PCR: </p>  
<p>&nbsp;&nbsp;&nbsp;&nbsp;dNTPmix(2.5mM)&nbsp;&nbsp;&nbsp;&nbsp;1μl</p>  
<p>&nbsp;&nbsp;&nbsp;&nbsp;dNTPmix(2.5mM)&nbsp;&nbsp;&nbsp;&nbsp;1μl</p>  

Revision as of 10:54, 26 September 2012




Yao.028-001.jpg
Preview for Whole Experiments

    GAL1 promoter + signal peptide to mitochondria + T7 RNAP + ADH terminator (backbone:YEP325)

    T7 promoter + DNase + terminator for mitochondria (under consideration)

    DLD3 promoter + Holin +ADH terminator

Identification of T7 RNAP Function in Nucleus
  • I. Construction of Vector

    1. Bacterial culture (BBa_I712074（T7 poromter，Amp resistant or Kana resistant），E0840（GFP generator，Amp resistant）

    2. Plasmid extraction for BBa_I712074，E0840( Tiangen normal plasmid extraction kits

    3. Measure the concentration of plasmid by NANODROP 2000(Thermo)

    4. Digestion: (enzymes are all from Takara

        BBa_I712074    2-3ug

        PstI    2ul

        SpeI    2ul

        10 x H Buffer    5ul

        ddH2O    50ul

        E0840    2-3ug

        XbaI    2ul

        PstI    2ul

        10 x H Buffer    5ul

        ddH2O    50ul

        37oC    3h

        80 oC     20min

    5. Electrophoresis:

        1% agarose gel, 120V, after 45min,EB dye.

    6. Gel recovery of GAL(EcoRI/SpeI), Holin(XbaI/PstI) (QIAquick Gel recovery kits)

    7. Measure the concentration of fragment of interest by NANODROP 2000(Thermo)

    8. Linage:

        BBa_I712074 （(stI/SpeI)    2ul

        E0840 (PstI/XbaI)    6ul

        T4 ligase    1ul

        T4 ligase Buffer    1ul

        16 oC    3 hours

    9. Transduction:

        1. UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

        2. 10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

        3. 42oC ice-bath heat shock for 50s.

        4. Stewing on ice for 2mins.

        5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

        6. 3000rpm/min for 5mins, abandon the supermate, mixing the left.

        7. 60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

    10. Colony PCR:

        dNTPmix(2.5mM)    1μl

        PCR 10×buffer2μl

        VF    0.5μl

        VR    0.5μl

        Ex Taq    0.5μl

        H2O    15.5μl

        Primer

            VF:    TGCCACCTGACGTCTAAGAA

            VR:    ATTACCGCCTTTGAGTGAGC

        94℃    3min

        94℃    30s

        55℃    30s

        72℃    1min

        72℃    10min

        12℃    ∞

        30 cycles

    11. 1%~1.5% agarose gel electrophoresis, <130V, 40mins.

    12. Sequencing:

        Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector PSB1AK3-T7 poromter+GFP+T7 terminater

  • II. Construction of Yeast Expression Vector

    1. Culture of PSB1AK3-T7 poromter+GFP+T7 terminater （Cmr resistant）gz-YEP352（AmpResistant, we have replaced the URA mark with trp mark）

    2. Plasmid extraction: PSB1AK3-T7 poromter+GFP+T7 terminater，gz-YEP352

    3. Digestion:

        Gz-YEP352    2ug

        XbaI    2ul

        PstI    2ul

        10 x H Buffer    5ul

        ddH2O        50ul

        PSB1AK3-T7 poromter+GFP+T7 terminater    2ug  

        XbaI    2ul

        Pst    2ul

        10 x H Buffer    5ul

        ddH2    50ul

    4. Electrophoresis:

        1% agarose gel, 120V, after 45min,EB dye.

    5. Gel recovery of gz-YEP352 (XbaI /PstI)PSB1AK3-T7 poromter+GFP+T7 terminater (XbaI / PstI) (Qiagen Gel recovery kits)

    6. Lingake:

        Gz-YEP352 (XbaI /PstI)    100ng

        PSB1AK3-T7 poromter+GFP+T7 terminater    100ng

        T4 buffer    1ul

        T4 ligase    1ul

        ddH2O    10ul

        16oC    overnight

    7. Transduction:

        1. UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

        2. 10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

        3. 42oC ice-bath heat shock for 50s.

        4. Stewing on ice for 2mins.

        5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

        6. 3000rpm/min for 5mins, abandon the supermate, mixing the left.

        7. 60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

    8. Clony PCR: <p>    dNTPmix(2.5mM)    1μl

        PCR 10×buffer    2μl

        M13_pUC_fwd_primer    0.5μl

        M13_reverse_primer    0.5μl

        Ex Taq    0.5μl

        H2O    15.5μl

        94℃    3min

        94℃    30s

        55℃    30s

        72℃    1.5min

        72℃    10min

        12℃    ∞

        30 cycles

    9. 1.5% agarose gel electrophoresis, <130V, 40mins.

    10. Sequencing:

        Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector:EP352-GAL1,Holin-ADH1

  • III. Yeast Transformation Experiment:

    1. plasmid extraction.

    2. Preparation  of Competent Yeast Cells - LiAc Method

        1.treak a YPDA agar plate with a small portion of AH109 or Y187. Incubate the plate upside down at 30°C until colonies appear(~3days). Yeast strains can be stored for up to 1 month at 4°C on YPDA medium in culture plates.

        2.Prepare 1.1X TE/LiAc Solution

        3.Prepare YPDA liquid medium (Yeast Protocols Handbook)

        4.Inoculate one colony(<4 weeks old, 2–3mm in diameter) into 3ml of YPDA medium in a sterile, 15-ml   centrifuge tube.

        5.Incubate at 30°C with shaking    for   8hr.

        6.Transfer 5µl of the culture  to a 250-ml flask containing  50ml of YPDA.

        7.Incubate at 30°C with shaking at 230–250 rpm for   16–20hr.The OD600 should reach 0.15–0.3.

        8.Centrifuge the cells at 700 x g for 5min at room temperature.

        9.Discard the supernatant and resuspend the  cell  pellet in 100 ml of YPDA.

        10.Incubate at 30°C for 3–5hr (OD600= 0.4–0.5).

        11.Centrifuge the cells at 700 x g for 5min at room  temperature.

        12.Discard the supernatant and resuspend the cell pellet in 60ml of sterile, deionized H2O.

        13.Centrifuge the cells at 700 x g for 5min at room  temperature.

        14.Discard the supernatant and resuspend the cells in 3 ml of 1.1 X TE/LiAc Solution.

        15.Split the resuspension between two 1.5-ml microcentrifuge tubes (1.5 ml per tube).

        16.Centrifuge each tube at high speed for 15 sec.

        17.Discard the supernatant and resuspend each pellet in 600 µl of 1.1 X TE/LiAc Solution.

    3.Transformation:

        1. Gz-YEP352-T7poromter+GFP+T7terminater 0.2ug

        Sperm DNA*(10 mg/ml) 0.1mg

        Sperm DNA  :when prepared, water-bath boiling for 20mins, then ice-bath, -20°C preservation.

        2. 100 ul dense medium of yeast competent cell by 1×TE/LiAc. Whirlpool oscillation.

        3. 600 ulPEG/LiAc, oscillation strongly, 30°C,200rpm, culture oscillating for 30mins.

        4. Add 70ul DMSO, mixing it slightly and 42oC heat shock by water-bath for 15mins, ice-bath for 1-2mins

        5. Centrifuging for 14,000rpm for 5sec, abandon the supermate, 0.1ml 1x TE suspense the cell precipitation, spread it to SD/ -Ura-trp solid plat, 30°C culture reversely for 3 days.

    6. Holin function identification:

        Pick a SD/ -Ura-trp-cultured colony and inoculate it to 50ml YPDA medium, 30°C,220rpm culture reelingly to OD-0.1, transfer 20ml to 50ml sterile medium (alpha-galactose), versus is added by equivalent water. Measuring the OD value one time for one hour and drawing the curve.

        Result analyzation:

            If the bacteria in alpha-galactose show flurorescence, that shows T7 RNAP/T7 promoter can work.

Protocol: Test of Holin Function
  • I. Construction of Vector (GAL promoter+Holin) in PSB1C3

    1. Plasmid extraction for T-Gal, T-holin

    2. PCR amplification of linear vector PSB1C3, purification(Qiagen PCR purification kits)

    3. Digestion:

        T-GAL1    2ug

        ECoRI2ul

        SpeI    2ul

        10 x H Buffer    5ul

        ddH2O50ul

        T-holin    2ug

        XbaI    2ul

        PstI    2ul

        10 x H    5ul

        ddH2O    50ul

        purified backbone PSB1C3    1ug

        ECoRI    2ul

        PstI    2ul

        10 x H Buffer    5ul

        ddH2O    50ul

        37oC    1h

        80oC    20min

    4. Electrophoresis:

        1% agarose gel, 120V, after 45min,EB dye.

    5. Gel recovery of GAL(EcoRI/SpeI), Holin(XbaI/PstI) (Qiagen Gel recovery kits)

    6. Linage:

        PSB1C3    2ul

        GAL1( ECoRI / SpeI)    100ng

        Holin（ XbaI/PstI)    100ng

        T4 buffer    1ul

        T4 ligase    1ul

        ddH2O    10ul

        16 oC    overnight

    7. Transduction:

        1. UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

        2. 10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

        3. 42oC ice-bath heat shock for 50s.

        4. Stewing on ice for 2mins.

        5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

        6. 3000rpm/min for 5mins, abandon the supermate, mixing the left.

        7. 60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

    8.Colony PCR:

        dNTPmix(2.5mM)    1μl

        PCR 10×buffer    2μl

        VF    0.5μl

        VR    0.5μl

        Ex Taq    0.5μl

        H2O    15.5μl

        Primer    

            VF: TGCCACCTGACGTCTAAGAA

            VR:ATTACCGCCTTTGAGTGAGC

        94℃    3min

        94℃    30s

        55℃    30s

        72℃    1min

        72℃    10min

        12℃    ∞

        30 cycles

    9. 1%~1.5% agarose gel electrophoresis, <130V, 40mins.

    10. Sequencing:

        Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector PSB1C3-GAL

  • II. Construction of vector(GAL promoter+holing) in PSB1C3

    1. Plasmid extraction: BBa-J63002(ADH terminator）, PSB1C3-GAL1-Holin.

    2. Digestion:

        BBa-J63002     2ug    

        XbaI     2ul    

        PstI     2ul        

        10 x H Buffer    5ul    

        ddH2O    50ul    

        37oC    1h        

        PSB1C3-GAL1-Holin    2ug

        SpeI    2ul

        PstI    2ul

        10 x H Buffer    5ul     <p>    ddH2O    50ul

        80oC    20min

    3. Electrophoresis:

        1% agarose gel, 120V, after 45min,EB dye.

    4. Gel recovery of BBa-J63002 (XbaI /PstI),PSB1C3-GAL1-Holin(SpeI/ PstI) (Qiagen Gel recovery kits)

    5. Linkage:

        PSB1C3-GAL1-Holin(SpeI/ PstI)    100ng

        BBa-J63002 (XbaI /PstI)    100ng

        T4 buffer    1ul

        T4 ligase    1ul

        ddH2O    10ul

        16 oC overnight

    6. Transduction:

        1. UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

        2. 10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

        3. 42oC ice-bath heat shock for 50s.

        4. Stewing on ice for 2mins.

        5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

        6. 3000rpm/min for 5mins, abandon the supermate, mixing the left.

        7. 60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

    7. Colony PCR:

        dNTPmix(2.5mM)v1μl

        PCR 10×buffer    2μl

        VF    0.5μl

        VR    0.5μl

        Ex Taq    0.5μl

        H2O    15.5μl

        Primer

            VF: TGCCACCTGACGTCTAAGAA

            VR: ATTACCGCCTTTGAGTGAGC

        94℃    3min

        94℃    30s

        55℃    30s    

        72℃    1.5min

        72℃    10min

        12℃    ∞

        30 cycles

    8. 1%~1.5% agarose gel electrophoresis, $lt;130V, 40mins.

    9. Sequencing:

        Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector PSB1C3-GAL1, Holin-ADH1

  • III. Construction of Yeast Expression Vector

    1. Culture of PSB1C3-GAL1-Holin-ADH1 (Cmr resistant) YEP352 (AmpResistant)

    2. Plasmid extraction: PSB1C3-GAL1-Holin-ADH1，YEP352

    3. Digestion:

        YEP352    2ug

        XbaI    2ul

        PstI    2ul

        10 x H    5ul

        ddH2O    50ul

        PSB1C3-GAL1-Holin-ADH1    2ug

        XbaI    2ul

        PstI    2ul

        10 x H Buffer    5ul

        ddH2O    50ul

    4. Electrophoresis:

        1% agarose gel, 120V, after 45min,EB dye.

    5. Gel recovery of YEP352 (XbaI /PstI),PSB1C3-GAL1-Holin-ADH1(XbaI / PstI) (Qiagen Gel recovery kits)

    6. Lingake:

        YEP352 (XbaI /PstI)    100ng

        PSB1C3-GAL1-Holin-ADH1(XbaI / PstI)    100ng

        T4 buffer    1ul

         T4 ligase    1ul

        ddH2O    10ul

        16oC overnight

    7. Transduction:

    1.    UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

    2.    10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

    3.    42oC ice-bath heat shock for 50s.

    4.    Stewing on ice for 2mins.

    5.    Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

    6.    3000rpm/min for 5mins, abandon the supermate, mixing the left.

    7.    60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

    8. Clony PCR: <p>    dNTPmix(2.5mM)    1μl

        PCR 10×buffer    2μl

        M13_pUC_fwd_primer    0.5μl

        M13_reverse_primer    0.5μl

        Ex Taq    0.5μl

        H2O    15.5μl

        94℃    3min

        94℃    30s

        55℃    30s

        72℃    1.5min

        72℃    10min

        12℃    ∞

        30 cycles

      9. 1.5% agarose gel electrophoresis, <130V, 40mins.

      10. Sequencing:

          Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector:EP352-GAL1, Holin-ADH1

  • IV. Yeast transformation experiment:

      • 1. plasmid extraction.

      2. Preparation of Competent Yeast Cells—LiAc Method

        1.treak a YPDA agar plate with a small portion of AH109 or Y187. Incubate the plate upside down at 30°C until colonies appear(~3days). Yeast strains can be stored for up to 1 month at 4°C on YPDA medium in culture plates

        2.Prepare 1.1X TE/LiAc Solution

        3.Prepare YPDA liquid medium     (Yeast Protocols Handbook)

        4.Inoculate one colony (<4 weeks old, 2–3mm in diameter) into 3ml of YPDA medium in a sterile, 15-ml centrifuge tube.

        5.Incubate at 30°C with shaking

        6.Transfer 5µl of the culture to a 250-ml flask containing 50ml of YPDA.

        7.Incubate at 30°C with shaking at 230–250 rpm for 16–20hr.The OD600 should reach 0.15–0.3.

        8.Centrifuge the cells at 700 x g for 5min at room temperature.

        9.Discard the supernatant and resuspend the cell pellet in 100 ml of YPDA.

        10.Incubate at 30°C for 3–5hr     (OD600= 0.4–0.5).

        11.Centrifuge the cells at 700 x g for 5min at room temperature.

        12.Discard the supernatant and resuspend the cell pellet in 60ml of sterile, deionized H2O.

        13.Centrifuge the cells at 700 x g for 5min at room temperature.

        14.Discard the supernatant and resuspend the cells in 3ml of 1.1 X TE/LiAc Solution.

        15.Split the resuspension between two 1.5-ml microcentrifuge tubes (1.5 ml per tube).

        16.Centrifuge each tube at high speed for 15     sec.

        17.Discard the supernatant and resuspend each pellet in 600µl of 1.1 X TE/LiAc Solution.

    3.Transformation:

        1. plasmid    0.2ug

            Sperm DNA*(10 mg/ml)    0.1mg

            *Sperm DNA: when prepared, water-bath boiling for 20mins, then ice-bath, -20°C preservation.

        2. 100 ul dense medium of yeast competent cell by 1×TE/LiAc. Whirlpool oscillation.

        3. 600 ulPEG/LiAc, oscillation strongly, 30°C,200rpm, culture oscillating for 30mins.

        5. Centrifuging for 14,000rpm for 5sec, abandon the supermate, 0.1ml 1x TE suspense the cell precipitation, spread it to SD/Ura solid plat, 30°C culture reversely for 3 days.

        6. Holin function identification:

            Pick a better-cultured colony and inoculate it to 50ml YPDA medium, 30°C,220rpm culture reelingly to OD-0.1, transfer 20ml to 50ml sterile medium (alpha-galactose), versus is         added by equivalent water. Measuring the OD value one time for one hour and drawing the curve.

            Result analyzation:

            If the bacteria in alpha-galactose grow slower that in water, that shows holing can work.


Retrieved from "http://2012.igem.org/Team:Shenzhen/Result/YAO.Suicider"