Team:Shenzhen/Result/YAO.Suicider

From 2012.igem.org

(Difference between revisions)
Line 136: Line 136:
<ul><p>2. Plasmid extraction: PSB1C3-GAL1-Holin-ADH1，YEP352</p></ul>
<ul><p>2. Plasmid extraction: PSB1C3-GAL1-Holin-ADH1，YEP352</p></ul>
<ul><p>3. Digestion: </p>
<ul><p>3. Digestion: </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; YEP352&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  2ug&nbsp;&nbsp;&nbsp;&nbsp;  </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;YEP352&nbsp;&nbsp;&nbsp;&nbsp;2ug</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  XbaI&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  2ul&nbsp;&nbsp;&nbsp;&nbsp;  </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;XbaI&nbsp;&nbsp;&nbsp;&nbsp;2ul</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  PstI&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 2ul&nbsp;&nbsp;&nbsp;&nbsp;  </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;PstI&nbsp;&nbsp;&nbsp;&nbsp;2ul</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  10 x H Buffer&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;5ul&nbsp;&nbsp;&nbsp;&nbsp;</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;10 x H&nbsp;&nbsp;&nbsp;&nbsp;5ul</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  ddH2O&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;   50ul&nbsp;&nbsp;&nbsp;&nbsp; </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;ddH2O&nbsp;&nbsp;&nbsp;&nbsp;50ul</p>
-
<p>PSB1C3-GAL1-Holin-ADH1  2ug  </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;PSB1C3-GAL1-Holin-ADH1&nbsp;&nbsp;&nbsp;&nbsp;2ug  </p>
-
<p>XbaI&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2ul </p>  
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;XbaI&nbsp;&nbsp;&nbsp;&nbsp;2ul </p>  
-
<p>PstI&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  2ul</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;PstI&nbsp;&nbsp;&nbsp;&nbsp;2ul</p>
-
<p>10 x H Buffer&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5ul&nbsp;&nbsp;&nbsp;&nbsp; </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;10 x H Buffer&nbsp;&nbsp;&nbsp;&nbsp;5ul</p>
-
<p>ddH2O&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 50ul</p></ul>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;ddH2O&nbsp;&nbsp;&nbsp;&nbsp;50ul</p></ul>
<ul><p>4. Electrophoresis: </p>
<ul><p>4. Electrophoresis: </p>
-
<p>1% agarose gel, 120V, after 45min,EB dye. </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;1% agarose gel, 120V, after 45min,EB dye. </p>
<ul><p>5. Gel recovery of YEP352 (XbaI /PstI),PSB1C3-GAL1-Holin-ADH1(XbaI / PstI) (Qiagen Gel recovery kits)</p></ul>
<ul><p>5. Gel recovery of YEP352 (XbaI /PstI),PSB1C3-GAL1-Holin-ADH1(XbaI / PstI) (Qiagen Gel recovery kits)</p></ul>
<ul><p>6. Lingake: </p>
<ul><p>6. Lingake: </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;YEP352 (XbaI /PstI)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;100ng</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;YEP352 (XbaI /PstI)&nbsp;&nbsp;&nbsp;&nbsp;100ng</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;PSB1C3-GAL1-Holin-ADH1(XbaI / PstI)   100ng</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;PSB1C3-GAL1-Holin-ADH1(XbaI / PstI)&nbsp;&nbsp;&nbsp;&nbsp;100ng</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; T4  buffer&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 1ul</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;T4  buffer&nbsp;&nbsp;&nbsp;&nbsp;1ul</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; T4 ligase&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  1ul</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp; T4 ligase&nbsp;&nbsp;&nbsp;&nbsp;1ul</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ddH2O&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;10ul</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;ddH2O&nbsp;&nbsp;&nbsp;&nbsp;10ul</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 16oC&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  overnight</p></ul>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;16oC overnight</p></ul>
<ul><p>7. Transduction: </p>
<ul><p>7. Transduction: </p>
-
<p>1.&nbsp;&nbsp;&nbsp;&nbsp; UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath. </p>
+
<p>1.&nbsp;&nbsp;&nbsp;&nbsp;UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath. </p>
-
<p>2.&nbsp;&nbsp;&nbsp;&nbsp; 10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins. </p>
+
<p>2.&nbsp;&nbsp;&nbsp;&nbsp;10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins. </p>
-
<p>3.&nbsp;&nbsp;&nbsp;&nbsp; 42oC ice-bath heat shock for 50s. </p>
+
<p>3.&nbsp;&nbsp;&nbsp;&nbsp;42oC ice-bath heat shock for 50s. </p>
-
<p>4.&nbsp;&nbsp;&nbsp;&nbsp; Stewing on ice for 2mins. </p>
+
<p>4.&nbsp;&nbsp;&nbsp;&nbsp;Stewing on ice for 2mins. </p>
-
<p>5.&nbsp;&nbsp;&nbsp;&nbsp; Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour. </p>
+
<p>5.&nbsp;&nbsp;&nbsp;&nbsp;Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour. </p>
-
<p>6.&nbsp;&nbsp;&nbsp;&nbsp; 3000rpm/min for 5mins, abandon the supermate, mixing the left. </p>
+
<p>6.&nbsp;&nbsp;&nbsp;&nbsp;3000rpm/min for 5mins, abandon the supermate, mixing the left. </p>
-
<p>7.&nbsp;&nbsp;&nbsp;&nbsp; 60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight. </p></ul>
+
<p>7.&nbsp;&nbsp;&nbsp;&nbsp;60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight. </p></ul>
<ul><p>8. Clony PCR:
<ul><p>8. Clony PCR:
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  dNTPmix(2.5mM)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  1μl</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;dNTPmix(2.5mM)&nbsp;&nbsp;&nbsp;&nbsp;1μl</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  PCR 10×buffer&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2μl</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;PCR 10×buffer&nbsp;&nbsp;&nbsp;&nbsp;2μl</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  M13_pUC_fwd_primer  0.5μl</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;M13_pUC_fwd_primer&nbsp;&nbsp;&nbsp;&nbsp;0.5μl</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  M13_reverse_primer&nbsp;&nbsp;&nbsp;&nbsp;   0.5μl</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;M13_reverse_primer&nbsp;&nbsp;&nbsp;&nbsp;0.5μl</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  Ex Taq&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;0.5μl</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;Ex Taq&nbsp;&nbsp;&nbsp;&nbsp;0.5μl</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  H2O&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  15.5μl</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;H2O&nbsp;&nbsp;&nbsp;&nbsp;15.5μl</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  94℃&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 3min</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;94℃&nbsp;&nbsp;&nbsp;&nbsp;3min</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  94℃&nbsp;&nbsp;&nbsp;&nbsp; 30s</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;94℃&nbsp;&nbsp;&nbsp;&nbsp;30s</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  55℃&nbsp;&nbsp;&nbsp;&nbsp; 30s </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;55℃&nbsp;&nbsp;&nbsp;&nbsp;30s </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  72℃&nbsp;&nbsp;&nbsp;&nbsp; 1.5min</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;72℃&nbsp;&nbsp;&nbsp;&nbsp;1.5min</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  72℃&nbsp;&nbsp;&nbsp;&nbsp; 10min</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;72℃&nbsp;&nbsp;&nbsp;&nbsp;10min</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;  12℃&nbsp;&nbsp;&nbsp;&nbsp; ∞</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;12℃&nbsp;&nbsp;&nbsp;&nbsp;∞</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;30 cycles</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;0 cycles</p>
<ul><p>9. 1.5% agarose gel electrophoresis, <130V, 40mins. </p></ul>
<ul><p>9. 1.5% agarose gel electrophoresis, <130V, 40mins. </p></ul>
<ul><p>10. Sequencing: </p>
<ul><p>10. Sequencing: </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector:EP352-GAL1, </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector:EP352-GAL1, Holin-ADH1</p></ul>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Holin-ADH1</p></ul>
+
<li>IV. Yeast transformation experiment: </li>
<li>IV. Yeast transformation experiment: </li>
<ul><p>1. plasmid extraction. </p></ul>
<ul><p>1. plasmid extraction. </p></ul>
<ul><p>2. Preparation  of Competent Yeast Cells—LiAc Method</p></ul>
<ul><p>2. Preparation  of Competent Yeast Cells—LiAc Method</p></ul>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.treak a YPDA  agar plate with&nbsp;&nbsp;&nbsp;&nbsp;  a small  portion of&nbsp;&nbsp;&nbsp;&nbsp;  AH109 or Y187.   Incubate  the   plate upside down at 30°C until colonies appear(~3days).&nbsp;&nbsp;&nbsp;&nbsp;  Yeast strains can be stored   for up to 1 month at&nbsp;&nbsp;&nbsp;&nbsp;  4°C on&nbsp;&nbsp;&nbsp;&nbsp;YPDA   medium   in culture plates&nbsp;&nbsp;&nbsp;&nbsp;  </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;1.treak a YPDA  agar plate with a small  portion of AH109 or Y187. Incubate  the plate upside down at 30°C until colonies appear(~3days). Yeast strains can be stored for up to 1 month at 4°C on YPDA medium in culture plates</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.Prepare 1.1X&nbsp;&nbsp;&nbsp;&nbsp;  TE/LiAc Solution </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;2.Prepare 1.1X TE/LiAc Solution </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;3.Prepare YPDA  liquid medium&nbsp;&nbsp;&nbsp;&nbsp;  (Yeast  Protocols  Handbook) </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;3.Prepare YPDA  liquid medium&nbsp;&nbsp;&nbsp;&nbsp;  (Yeast  Protocols  Handbook) </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;4.Inoculate one colony(<4 weeks old,   2–3mm   in diameter) into 3ml of YPDA   medium   in a sterile, 15-ml  centrifuge tube. </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;4.Inoculate one colony (&lt;4 weeks old, 2–3mm in diameter) into 3ml of YPDA medium in a sterile, 15-ml  centrifuge tube. </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;5.Incubate at 30°C with shaking&nbsp;&nbsp;&nbsp;&nbsp;for  8hr. </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;5.Incubate at 30°C with shaking</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;6.Transfer 5µl of the culture  to a 250-ml flask containing 50ml of YPDA. </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;6.Transfer 5µl of the culture  to a 250-ml flask containing 50ml of YPDA. </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;7.Incubate at 30°C with shaking at 230–250 rpm for   16–20hr.The OD600 should reach 0.15–0.3. </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;7.Incubate at 30°C with shaking at 230–250 rpm for 16–20hr.The OD600 should reach 0.15–0.3. </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;8.Centrifuge the cells at 700 x g for 5min at&nbsp;&nbsp;&nbsp;&nbsp;  room temperature. </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;8.Centrifuge the cells at 700 x g for 5min at room temperature. </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;9.Discard the supernatant and resuspend the  cell  pellet in 100 ml of YPDA. </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;9.Discard the supernatant and resuspend the  cell  pellet in 100 ml of YPDA. </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;10.Incubate at 30°C for 3–5hr&nbsp;&nbsp;&nbsp;&nbsp;  (OD600= 0.4–0.5). </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;10.Incubate at 30°C for 3–5hr&nbsp;&nbsp;&nbsp;&nbsp;  (OD600= 0.4–0.5). </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;11.Centrifuge  the cells at 700 x g for   5min at room  temperature. </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;11.Centrifuge  the cells at 700 x g for 5min at room  temperature. </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;12.Discard the supernatant and resuspend the cell pellet in 60ml of sterile, deionized H2O. </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;12.Discard the supernatant and resuspend the cell pellet in 60ml of sterile, deionized H2O. </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;13.Centrifuge  the cells at 700 x g for   5min at room  temperature. </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;13.Centrifuge  the cells at 700 x g for 5min at room  temperature. </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;14.Discard the supernatant and resuspend the cells in 3&nbsp;&nbsp;&nbsp;&nbsp;  ml of 1.1 X TE/LiAc Solution. </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;14.Discard the supernatant and resuspend the cells in 3ml of 1.1 X TE/LiAc Solution. </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;15.Split the resuspension between two  1.5-ml microcentrifuge tubes (1.5 ml   per   tube). </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;15.Split the resuspension between two  1.5-ml microcentrifuge tubes (1.5 ml per tube). </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;16.Centrifuge  each tube at high speed for 15&nbsp;&nbsp;&nbsp;&nbsp;  sec. </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;16.Centrifuge  each tube at high speed for 15&nbsp;&nbsp;&nbsp;&nbsp;  sec. </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;17.Discard the supernatant and resuspend each pellet in 600&nbsp;&nbsp;&nbsp;&nbsp;  µl of&nbsp;&nbsp;&nbsp;&nbsp;  1.1 X TE/LiAc   Solution. </p></ul>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;17.Discard the supernatant and resuspend each pellet in 600µl of 1.1 X TE/LiAc Solution. </p></ul>
<ul><p>3.Transformation: </p>
<ul><p>3.Transformation: </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;1. plasmid&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 0.2ug</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;1. plasmid&nbsp;&nbsp;&nbsp;&nbsp;0.2ug</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Sperm DNA*(10 mg/ml)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 0.1mg</p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Sperm DNA*(10 mg/ml)&nbsp;&nbsp;&nbsp;&nbsp;0.1mg</p>
-
<p> Sperm DNA :when prepared, water-bath boiling for 20mins, then ice-bath, -20°C preservation. </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;*Sperm DNA: when prepared, water-bath boiling for 20mins, then ice-bath, -20°C preservation. </p>
<p>&nbsp;&nbsp;&nbsp;&nbsp;2. 100 ul dense medium of yeast competent cell by 1×TE/LiAc. Whirlpool oscillation. </p>
<p>&nbsp;&nbsp;&nbsp;&nbsp;2. 100 ul dense medium of yeast competent cell by 1×TE/LiAc. Whirlpool oscillation. </p>
<p>&nbsp;&nbsp;&nbsp;&nbsp;3. 600 ulPEG/LiAc, oscillation strongly, 30°C,200rpm, culture oscillating for 30mins. </p>
<p>&nbsp;&nbsp;&nbsp;&nbsp;3. 600 ulPEG/LiAc, oscillation strongly, 30°C,200rpm, culture oscillating for 30mins. </p>
<p>&nbsp;&nbsp;&nbsp;&nbsp;5. Centrifuging for 14,000rpm for 5sec, abandon the supermate, 0.1ml 1x TE suspense the cell precipitation, spread it to SD/Ura solid plat, 30°C culture reversely for 3 days. </p>
<p>&nbsp;&nbsp;&nbsp;&nbsp;5. Centrifuging for 14,000rpm for 5sec, abandon the supermate, 0.1ml 1x TE suspense the cell precipitation, spread it to SD/Ura solid plat, 30°C culture reversely for 3 days. </p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;6. Holin function identification: </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;6. Holin function identification: </p>
-
<p>Pick a better-cultured colony and inoculate it to 50ml YPDA medium, 30°C,220rpm culture reelingly to OD-0.1, transfer 20ml to 50ml sterile medium (alpha-galactose), versus is&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; added  by equivalent water. Measuring the OD value one time for one hour and drawing the curve. </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;Pick a better-cultured colony and inoculate it to 50ml YPDA medium, 30°C,220rpm culture reelingly to OD-0.1, transfer 20ml to 50ml sterile medium (alpha-galactose), versus is&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; added  by equivalent water. Measuring the OD value one time for one hour and drawing the curve. </p>
-
<p>Result analyzation: </p>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;Result analyzation: </p>
-
<p>If the bacteria in alpha-galactose grow slower that in water, that shows holing can work. </p></ul>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;If the bacteria in alpha-galactose grow slower that in water, that shows holing can work. </p></ul>
</div>
</div>
</div>
</div>
{{:Team:Shenzhen/Temp/gallery.htm}}
{{:Team:Shenzhen/Temp/gallery.htm}}

Revision as of 15:27, 25 September 2012




Yao.028-001.jpg
Protocol: Test of Holin Function
  • I. Construction of Vector (GAL promoter+Holin) in PSB1C3</li>

      1. Plasmid extraction for T-Gal, T-holin

      2. PCR amplification of linear vector PSB1C3, purification(Qiagen PCR purification kits)

      3. Digestion:

          T-GAL1    2ug

          ECoRI2ul

          SpeI    2ul

          10 x H Buffer    5ul

          ddH2O50ul

          T-holin    2ug

          XbaI    2ul

          PstI    2ul

          10 x H    5ul

          ddH2O    50ul

          purified backbone PSB1C3    1ug

          ECoRI    2ul

          PstI    2ul

          10 x H Buffer    5ul

          ddH2O    50ul

          37oC    1h

          80oC    20min

      4. Electrophoresis:

          1% agarose gel, 120V, after 45min,EB dye.

      5. Gel recovery of GAL(EcoRI/SpeI), Holin(XbaI/PstI) (Qiagen Gel recovery kits)

      6. Linage:

          PSB1C3    2ul

          GAL1( ECoRI / SpeI)    100ng

          Holin（ XbaI/PstI)    100ng

          T4 buffer    1ul

          T4 ligase    1ul

          ddH2O    10ul

          16 oC    overnight

      7. Transduction:

          1. UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

          2. 10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

          3. 42oC ice-bath heat shock for 50s.

          4. Stewing on ice for 2mins.

          5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

          6. 3000rpm/min for 5mins, abandon the supermate, mixing the left.

          7. 60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

      8.Colony PCR:

          dNTPmix(2.5mM)    1μl

          PCR 10×buffer    2μl

          VF    0.5μl

          VR    0.5μl

          Ex Taq    0.5μl

          H2O    15.5μl

          Primer    

              VF: TGCCACCTGACGTCTAAGAA

              VR:ATTACCGCCTTTGAGTGAGC

          94℃    3min

          94℃    30s

          55℃    30s

          72℃    1min

          72℃    10min

          12℃    ∞

          30 cycles

      9. 1%~1.5% agarose gel electrophoresis, <130V, 40mins.

      10. Sequencing:

          Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector PSB1C3-GAL

  • II. Construction of vector(GAL promoter+holing) in PSB1C3</li>

      1. Plasmid extraction: BBa-J63002(ADH terminator）, PSB1C3-GAL1-Holin.

      2. Digestion:

          BBa-J63002     2ug    

          XbaI     2ul    

          PstI     2ul        

          10 x H Buffer    5ul    

          ddH2O    50ul    

          37oC    1h        

          PSB1C3-GAL1-Holin    2ug

          SpeI    2ul

          PstI    2ul

          10 x H Buffer    5ul     <p>    ddH2O    50ul

          80oC    20min

      3. Electrophoresis:

          1% agarose gel, 120V, after 45min,EB dye.

      4. Gel recovery of BBa-J63002 (XbaI /PstI),PSB1C3-GAL1-Holin(SpeI/ PstI) (Qiagen Gel recovery kits)

      5. Linkage:

          PSB1C3-GAL1-Holin(SpeI/ PstI)    100ng

          BBa-J63002 (XbaI /PstI)    100ng

          T4 buffer    1ul

          T4 ligase    1ul

          ddH2O    10ul

          16 oC overnight

      6. Transduction:

          1. UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

          2. 10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

          3. 42oC ice-bath heat shock for 50s.

          4. Stewing on ice for 2mins.

          5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

          6. 3000rpm/min for 5mins, abandon the supermate, mixing the left.

          7. 60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

      7. Colony PCR:

          dNTPmix(2.5mM)v1μl

          PCR 10×buffer    2μl

          VF    0.5μl

          VR    0.5μl

          Ex Taq    0.5μl

          H2O    15.5μl

          Primer

              VF: TGCCACCTGACGTCTAAGAA

              VR: ATTACCGCCTTTGAGTGAGC

          94℃    3min

          94℃    30s

          55℃    30s     <p>    72℃    1.5min

          72℃    10min

          12℃    ∞

          30 cycles

        8. 1%~1.5% agarose gel electrophoresis, <130V, 40mins.

        9. Sequencing:

            Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector PSB1C3-GAL1, Holin-ADH1

    • III. Construction of Yeast Expression Vector

        • 1. Culture of PSB1C3-GAL1-Holin-ADH1 (Cmr resistant) YEP352 (AmpResistant)

        2. Plasmid extraction: PSB1C3-GAL1-Holin-ADH1，YEP352

        3. Digestion:

            YEP352    2ug

            XbaI    2ul

            PstI    2ul

            10 x H    5ul

            ddH2O    50ul

            PSB1C3-GAL1-Holin-ADH1    2ug

            XbaI    2ul

            PstI    2ul

            10 x H Buffer    5ul

            ddH2O    50ul

        4. Electrophoresis:

            1% agarose gel, 120V, after 45min,EB dye.

          5. Gel recovery of YEP352 (XbaI /PstI),PSB1C3-GAL1-Holin-ADH1(XbaI / PstI) (Qiagen Gel recovery kits)

          6. Lingake:

              YEP352 (XbaI /PstI)    100ng

              PSB1C3-GAL1-Holin-ADH1(XbaI / PstI)    100ng

              T4 buffer    1ul

               T4 ligase    1ul

              ddH2O    10ul

              16oC overnight

          7. Transduction:

          1.    UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

          2.    10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

          3.    42oC ice-bath heat shock for 50s.

          4.    Stewing on ice for 2mins.

          5.    Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

          6.    3000rpm/min for 5mins, abandon the supermate, mixing the left.

          7.    60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

          8. Clony PCR: <p>    dNTPmix(2.5mM)    1μl

              PCR 10×buffer    2μl

              M13_pUC_fwd_primer    0.5μl

              M13_reverse_primer    0.5μl

              Ex Taq    0.5μl

              H2O    15.5μl

              94℃    3min

              94℃    30s

              55℃    30s

              72℃    1.5min

              72℃    10min

              12℃    ∞

              0 cycles

            9. 1.5% agarose gel electrophoresis, <130V, 40mins.

            10. Sequencing:

                Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector:EP352-GAL1, Holin-ADH1

        • IV. Yeast transformation experiment:

            • 1. plasmid extraction.

            2. Preparation of Competent Yeast Cells—LiAc Method

              1.treak a YPDA agar plate with a small portion of AH109 or Y187. Incubate the plate upside down at 30°C until colonies appear(~3days). Yeast strains can be stored for up to 1 month at 4°C on YPDA medium in culture plates

              2.Prepare 1.1X TE/LiAc Solution

              3.Prepare YPDA liquid medium     (Yeast Protocols Handbook)

              4.Inoculate one colony (<4 weeks old, 2–3mm in diameter) into 3ml of YPDA medium in a sterile, 15-ml centrifuge tube.

              5.Incubate at 30°C with shaking

              6.Transfer 5µl of the culture to a 250-ml flask containing 50ml of YPDA.

              7.Incubate at 30°C with shaking at 230–250 rpm for 16–20hr.The OD600 should reach 0.15–0.3.

              8.Centrifuge the cells at 700 x g for 5min at room temperature.

              9.Discard the supernatant and resuspend the cell pellet in 100 ml of YPDA.

              10.Incubate at 30°C for 3–5hr     (OD600= 0.4–0.5).

              11.Centrifuge the cells at 700 x g for 5min at room temperature.

              12.Discard the supernatant and resuspend the cell pellet in 60ml of sterile, deionized H2O.

              13.Centrifuge the cells at 700 x g for 5min at room temperature.

              14.Discard the supernatant and resuspend the cells in 3ml of 1.1 X TE/LiAc Solution.

              15.Split the resuspension between two 1.5-ml microcentrifuge tubes (1.5 ml per tube).

              16.Centrifuge each tube at high speed for 15     sec.

              17.Discard the supernatant and resuspend each pellet in 600µl of 1.1 X TE/LiAc Solution.

          3.Transformation:

              1. plasmid    0.2ug

                  Sperm DNA*(10 mg/ml)    0.1mg

                  *Sperm DNA: when prepared, water-bath boiling for 20mins, then ice-bath, -20°C preservation.

              2. 100 ul dense medium of yeast competent cell by 1×TE/LiAc. Whirlpool oscillation.

              3. 600 ulPEG/LiAc, oscillation strongly, 30°C,200rpm, culture oscillating for 30mins.

              5. Centrifuging for 14,000rpm for 5sec, abandon the supermate, 0.1ml 1x TE suspense the cell precipitation, spread it to SD/Ura solid plat, 30°C culture reversely for 3 days.

              6. Holin function identification:

              Pick a better-cultured colony and inoculate it to 50ml YPDA medium, 30°C,220rpm culture reelingly to OD-0.1, transfer 20ml to 50ml sterile medium (alpha-galactose), versus is         added by equivalent water. Measuring the OD value one time for one hour and drawing the curve.

              Result analyzation:

                  If the bacteria in alpha-galactose grow slower that in water, that shows holing can work.

        </div> </div>


    • Retrieved from "http://2012.igem.org/Team:Shenzhen/Result/YAO.Suicider"