Team:Shenzhen/Result/YAO.Channel

Construction of a Signal Peptide System

    Signal peptides are the tools we use to assemble YAO. Channel-Toc and Tic proteins, and to guide the protein into YAO matrix through YAO. Channel. We have designed several Signal Peptide BioBricks (shown in http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2012&group=Shenzhen).

    In total, there are 6 types of signal peptide involved in our project: signal peptide (SP) of Zim17, SP of ferredoxi, SP of Tim21, SP of Tom40, SP of Tom70, SP of Tom22.

• 1. SP of Zim17

     Zim17 is a zinc finger protein located in mitochondrial matrix. The signal peptide of Zim17 is amino-terminal segments rich in positively charged residues that form two to three turns of a helix with amphipathic character, and it directs the proteins imported into mitochondrial matrix. The sequence can be found at http://www.uniprot.org/blast/?about=P42844[1-47]. We synthesized the sequence and linked it with RFP & YFP.

The document we mainly refer to is:

Burri L, Vascotto K, Fredersdorf S, Tiedt R, Hall MN, Lithgow T. Zim17, a novel zinc finger protein essential for protein import into mitochondria. J. Biol. Chem. 2004;279:50243-50249.

• 2. SP of ferredoxi

     The signal peptide of ferredoxi, as a chloroplast-target transit peptide, has an α helix at its N-terminus, followed by an unstructured C-terminal domain of ~19 amino acids. The sequence can be found at http://www.uniprot.org/blast/?about=P07839%5b1-32%5d. We synthesized the sequence and linked it with RFP & YFP.

The document we mainly refer to is:

Bruce, B. D. (2000). "Chloroplast transit peptides: structure, function and evolution." Trends in Cell Biology 10(10): 440-447.

• 3. SP of Tim21

     Tim21 is one component of the translocase of the inner mitochondrial membrane (TIM complex), and the signal peptide of Tim21 contains 239 amino acids with a N-terminally single transmembrane segment showing the characteristics of a positively charged mitochondrial presequence with a predicted cleavage site after residue 42. The sequence can be found at http://www.uniprot.org/blast/?about=P53220[1-70]. We synthesized the sequence and linked it with RFP & YFP.

The document we mainly refer to is:

Chacinska, A., M. Lind, et al. (2005). "Mitochondrial Presequence Translocase: Switching between TOM Tethering and Motor Recruitment Involves Tim21 and Tim17." Cell 120(6): 817-829.

• 4. SP of Tom40

     Tom40 is the core component of the translocase of the outer mitochondrial membrane (TOM complex), presenting an β-barrel structure. The signal peptide of Tom40 is a conserved β-signal motif, located near the C-terminus, The sequence can be found in the document BMC Genomics, 12, 79. We synthesized the sequence and linked it with RFP & YFP.

The document we mainly refer to is:

Imai, K., Fujita, N., Gromiha, M.M. and Horton, P. (2011) Eukaryote-wide sequence analysis of mitochondrial beta-barrel outer membrane proteins. BMC Genomics, 12, 79.

• 5. SP of Tom70

     Tom70 is also one component of TOM complex, but only contain a single transmembrane segment at their N terminus. The signal peptide of Tom70 is the transmembrane domain comprising a hydrophilic, positively charged segment. The sequence can be found in http://www.uniprot.org/blast/?about=P07213[11-30]. We synthesized the sequence and linked it with RFP & YFP.

The document we mainly refer to is:

Rapaport, D. (2003). "Finding the right organelle." EMBO Rep 4(10): 948-952.

• 6. SP of Tom22

     Tom22 is similar with Tom70, but it’s a tail-anchored protein. The signal peptide of Tom22 is also similar with the one of Tom70: moderately hydrophobic, relatively short, with positive charges at the flanking regions. The sequence can be found in http://www.uniprot.org/blast/?about=P49334[98-119]. We synthesized the sequence and linked it with RFP & YFP.

The document we mainly refer to is:

Plant Physiology July 2000 vol. 123 no. 3 811-816.

Signal Peptides Validation Protocol

• Purpose

Verify that the mitochondrial signal peptides can lead peptides into the mitochondria, or onto the mitochondrial membrane, while the chloroplast signal peptides can not.

• Materials

GFP, Signal peptides (ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40), yeast strain.

• Methods
• I. First Vector Construction

1. Synthesis of ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40.

2. The synthetic fragments are connected with PUC57 the carrier. Mix the strain which containing the carrier and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight.

3. Mix other two strains( BBa-E0030, BBa-E1010 containing biobrick) and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight.

4. Extract plasmid ( ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40, BBa-E0030, BBa-E1010).

5. Use NANODROP 2000 from Thermo Co. to measure plasmid concentration.

6. Digest:

     ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40 2-3ug respectively.

     ECoRI 2ul

     SpeI 2ul

     10 x H Buffer 5ul

     ddH2O 50ul

     BBa-E0030, BBa-E1010 2-3ug respectively

     ECoRI 2ul

     XbaI 2ul

     10 x M Buffer 5ul

     ddH2O 50ul

    - Reaction conditions：37℃ x 3h + 70℃ x 30min

7. Run a 1% agarose gel 120V 45 min, and EB staining.

8. Gel Extraction( QIAquick Gel Extraction Kit).

9. Measure the concentration of the recycle fragments.

10. Ligation:

     (1) ZIM17(ECoRI/SpeI) 6ul (2) ZIM17(ECoRI/SpeI) 6ul

     BBa-E0030(ECoRI/XbaI) 2ul BBa-E1010(ECoRI/XbaI) 2ul

     T4 ligase 1ul T4 ligase 1ul

     T4 ligase Buffer 1ul T4 ligase Buffer 1ul

     and the same to (3) ~ (14).

     - Ligation condition: Room temperature, 3h.

11. Transformation

     (1) UV sterilization half an hour earlier, and melt competent cells (DH5a) with ice bath.

     (2) 10 μl ligation product + 50 μl of competent cells, with 30 min ice bath.

     (3) 42 ℃ water bath heat shock 50s.

     (4) cool down with ice for 2 min.

     (5) Adding 500μl LB liquid medium without antibiotics, 37 ℃ shake (225 rpm) 1 h, recovery.

     (6) 3000 rpm × 5 min, discard 400μl supernatant and percussion of the remaining liquid and mix.

     (7) Overlay 60μl broth on solid LB medium with Kan resistance, 37 ℃, inverted overnight culture in incubator.

12. Validation positive clones

    dNTP mix (2.5mM) 1μl

     PCR 10×buffer 2μl

     VF 0.5μl

     VR 0.5μl

     Ex Taq 0.5μl

     H2O 15.5μl

    - Primer sequence:

     VF: TGCCACCTGACGTCTAAGAA

     VR: ATTACCGCCTTTGAGTGAGC

     94℃ 3 min

     94℃ 30s

     55℃ 30s 30 cycles

     72℃ 1 min

     72℃ 10 min

     12℃ ∞

     1% to 1.5% agarose gel electrophoresis, voltage <130, time ≈ 40 min.

    - Result:

13. Sequencing

Pick single colony of PCR positive clones to sequencing</p>

14. Named the correct vectors( for convenient description)

ZIM17-E0030, ZIM17-E1010, FER-E0030, sp|P07839|1-

32-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010</p>
• II. Second Vector Construction

1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight. ZIM17-E0030, ZIM17-E1010, FER-E0030, sp|P07839|1- 32-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010(kan resistant), T-gz-GAL1(Amp resistant). 2. Extract plasmid 3. Measure plasmid concentration 4. Digestion ECoRI and XbaI: ZIM17-E0030, ZIM17-E1010, FER-E0030, FER- E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010 ECoRI and SpeI: T-gz-GAL1 5. Gel electrophoresis, recycle and measure plasmid concentration 6. Ligation ZIM17-E0030, ZIM17-E1010, FER-E0030, sp|P07839|1- 32-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010 2ul respectively ligating with T-gz-GAL1 6ul. 7. Transformation 8. PCR 9. Shake culture 10. Sequencing 11. Named the correct vectors( for convenient description) GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GALTOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010.

• III. Third Vector Construction

1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight. GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GAL-TOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010(kan resistant) BBa-J63002(Amp resistant, yeast ADH terminator) 2. Extract plasmid 3. Measure plasmid concentration 4. Digestion SpeI and PstI with 10X H Buffer: GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GAL-TOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010 XbaI and PstI with 10X H Buffer: BBa-J63002 5. Gel electrophoresis, recycle and measure plasmid concentration 6. Ligation GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GAL-TOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010

2ul respectively ligating with BBa-J63002 6ul.

7. Transformation 8. PCR 9. Shake culture 10. Sequencing 11. Named the correct vectors( for convenient description) GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-sp|P07839| 1-32-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GALTOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GALTOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002

• IV. Construction of yeast expression vector

1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-sp|P07839| 1-32-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GALTOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GALTOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002(kan resistant) YEP352(Amp resistant, yeast ADH terminator) 2. Extract plasmid 3. Measure plasmid concentration 4. Digestion XbaI and PstI: GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-sp|P07839| 1-32-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GALTOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GAL-TOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002, YEP352 5. Gel electrophoresis, recycle and measure plasmid concentration 6. Ligation GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-sp|P07839| 1-32-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GAL-TOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GAL-TOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002 6ul respectively ligating with YEP532 2ul. 7. Transformation 8. PCR 9. Shake culture 10. Sequencing 11. Named the correct vectors( for convenient description) YEP-GAL-ZIM17-E0030-J63002, YEP-GAL-ZIM17-E1010-J63002, YEPGAL-FER-E0030-J63002, YEP-GAL-FER-E1010-J63002, YEP-GALTIM2-E0030-J63002, YEP-GAL-TIM2-E1010-J63002, YEP-GAL-TOM22-E0030-J63002, YEP-GAL-TOM22-E1010-J63002, YEP-GAL-TOM70-E0030-J63002, YEP-GAL-TOM70- E1010-J63002, YEP-GAL-TOM20-E0030-J63002, YEP-GAL-TOM20-E1010-J63002, YEPGAL-Tom40-E0030-J63002, YEP-GAL-Tom40-E1010-J63002

• V. Yeast transformation

1. Extract plasmid YEP-GAL-ZIM17-E0030-J63002, YEP-GAL-ZIM17-E1010-J63002, YEPGAL-FER-E0030-J63002, YEP-GAL-FER-E1010-J63002, YEP-GALTIM2-E0030-J63002, YEP-GAL-TIM2-E1010-J63002, YEP-GAL-TOM22-E0030-J63002, YEP-GAL-TOM22-E1010-J63002, YEP-GAL-TOM70-E0030-J63002, YEP-GAL-TOM70- E1010-J63002, YEP-GAL-TOM20-E0030-J63002, YEP-GAL-TOM20-E1010-J63002, YEPGAL-Tom40-E0030-J63002, YEP-GAL-Tom40-E1010-J63002 2. Preparation of yeast competent (1). Streak a YPDA agar plate with a small portion of AH109 or Y187. Incubate the plate upside down at 30°C until colonies appear(~3days). Yeast strains can be stored for up to 1 month at 4°C on YPDA medium in culture plates (2).Prepare 1.1X TE/LiAc Solution (3).Prepare YPDA liquid medium (Yeast Protocols Handbook) (4).Inoculate one colony(<4 weeks old, 2–3mm in diameter) into 3ml of YPDA medium in a sterile, 15-ml centrifuge tube. (5).Incubate at 30°C with shaking for 8hr. (6).Transfer 5µl of the culture to a 250-ml flask containing 50ml of YPDA. (7).Incubate at 30°C with shaking at 230–250 rpm for 16–20hr.The OD600 should reach 0.15–0.3. (8).Centrifuge the cells at 700 x g for 5min at room temperature. (9).Discard the supernatant and resuspend the cell pellet in 100 ml of YPDA.(10).Incubate at 30°C for 3–5hr(OD600= 0.4–0.5). (11).Centrifuge the cells at 700 x g for 5min at room temperature. (12).Discard the supernatant and resuspend the cell pellet in 60ml of sterile, deionized H2O. (13).Centrifuge the cells at 700 x g for 5min at room temperature. (14).Discard the supernatant and resuspend the cells in 3 ml of 1.1 X TE/LiAc Solution. (15).Split the resuspension between two 1.5-ml microcentrifuge tubes (1.5 ml per tube). (16).Centrifuge each tube at high speed for 15 sec. (17).Discard the supernatant and resuspend each pellet in 600 µl of 1.1 X TE/LiAc Solution. 3. Transformation (1). 1.5ml centrifuge: plasmid 0.2ug Sperm DNA*(10 mg/ml) 0.1mg

• Sperm DNA When freshly prepared water bath boil for 20 minutes, and immediately inserted

into the ice bath and stored at -20 °C (2). Add 100 ul with 1 × TE / LiAc resuspended yeast competent cells per tube, mixed with shaking; (3). Each added 600ul PEG / LiAc, shaken vigorously (to improve the conversion efficiency), 30 °C, 200 rpm shaking culture 30 min; (4). Each adding 70 ul DMSO, slowly inverted mix (not oscillating), 42 °C water bath thermal shock 15 min, insert into the ice bath to cool 1-2 min; (5). 14,000rpm × 5 sec, discard supernatant, resuspend cells with 0.1 ml 1×TE, overlay on SD/- Ura solid medium, 30°C inverted culture 3 days in incubator. 4. Check out Draw the colonies grown on the said plate in the galactose-containing SD/-Ura solid plates, until the colonies grow, single colonies were picked, and microscopic examination under a fluorescence microscope and record the results. </div>