Team:Shenzhen/Result/YAO.Channel
From 2012.igem.org
(Difference between revisions)
Line 100: | Line 100: | ||
(7) Overlay 60μl broth on solid LB medium with Kan resistance, 37 ℃, inverted overnight culture in incubator.</p></ul> | (7) Overlay 60μl broth on solid LB medium with Kan resistance, 37 ℃, inverted overnight culture in incubator.</p></ul> | ||
<ul><p>12. Validation positive clones</p> | <ul><p>12. Validation positive clones</p> | ||
- | <p> dNTP mix (2.5mM) 1μl</p><p> | + | <p> dNTP mix (2.5mM) 1μl</p><p> |
PCR 10×buffer 2μl</p><p> | PCR 10×buffer 2μl</p><p> | ||
VF 0.5μl</p><p> | VF 0.5μl</p><p> | ||
VR 0.5μl</p><p> | VR 0.5μl</p><p> | ||
Ex Taq 0.5μl</p><p> | Ex Taq 0.5μl</p><p> | ||
- | H2O 15.5μl</p><p> | + | H2O 15.5μl</p><p> |
- | VF: TGCCACCTGACGTCTAAGAA</p><p> | + | Primer sequence: </p><p> |
+ | VF: TGCCACCTGACGTCTAAGAA</p><p> | ||
VR: ATTACCGCCTTTGAGTGAGC</p><p> | VR: ATTACCGCCTTTGAGTGAGC</p><p> | ||
94℃ 3 min</p><p> | 94℃ 3 min</p><p> | ||
Line 114: | Line 115: | ||
72℃ 10 min</p><p> | 72℃ 10 min</p><p> | ||
12℃ ∞</p><p> | 12℃ ∞</p><p> | ||
- | 1% to 1.5% agarose gel electrophoresis, voltage <130, time ≈ 40 min.</p><p> - Result:</p></ul> | + | 1% to 1.5% agarose gel electrophoresis, voltage <130, time ≈ 40 min.</p><p> - Result:</p></ul> |
<ul><p>13. Sequencing</p><p> | <ul><p>13. Sequencing</p><p> | ||
Pick single colony of PCR positive clones to sequencing</p><ul> | Pick single colony of PCR positive clones to sequencing</p><ul> | ||
<ul><p>14. Named the correct vectors( for convenient description)</p><p> | <ul><p>14. Named the correct vectors( for convenient description)</p><p> | ||
ZIM17-E0030, ZIM17-E1010, FER-E0030, FER-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010</p></ul> | ZIM17-E0030, ZIM17-E1010, FER-E0030, FER-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010</p></ul> | ||
+ | |||
<ul><li>II. Second Vector Construction</li></ul> | <ul><li>II. Second Vector Construction</li></ul> | ||
- | 1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml | + | <ul><p>1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight.</p><p> |
- | centrifuge tube, shake at 37 ℃, 220 rpm overnight. | + | ZIM17-E0030, ZIM17-E1010, FER-E0030, FER-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010(kan resistant), T-gz-GAL1(Amp resistant).</p></ul> |
- | ZIM17-E0030, ZIM17-E1010, FER-E0030, | + | <ul><p>2. Extract plasmid</p></ul> |
- | + | <ul><p>3. Measure plasmid concentration</p></ul> | |
- | TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010(kan | + | <ul><p>4. Digestion </p><p> |
- | resistant), T-gz-GAL1(Amp resistant). | + | ECoRI and XbaI:</p><p> |
- | 2. Extract plasmid | + | ZIM17-E0030, ZIM17-E1010, FER-E0030, FER-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010</p><p> |
- | 3. Measure plasmid concentration | + | ECoRI and SpeI:</p><p> |
- | 4. Digestion | + | T-gz-GAL1</p></ul> |
- | ECoRI and XbaI: | + | <ul><p>5. Gel electrophoresis, recycle and measure plasmid concentration</p></ul> |
- | ZIM17-E0030, ZIM17-E1010, FER-E0030, FER- | + | <ul><p>6. Ligation </p><p> |
- | E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, | + | ZIM17-E0030, ZIM17-E1010, FER-E0030, FER-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010 2ul </p><p> |
- | TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010 | + | respectively ligating with T-gz-GAL1 6ul.</p></ul> |
- | ECoRI and SpeI: | + | <ul><p>7. Transformation</p></ul> |
- | T-gz-GAL1 | + | <ul><p>8. PCR</p></ul> |
- | 5. Gel electrophoresis, recycle and measure plasmid concentration | + | <ul><p>9. Shake culture</p></ul> |
- | 6. Ligation | + | <ul><p>10. Sequencing</p></ul> |
- | ZIM17-E0030, ZIM17-E1010, FER-E0030, | + | <ul><p>11. Named the correct vectors( for convenient description) </p></ul><p> |
- | + | GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GALTOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010.</p></ul> | |
- | TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010 2ul | + | |
- | respectively ligating with T-gz-GAL1 6ul. | + | |
- | 7. Transformation | + | |
- | 8. PCR | + | |
- | 9. Shake culture | + | |
- | 10. Sequencing | + | |
- | 11. Named the correct vectors( for convenient description) | + | |
- | GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, | + | |
- | GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, | + | |
- | GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GALTOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010. | + | |
<ul><li>III. Third Vector Construction</li></ul> | <ul><li>III. Third Vector Construction</li></ul> | ||
1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml | 1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml |
Revision as of 08:26, 25 September 2012