Team:Shenzhen/Result/YAO.Channel

From 2012.igem.org

(Difference between revisions)
 
(11 intermediate revisions not shown)
Line 21: Line 21:
<div id="picshow">
<div id="picshow">
</div>
</div>
 +
<div class="context">
<div class="context">
Line 26: Line 27:
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;Signal peptides are the tools we use to assemble YAO. Channel-Toc and Tic proteins, and to guide the protein into YAO matrix through YAO. Channel. We have designed several Signal Peptide BioBricks (shown in http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2012&group=Shenzhen). </p></ul>
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;Signal peptides are the tools we use to assemble YAO. Channel-Toc and Tic proteins, and to guide the protein into YAO matrix through YAO. Channel. We have designed several Signal Peptide BioBricks (shown in http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2012&group=Shenzhen). </p></ul>
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;In total, there are 6 types of signal peptide involved in our project: signal peptide (SP) of Zim17, SP of ferredoxi, SP of Tim21, SP of Tom40, SP of Tom70, SP of Tom22.</p></ul>
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;In total, there are 6 types of signal peptide involved in our project: signal peptide (SP) of Zim17, SP of ferredoxi, SP of Tim21, SP of Tom40, SP of Tom70, SP of Tom22.</p></ul>
-
<ul><li>
+
<ul><li>1. SP of Zim17</li>
-
1. SP of Zim17</li><p>&nbsp;&nbsp;&nbsp;&nbsp;
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;Zim17 is a zinc finger protein located in mitochondrial matrix. The signal peptide of Zim17 is amino-terminal segments rich in positively charged residues that form two to three turns of a helix with amphipathic character, and it directs the proteins imported into mitochondrial matrix. The sequence can be found at http://www.uniprot.org/blast/?about=P42844[1-47]. We synthesized the sequence and linked it with RFP & YFP.</p>
-
Zim17 is a zinc finger protein located in mitochondrial matrix. The signal peptide of Zim17 is amino-terminal segments rich in positively charged residues that form two to three turns of a helix with amphipathic character, and it directs the proteins imported into mitochondrial matrix. The sequence can be found at http://www.uniprot.org/blast/?about=P42844[1-47]. We synthesized the sequence and linked it with RFP & YFP.</p><p>
+
<p>The document we mainly refer to is:</p>
-
The document we mainly refer to is:</p><p>
+
<p>Burri L, Vascotto K, Fredersdorf S, Tiedt R, Hall MN, Lithgow T. Zim17, a novel zinc finger protein essential for protein import into mitochondria. J. Biol. Chem. 2004;279:50243-50249. </p></ul>
-
Burri L, Vascotto K, Fredersdorf S, Tiedt R, Hall MN, Lithgow T. Zim17, a novel zinc finger protein essential for protein import into mitochondria. J. Biol. Chem. 2004;279:50243-50249. </p></ul>
+
<ul><li>2. SP of ferredoxi</li>
-
<ul><li>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;The signal peptide of ferredoxi, as a chloroplast-target transit peptide, has an α helix at its N-terminus, followed by an unstructured C-terminal domain of ~19 amino acids. The sequence can be found at http://www.uniprot.org/blast/?about=P07839%5b1-32%5d. We synthesized the sequence and linked it with RFP & YFP.</p>
-
2. SP of ferredoxi</li><p>&nbsp;&nbsp;&nbsp;&nbsp;
+
<p>The document we mainly refer to is:</p>
-
The signal peptide of ferredoxi, as a chloroplast-target transit peptide, has an α helix at its N-terminus, followed by an unstructured C-terminal domain of ~19 amino acids. The sequence can be found at http://www.uniprot.org/blast/?about=P07839%5b1-32%5d. We synthesized the sequence and linked it with RFP & YFP.</p><p>
+
<p>Bruce, B. D. (2000). "Chloroplast transit peptides: structure, function and evolution." Trends in Cell Biology 10(10): 440-447. </p></ul>
-
The document we mainly refer to is:</p><p>
+
<ul>
-
Bruce, B. D. (2000). "Chloroplast transit peptides: structure, function and evolution." Trends in Cell Biology 10(10): 440-447. </p></ul>
+
<li>3. SP of Tim21</li>
-
<ul><li>
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;Tim21 is one component of the translocase of the inner mitochondrial membrane (TIM complex), and the signal peptide of Tim21 contains 239 amino acids with a N-terminally single transmembrane segment showing the characteristics of a positively charged mitochondrial presequence with a predicted cleavage site after residue 42. The sequence can be found at  http://www.uniprot.org/blast/?about=P53220[1-70]. We synthesized the sequence and linked it with RFP & YFP.</p>
-
3. SP of Tim21</li><p>&nbsp;&nbsp;&nbsp;&nbsp;
+
<p>The document we mainly refer to is:</p>
-
Tim21 is one component of the translocase of the inner mitochondrial membrane (TIM complex), and the signal peptide of Tim21 contains 239 amino acids with a N-terminally single transmembrane segment showing the characteristics of a positively charged mitochondrial presequence with a predicted cleavage site after residue 42. The sequence can be found at  http://www.uniprot.org/blast/?about=P53220[1-70]. We synthesized the sequence and linked it with RFP & YFP.</p><p>
+
<p>Chacinska, A., M. Lind, et al. (2005). "Mitochondrial Presequence Translocase: Switching between TOM Tethering and Motor Recruitment Involves Tim21 and Tim17." Cell 120(6): 817-829.</p>
-
The document we mainly refer to is:</p><p>
+
</ul>
-
Chacinska, A., M. Lind, et al. (2005). "Mitochondrial Presequence Translocase: Switching between TOM Tethering and Motor Recruitment Involves Tim21 and Tim17." Cell 120(6): 817-829.</p></ul>
+
<ul><li>
<ul><li>
4. SP of Tom40</li><p>&nbsp;&nbsp;&nbsp;&nbsp;
4. SP of Tom40</li><p>&nbsp;&nbsp;&nbsp;&nbsp;
Line 57: Line 57:
Plant Physiology July 2000 vol. 123 no. 3 811-816.</p></ul>
Plant Physiology July 2000 vol. 123 no. 3 811-816.</p></ul>
</div>
</div>
-
 
<div class="context">
<div class="context">
-
<h5>Signal Peptides Validation Protocol</h5>
+
<h5>Construction of  Signal Peptide System</h5>
-
<ul><li>Purpose</li><ul>
+
<ul><p>Due to some inaccurate information in the iGEM website and our own mistakes, some errors accrued when we attempted to link the reporter gene with signal peptide.</p></ul>
-
<ul><p>Verify that the mitochondrial signal peptides can lead peptides into the mitochondria, or onto the mitochondrial membrane, while the chloroplast signal peptides can not.</p><ul>
+
<ul><p>The followings are the reason why the errors took place and the approach we applied to solved the problem.</p></ul>
-
<ul><li>Materials</li><ul>
+
<ul><li>Causes</li></ul>
-
<ul><p>GFP, Signal peptides (ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40),  yeast strain.</p><ul>
+
<ul><p>The general adapter is:</p></ul>
-
<ul><li>Methods</li><ul>
+
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;GAATTC GCGGCCGC T TCTAGA G[ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG</p></ul>
 +
<ul><p>And general adapter of fusion protein is:</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;GAATTC GCGGCCGC T TCTAGA &nbsp;[ATG ... TAA TAA] &nbsp;ACTAGT A GCGGCCG CTGCAG &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p></ul>
 +
<ul><p>But our adapter of signal peptide is:</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;GAATTC GCGGCCGC T TCTAG &nbsp; [ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG</p></ul>
 +
<ul><p>Bad news came when we attempted to link the General adapter with the General adapter fragment. The fusion protein is as following:</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;GAATTC GCGGCCGC T TCTAGA G[part1] T ACTAGA G [part2]T ACTAGT A GCGGCCG CTGCAG</p></ul>
 +
<ul><p>As we can see, there are 8 bases at the fused locus, and in this case, frame shift mutation will occur.</p></ul>
 +
<ul><p>We also produce fusion protein using two General adapter, the result is:</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;GAATTC GCGGCCGC T TCTAGA [part1] &nbsp;ACTAGA &nbsp;[part2] ACTAGT A GCGGCCG CTGCAG</p></ul>
 +
<ul><p>There are 6 bases at the fused locus. No stop codon occurs, and it will not cause frame shift mutation.</p></ul>
 +
<ul><p>If we use our adapter to link the adapter we designed, the locus is:</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;GAATTC GCGGCCGC T TCTAG [part1] CTACTAGAG [part2] T ACTAGT A GCGGCCG CTGCAG</p></ul>
 +
<ul><p>In this case, no frame shift mutation occurs, and there are a lot of GFPs available if we select this adapter for use.</p></ul>
 +
<ul><p>However, when sequencing the fusion protein, we found the fusion locus had lost 2 bases thus causing frameshift mutation, and that the adapter of E1010 linked by backbone PSB1A3 &nbsp;became:</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;GAATTC GCGGCCGC T TCTAG &nbsp; [ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG</p></ul>
 +
<ul><div class="figurep">
 +
[[File:result_yao_channel_p1.jpg]]
 +
<p>Figure 1. Sequence and mapping result.</p></div></ul>
 +
<ul><li>Solution</li></ul>
 +
<ul>
 +
  <p>To correct this error, we designed some primers to perform the point mutation.</p>
 +
</ul>
 +
<div class="figurep"><ul><p>Table 1. Primers we used in this experiment</p></ul>
 +
<table>
 +
<tr><td><p>Common</p>
 +
</td><td><p>5&#39;-GTTTCTTCGAATTCGCGGCCGCTTCTAG</p>
 +
</td></tr><tr><td><p>ZIM17-R</p>
 +
</td><td><p>5&#39;-GTTTCTTCCTGCAGCGGCCGCTATACTAGTAGATGTGCGATGAT</p>
 +
</td></tr><tr><td><p>FER-R</p>
 +
</td><td><p>5&#39;-GTTTCTTCCTGCAGCGGCCGCTATACTAGTAGGGCCATGCAGCT</p>
 +
</td></tr><tr><td><p>TIM21-R</p>
 +
</td><td><p>5&#39;-GTTTCTTCCTGCAGCGGCCGCTATACTAGTAGGGATTTTACTTG</p>
 +
</td></tr><tr><td><p>TOM22-R</p>
 +
</td><td><p>5&#39;-GTTTCTTCCTGCAGCGGCCGCTATACTAGTAGCGGCAAGTATAG</p>
 +
</td></tr><tr><td><p>TOM70-R</p>
 +
</td><td><p>5&#39;-GTTTCTTCCTGCAGCGGCCGCTATACTAGTAGGTTGTAATAATA</p>
 +
</td></tr><tr><td><p>TOM20-R</p>
 +
</td><td><p>5&#39;-GTTTCTTCCTGCAGCGGCCGCTATACTAGTAGCCTGAATTGCGG</p>
 +
</td></tr><tr><td><p>TOM40-R</p>
 +
</td><td><p>5&#39;-GTTTCTTCCTGCAGCGGCCGCTATACTAGTAGCAATTGAGGAAG</p>
 +
</td></tr></table></div>
 +
<ul><p>COM-F is the forward primer of all signal peptides, and the other seven are the reverse primers of signal peptides. After our experimental adapters are as followings:</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;GAATTC GCGGCCGC T TCTAG [part] CT ACTAG TA T A GCGGCCG CTGCAG</p></ul>
 +
<ul><p>We add three bases in the adapter. If we link the signal peptide at N-terminal, the fused locus is:</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;GAATTC GCGGCCGC T TCTAG [part1] CTACTAGAG [part2]T ACTAGT A GCGGCCG CTGCAG</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;In this case, there are nine bases at the locus, and there aren&rsquo;t stop codon or frame shift mutations, and our adapter can be used.</p></ul>
 +
<ul><p>After such treatment, final adapter is:</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;GAATTC GCGGCCGC T TCTAGA G [part] CT ACTAG TA T A GCGGCCG CTGCAG</p></ul>
 +
<ul><p>If we add signal peptide at the N-terminal of adapter, fusion protein is:</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;GAATTC GCGGCCGC T TCTAGAG [part1] &nbsp;CTACTAGAG [part2] CT ACTAGT ATA GCGGCCG CTGCAG</p></ul>
 +
<ul><li>Protocol</li></ul>
 +
<ul><p>Step 1:Extraction plasmid</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;Zim17, FER, TIM21, TOM22, TOM70, TOM20, TOM50</p></ul>
 +
<ul><p>Step 2:Point mutation</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;PCR system(take ZIM17&nbsp;as example):</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ZIM17 plasmid template&nbsp;&nbsp;&nbsp;&nbsp;0.2ul</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Ex Taq&nbsp;&nbsp;&nbsp;&nbsp;0.5ul</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;10 x Ex Taq Buffer&nbsp;&nbsp;&nbsp;&nbsp;2.0ul</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;dNTP Mix&nbsp;&nbsp;&nbsp;&nbsp;1.0ul</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;COM-Fv0.5ul</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ZIM17-R&nbsp;&nbsp;&nbsp;&nbsp;0.5ul</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ddH2O&nbsp;&nbsp;&nbsp;&nbsp;15.3ul</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;Reaction condition:</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;94&#8451;&nbsp;&nbsp;&nbsp;&nbsp;5min</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;94&#8451;v30s</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;55&#8451&nbsp;&nbsp;&nbsp;&nbsp;30s&nbsp;&nbsp;&nbsp;&nbsp;30 cycle</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;72&#8451;&nbsp;&nbsp;&nbsp;&nbsp;30s</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;72&#8451;&nbsp;&nbsp;&nbsp;&nbsp;10min</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;12&#8451;&nbsp;&nbsp;&nbsp;&nbsp;&infin;</p></ul>
 +
<ul><p>Step 3:Add 4ul, 6 x loading Buffer, and Run agarose gel. The result are as followings:</p></ul>
 +
<ul><div class="figurep">
 +
[[File:result_yao_channel_p2.jpg]]
 +
<p>Figure 2. Result for point mutation. Lane 1=100bp Marker &nbsp;2=Tom70 &nbsp;4=Tom40 &nbsp;6=Tom20 &nbsp;8=sZIM!&amp; &nbsp;10=FER &nbsp;12=Tom22 &nbsp;13=Tim21</p></div></ul>
 +
<ul><p>Step 4:gel extraction(use QIAquick Gel Extraction Kit)</p></ul>
 +
<ul><p>Step 5:use NANODROP 2000 to measure concentration.</p></ul>
 +
<ul><p>Step 6: enzyme digestion</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;enzyme digestion system:</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;target fragment&nbsp;&nbsp;&nbsp;&nbsp;8ul</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ECoRI&nbsp;&nbsp;&nbsp;&nbsp;0.5ul</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SpeI&nbsp;&nbsp;&nbsp;&nbsp;0.5u</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;10 x H Buffer &nbsp;&nbsp;&nbsp;&nbsp;1ul</p></ul>
 +
<ul><p>&nbsp;&nbsp;&nbsp;&nbsp;Reaction condition:&nbsp;&nbsp;&nbsp;&nbsp;37&#8451; x 3h + 70&#8451; x 30min</p></ul>
 +
</div>
 +
<div class="context">
 +
<h5>Signal Peptides Validation Protocol</h5>
 +
<ul><li>Purpose</li></ul>
 +
<ul><p>Verify that the mitochondrial signal peptides can lead peptides into the mitochondria, or onto the mitochondrial membrane, while the chloroplast signal peptides can not.</p></ul>
 +
<ul><li>Materials</li></ul>
 +
<ul><p>GFP, Signal peptides (ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40),  yeast strain.</p></ul>
 +
<ul><li>Methods</li></ul>
<ul><li>I. First Vector Construction</li></ul>
<ul><li>I. First Vector Construction</li></ul>
-
<ul><p>1. Synthesis of ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40.</p><ul>
+
<ul><p>1. Synthesis of ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40.</p></ul>
<ul><p>2. The synthetic fragments are connected with PUC57 the carrier.  Mix the strain which containing the carrier and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight.</p></ul>
<ul><p>2. The synthetic fragments are connected with PUC57 the carrier.  Mix the strain which containing the carrier and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight.</p></ul>
-
<ul><p>3. Mix other two strains( BBa-E0030, BBa-E1010 containing biobrick) and 4 ml of LB+AMP  liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight.</p><ul>
+
<ul><p>3. Mix other two strains( BBa-E0030, BBa-E1010 containing biobrick) and 4 ml of LB+AMP  liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight.</p></ul>
-
<ul><p>4. Extract plasmid ( ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40, BBa-E0030, BBa-E1010).</p><ul>
+
<ul><p>4. Extract plasmid ( ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40, BBa-E0030, BBa-E1010).</p></ul>
-
<ul><p>5. Use NANODROP 2000 from  Thermo Co. to measure plasmid concentration.</p><ul>
+
<ul><p>5. Use NANODROP 2000 from  Thermo Co. to measure plasmid concentration.</p></ul>
<ul><p>6. Digest: </p><p>
<ul><p>6. Digest: </p><p>
&nbsp;&nbsp;&nbsp;&nbsp; ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40 2-3ug respectively.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
&nbsp;&nbsp;&nbsp;&nbsp; ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40 2-3ug respectively.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
Line 81: Line 170:
XbaI 2ul</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
XbaI 2ul</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
10 x M Buffer 5ul</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
10 x M Buffer 5ul</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
ddH2O 50ul</p><p>&nbsp;&nbsp;&nbsp;&nbsp; - Reaction conditions:37℃ x 3h + 70℃ x 30min</p><ul>
+
ddH2O 50ul</p><p>&nbsp;&nbsp;&nbsp;&nbsp; - Reaction conditions:37℃ x 3h + 70℃ x 30min</p></ul>
-
<ul><p>7. Run a 1% agarose gel 120V 45 min, and EB staining.</p><ul>
+
<ul><p>7. Run a 1% agarose gel 120V 45 min, and EB staining.</p></ul>
-
<ul><p>8. Gel Extraction( QIAquick Gel Extraction Kit).</p><ul>
+
<ul><p>8. Gel Extraction( QIAquick Gel Extraction Kit).</p></ul>
-
<ul><p>9. Measure the concentration of the recycle fragments.</p><ul>
+
<ul><p>9. Measure the concentration of the recycle fragments.</p></ul>
<ul><p>10. Ligation:</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
<ul><p>10. Ligation:</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
(1) ZIM17(ECoRI/SpeI) 6ul (2) ZIM17(ECoRI/SpeI) 6ul</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
(1) ZIM17(ECoRI/SpeI) 6ul (2) ZIM17(ECoRI/SpeI) 6ul</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
Line 90: Line 179:
T4 ligase 1ul  T4 ligase 1ul</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
T4 ligase 1ul  T4 ligase 1ul</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
T4 ligase Buffer 1ul  T4 ligase Buffer 1ul</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
T4 ligase Buffer 1ul  T4 ligase Buffer 1ul</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
and the same to (3) ~ (14).</p><p>&nbsp;&nbsp;&nbsp;&nbsp; - Ligation condition: Room temperature, 3h.</p><ul>
+
and the same to (3) ~ (14).</p><p>&nbsp;&nbsp;&nbsp;&nbsp; - Ligation condition: Room temperature, 3h.</p></ul>
<ul><p>11. Transformation</p>
<ul><p>11. Transformation</p>
<p>&nbsp;&nbsp;&nbsp;&nbsp; (1) UV sterilization half an hour earlier, and melt competent cells (DH5a) with ice bath.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
<p>&nbsp;&nbsp;&nbsp;&nbsp; (1) UV sterilization half an hour earlier, and melt competent cells (DH5a) with ice bath.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
Line 100: Line 189:
(7) Overlay 60μl broth on solid LB medium with Kan resistance,  37 ℃, inverted overnight culture in incubator.</p></ul>
(7) Overlay 60μl broth on solid LB medium with Kan resistance,  37 ℃, inverted overnight culture in incubator.</p></ul>
<ul><p>12. Validation positive clones</p>
<ul><p>12. Validation positive clones</p>
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;dNTP mix (2.5mM) 1μl</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
+
<p>&nbsp;&nbsp;&nbsp;&nbsp; dNTP mix (2.5mM) 1μl</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
PCR 10×buffer 2μl</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
PCR 10×buffer 2μl</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
VF 0.5μl</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
VF 0.5μl</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
VR 0.5μl</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
VR 0.5μl</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
Ex Taq 0.5μl</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
Ex Taq 0.5μl</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
H2O 15.5μl</p><p>&nbsp;&nbsp;&nbsp;&nbsp; - Primer sequence: </p><p>&nbsp;&nbsp;&nbsp;&nbsp;
+
H2O 15.5μl</p><p>&nbsp;&nbsp;&nbsp;&nbsp;  
-
VF: TGCCACCTGACGTCTAAGAA</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
+
Primer sequence: </p><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;
 +
VF: TGCCACCTGACGTCTAAGAA</p><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;
VR: ATTACCGCCTTTGAGTGAGC</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
VR: ATTACCGCCTTTGAGTGAGC</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
94℃ 3 min</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
94℃ 3 min</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
Line 114: Line 204:
72℃ 10 min</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
72℃ 10 min</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
12℃ ∞</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
12℃ ∞</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
1% to 1.5% agarose gel electrophoresis, voltage <130, time ≈ 40 min.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;- Result:</p></ul>
+
1% to 1.5% agarose gel electrophoresis, voltage <130, time ≈ 40 min.</p><p>&nbsp;&nbsp;&nbsp;&nbsp; - Result:</p></ul>
<ul><p>13. Sequencing</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
<ul><p>13. Sequencing</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
Pick single colony of PCR positive clones to sequencing</p><ul>
+
Pick single colony of PCR positive clones to sequencing</p></ul>
<ul><p>14. Named the correct vectors( for convenient description)</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
<ul><p>14. Named the correct vectors( for convenient description)</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
ZIM17-E0030, ZIM17-E1010, FER-E0030, FER-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010</p></ul>
ZIM17-E0030, ZIM17-E1010, FER-E0030, FER-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010</p></ul>
 +
<ul><li>II. Second Vector Construction</li></ul>
<ul><li>II. Second Vector Construction</li></ul>
-
1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml  
+
<ul><p>1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
centrifuge tube, shake at 37 ℃, 220 rpm overnight.
+
ZIM17-E0030, ZIM17-E1010, FER-E0030, FER-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010(kan resistant), T-gz-GAL1(Amp resistant).</p></ul>
-
ZIM17-E0030, ZIM17-E1010, FER-E0030, sp|P07839|1-
+
<ul><p>2. Extract plasmid</p></ul>
-
32-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030,  
+
<ul><p>3. Measure plasmid concentration</p></ul>
-
TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010(kan  
+
<ul><p>4. Digestion </p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
resistant), T-gz-GAL1(Amp resistant).
+
ECoRI and XbaI:</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
2. Extract plasmid
+
ZIM17-E0030, ZIM17-E1010, FER-E0030, FER-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
3. Measure plasmid concentration
+
ECoRI and SpeI:</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
4. Digestion  
+
T-gz-GAL1</p></ul>
-
ECoRI and XbaI:
+
<ul><p>5. Gel electrophoresis, recycle and measure plasmid concentration</p></ul>
-
ZIM17-E0030, ZIM17-E1010, FER-E0030, FER-
+
<ul><p>6. Ligation </p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030,  
+
ZIM17-E0030, ZIM17-E1010, FER-E0030, FER-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010 2ul </p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010
+
respectively ligating with T-gz-GAL1 6ul.</p></ul>
-
ECoRI and SpeI:
+
<ul><p>7. Transformation</p></ul>
-
T-gz-GAL1
+
<ul><p>8. PCR</p></ul>
-
5. Gel electrophoresis, recycle and measure plasmid concentration
+
<ul><p>9. Shake culture</p></ul>
-
6. Ligation  
+
<ul><p>10. Sequencing</p></ul>
-
ZIM17-E0030, ZIM17-E1010, FER-E0030, sp|P07839|1-
+
<ul><p>11. Named the correct vectors( for convenient description) </p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
32-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030,  
+
GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GALTOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010.</p></ul>
-
TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010 2ul  
+
 
-
respectively ligating with T-gz-GAL1 6ul.
+
-
7. Transformation
+
-
8. PCR
+
-
9. Shake culture
+
-
10. Sequencing
+
-
11. Named the correct vectors( for convenient description)  
+
-
GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030,  
+
-
GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030,  
+
-
GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GALTOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010.
+
<ul><li>III. Third Vector Construction</li></ul>
<ul><li>III. Third Vector Construction</li></ul>
-
1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml  
+
<ul><p>1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
centrifuge tube, shake at 37 ℃, 220 rpm overnight.
+
GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GAL-TOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010(kan resistant)</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030,  
+
BBa-J63002(Amp resistant, yeast ADH terminator)</p></ul>
-
GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030,  
+
<ul><p>2. Extract plasmid</p></ul>
-
GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030,  
+
<ul><p>3. Measure plasmid concentration</p></ul>
-
GAL-TOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010(kan resistant)
+
<ul><p>4. Digestion SpeI and PstI with 10X H Buffer:</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
BBa-J63002(Amp resistant, yeast ADH terminator)
+
GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GAL-TOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
2. Extract plasmid
+
XbaI and PstI with 10X H Buffer: </p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
3. Measure plasmid concentration
+
BBa-J63002</p></ul>
-
4. Digestion SpeI and PstI with 10X H Buffer:
+
<ul><p>5. Gel electrophoresis, recycle and measure plasmid concentration</p></ul>
-
GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030,  
+
<ul><p>6. Ligation  </p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030,  
+
GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GAL-TOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010 2ul respectively ligating with BBa-J63002 6ul.</p></ul>
-
GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030,  
+
<ul><p>7. Transformation</p></ul>
-
GAL-TOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010
+
<ul><p>8. PCR</p></ul>
-
XbaI and PstI with 10X H Buffer:  
+
<ul><p>9. Shake culture</p></ul>
-
BBa-J63002
+
<ul><p>10. Sequencing</p></ul>
-
5. Gel electrophoresis, recycle and measure plasmid concentration
+
<ul><p>11. Named the correct vectors( for convenient description) </p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
6. Ligation   
+
GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-FER-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GALTOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GALTOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002</p></ul>
-
GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030,  
+
-
GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030,  
+
-
GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030,  
+
-
GAL-TOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010
+
-
2ul respectively ligating with BBa-J63002 6ul.
+
-
7. Transformation
+
-
8. PCR
+
-
9. Shake culture
+
-
10. Sequencing
+
-
11. Named the correct vectors( for convenient description)  
+
-
GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-sp|P07839|
+
-
1-32-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002,  
+
-
GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GALTOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GALTOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002
+
<ul><li>IV. Construction of yeast expression vector</li></ul>
<ul><li>IV. Construction of yeast expression vector</li></ul>
-
1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml  
+
<ul><p>1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
centrifuge tube, shake at 37 ℃, 220 rpm overnight
+
GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-FER-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GALTOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GALTOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002(kan resistant)</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-sp|P07839|
+
YEP352(Amp resistant, yeast ADH terminator)</p></ul>
-
1-32-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002,  
+
<ul><p>2. Extract plasmid</p></ul>
-
GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GALTOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GALTOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002(kan  
+
<ul><p>3. Measure plasmid concentration</p></ul>
-
resistant)
+
<ul><p>4. Digestion </p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
YEP352(Amp resistant, yeast ADH terminator)
+
XbaI and PstI:</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
2. Extract plasmid
+
GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-FER-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GALTOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GAL-TOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002, YEP352</p></ul>
-
3. Measure plasmid concentration
+
<ul><p>5. Gel electrophoresis, recycle and measure plasmid concentration</p></ul>
-
4. Digestion  
+
<ul><p>6. Ligation </p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
XbaI and PstI:
+
GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-FER-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GAL-TOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GAL-TOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002 6ul respectively ligating with YEP532 2ul.</p></ul>
-
GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-sp|P07839|
+
<ul><p>7. Transformation</p></ul>
-
1-32-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002,  
+
<ul><p>8. PCR</p></ul>
-
GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GALTOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GAL-TOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002, YEP352
+
<ul><p>9. Shake culture</p></ul>
-
5. Gel electrophoresis, recycle and measure plasmid concentration
+
<ul><p>10. Sequencing</p></ul>
-
6. Ligation  
+
<ul><p>11. Named the correct vectors( for convenient description)</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-sp|P07839|
+
YEP-GAL-ZIM17-E0030-J63002, YEP-GAL-ZIM17-E1010-J63002, YEPGAL-FER-E0030-J63002, YEP-GAL-FER-E1010-J63002, YEP-GALTIM2-E0030-J63002, YEP-GAL-TIM2-E1010-J63002, YEP-GAL-TOM22-E0030-J63002, YEP-GAL-TOM22-E1010-J63002, YEP-GAL-TOM70-E0030-J63002, YEP-GAL-TOM70-E1010-J63002, YEP-GAL-TOM20-E0030-J63002, YEP-GAL-TOM20-E1010-J63002, YEPGAL-Tom40-E0030-J63002, YEP-GAL-Tom40-E1010-J63002</p></ul>
-
1-32-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002,  
+
-
GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002,  
+
-
GAL-TOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002,  
+
-
GAL-TOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002 6ul  
+
-
respectively ligating with YEP532 2ul.
+
-
7. Transformation
+
-
8. PCR
+
-
9. Shake culture
+
-
10. Sequencing
+
-
11. Named the correct vectors( for convenient description)
+
-
YEP-GAL-ZIM17-E0030-J63002, YEP-GAL-ZIM17-E1010-J63002, YEPGAL-FER-E0030-J63002, YEP-GAL-FER-E1010-J63002, YEP-GALTIM2-E0030-J63002, YEP-GAL-TIM2-E1010-J63002, YEP-GAL-TOM22-E0030-J63002,  
+
-
YEP-GAL-TOM22-E1010-J63002, YEP-GAL-TOM70-E0030-J63002, YEP-GAL-TOM70-
+
-
E1010-J63002, YEP-GAL-TOM20-E0030-J63002, YEP-GAL-TOM20-E1010-J63002, YEPGAL-Tom40-E0030-J63002, YEP-GAL-Tom40-E1010-J63002
+
<ul><li>V. Yeast transformation</li></ul>
<ul><li>V. Yeast transformation</li></ul>
-
1. Extract plasmid
+
<ul><p>1. Extract plasmid</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
YEP-GAL-ZIM17-E0030-J63002, YEP-GAL-ZIM17-E1010-J63002, YEPGAL-FER-E0030-J63002, YEP-GAL-FER-E1010-J63002, YEP-GALTIM2-E0030-J63002, YEP-GAL-TIM2-E1010-J63002, YEP-GAL-TOM22-E0030-J63002,  
+
YEP-GAL-ZIM17-E0030-J63002, YEP-GAL-ZIM17-E1010-J63002, YEPGAL-FER-E0030-J63002, YEP-GAL-FER-E1010-J63002, YEP-GALTIM2-E0030-J63002, YEP-GAL-TIM2-1010-J63002, YEP-GAL-TOM22-E0030-J63002, </p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
YEP-GAL-TOM22-E1010-J63002, YEP-GAL-TOM70-E0030-J63002, YEP-GAL-TOM70-
+
YEP-GAL-TOM22-E1010-J63002, YEP-GAL-TOM70-E0030-J63002, YEP-GAL-TOM70-E1010-J63002, YEP-GAL-TOM20-E0030-J63002, YEP-GAL-TOM20-E1010-J63002, YEPGAL-Tom40-E0030-J63002, YEP-GAL-Tom40-E1010-J63002</p></ul>
-
E1010-J63002, YEP-GAL-TOM20-E0030-J63002, YEP-GAL-TOM20-E1010-J63002, YEPGAL-Tom40-E0030-J63002, YEP-GAL-Tom40-E1010-J63002
+
<ul><p>2. Preparation of yeast competent</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
2. Preparation of yeast competent
+
(1) Streak a YPDA agar plate with a small portion of AH109 or Y187. Incubate the plate upside down at 30°C until colonies appear(~3days). Yeast strains can be  stored for up to 1 month at 4°C on YPDA medium in culture plates.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
(1). Streak a YPDA agar plate with a small portion of AH109 or  
+
(2) Prepare 1.1X TE/LiAc Solution.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
Y187. Incubate the plate upside down at 30°C until colonies appear(~3days). Yeast  
+
(3) Prepare YPDA liquid medium (Yeast  Protocols Handbook).</p>
-
strains can be  stored for up to 1 month at 4°C on YPDA medium in culture
+
<p>&nbsp;&nbsp;&nbsp;&nbsp;
-
plates
+
(4) Inoculate one colony(&lt;4 weeks old, 2–3mm in diameter) into 3ml of YPDA medium in a sterile, 15-ml centrifuge tube.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
(2).Prepare 1.1X TE/LiAc Solution
+
(5) Incubate at 30°C with shaking for 8hr.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
(3).Prepare YPDA liquid medium (Yeast  Protocols Handbook)
+
(6) Transfer 5µl of the culture to a 250-ml flask containing 50ml of YPDA.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
(4).Inoculate one colony(<4 weeks old, 2–3mm in diameter) into 3ml of YPDA
+
(7) Incubate at 30°C with shaking at 230–250 rpm for 16–20hr.The OD600 should reach 0.15–0.3.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
medium in a sterile, 15-ml centrifuge tube.
+
(8) Centrifuge the cells at 700 x g for 5min at room temperature.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
(5).Incubate at 30°C with shaking for 8hr.
+
(9) Discard the supernatant and resuspend the cell pellet in 100 ml of YPDA.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
(6).Transfer 5µl of the culture to a 250-ml flask containing 50ml of YPDA.
+
(10) Incubate at 30°C for 3–5hr(OD600=0.4~0.5).</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
(7).Incubate at 30°C with shaking at 230–250 rpm for 16–20hr.The OD600 should reach  
+
(11) Centrifuge the cells at 700 x g for 5min at room temperature.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
0.15–0.3.
+
(12) Discard the supernatant and resuspend the cell pellet in 60ml of sterile, deionized H2O.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
(8).Centrifuge the cells at 700 x g for 5min at room temperature.
+
(13) Centrifuge the cells at 700 x g for 5min at room temperature.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
(9).Discard the supernatant and resuspend the cell pellet in 100 ml of YPDA.(10).Incubate at 30°C for 3–5hr(OD600= 0.4–0.5).
+
(14) Discard the supernatant and resuspend the cells in 3 ml of 1.1 X TE/LiAc Solution.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
(11).Centrifuge the cells at 700 x g for 5min at room temperature.
+
(15) Split the resuspension between two 1.5-ml microcentrifuge tubes (1.5 ml pertube).</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
(12).Discard the supernatant and resuspend the cell pellet in 60ml of sterile,
+
(16) Centrifuge each tube at high speed for 15 sec.</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
deionized H2O.
+
(17) Discard the supernatant and resuspend each pellet in 600 µl of 1.1 X  TE/LiAc Solution.</p></ul>
-
(13).Centrifuge the cells at 700 x g for 5min at room temperature.
+
<ul><p>3. Transformation</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
(14).Discard the supernatant and resuspend the cells in 3 ml of 1.1 X TE/LiAc Solution.
+
(1) 1.5ml centrifuge:</p><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;
-
(15).Split the resuspension between two 1.5-ml microcentrifuge tubes (1.5 ml per
+
plasmid 0.2ug</p><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;
-
tube).
+
Sperm DNA*(10 mg/ml) 0.1mg</p><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;
-
(16).Centrifuge each tube at high speed for 15 sec.
+
Note: Sperm DNA: When freshly prepared water bath boil for 20 minutes, and immediately inserted into the ice bath and stored at -20 °C</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
(17).Discard the supernatant and resuspend each pellet in 600 µl of 1.1 X  TE/LiAc
+
(2) Add 100 ul with 1 × TE / LiAc resuspended yeast competent cells  per tube, mixed with shaking;</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
Solution.
+
(3) Each added 600ul PEG / LiAc, shaken vigorously (to improve the conversion efficiency), 30 °C, 200 rpm shaking culture 30 min; </p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
3. Transformation
+
(4) Each adding 70 ul DMSO, slowly inverted mix (not oscillating), 42 °C water bath thermal shock 15 min, insert into the ice bath to cool 1-2 min; </p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
(1). 1.5ml centrifuge:
+
(5) 14,000rpm × 5 sec, discard supernatant, resuspend cells with 0.1 ml 1×TE, overlay on SD/-Ura solid medium, 30°C inverted culture 3 days in incubator.</p></ul>
-
plasmid                                     0.2ug
+
<ul><p>4. Check out</p><p>&nbsp;&nbsp;&nbsp;&nbsp;
-
Sperm DNA*(10 mg/ml)                     0.1mg
+
Draw the colonies grown on the said plate  in the galactose-containing SD/-Ura solid plates, until the colonies grow, single colonies were picked, and microscopic examination under a fluorescence microscope and record the results.</p></ul>
-
*Sperm DNA  When freshly prepared water bath boil for 20 minutes, and immediately inserted  
+
</div>
-
into the ice bath and stored at -20 °C
+
-
(2). Add 100 ul with 1 × TE / LiAc resuspended yeast competent cells  per tube, mixed with  
+
-
shaking;
+
-
(3). Each added 600ul PEG / LiAc, shaken vigorously (to improve the conversion efficiency),  
+
-
30 °C, 200 rpm shaking culture 30 min;  
+
-
(4). Each adding 70 ul DMSO, slowly inverted mix (not oscillating), 42 °C water bath thermal  
+
-
shock 15 min, insert into the ice bath to cool 1-2 min;  
+
-
(5). 14,000rpm × 5 sec, discard supernatant, resuspend cells with 0.1 ml 1×TE, overlay on SD/-
+
-
Ura solid medium, 30°C inverted culture 3 days in incubator.
+
-
4. Check out
+
-
Draw the colonies grown on the said plate  in the galactose-containing SD/-Ura solid plates,  
+
-
until the colonies grow, single colonies were picked, and microscopic examination under a  
+
-
fluorescence microscope and record the results.
+
</div>
</div>
{{:Team:Shenzhen/Temp/gallery.htm}}
{{:Team:Shenzhen/Temp/gallery.htm}}

Latest revision as of 07:47, 26 September 2012




Yao.019-001.jpg


Construction of a Signal Peptide System

        In total, there are 6 types of signal peptide involved in our project: signal peptide (SP) of Zim17, SP of ferredoxi, SP of Tim21, SP of Tom40, SP of Tom70, SP of Tom22.

  • 1. SP of Zim17
  •     Zim17 is a zinc finger protein located in mitochondrial matrix. The signal peptide of Zim17 is amino-terminal segments rich in positively charged residues that form two to three turns of a helix with amphipathic character, and it directs the proteins imported into mitochondrial matrix. The sequence can be found at http://www.uniprot.org/blast/?about=P42844[1-47]. We synthesized the sequence and linked it with RFP & YFP.

    The document we mainly refer to is:

    Burri L, Vascotto K, Fredersdorf S, Tiedt R, Hall MN, Lithgow T. Zim17, a novel zinc finger protein essential for protein import into mitochondria. J. Biol. Chem. 2004;279:50243-50249.

  • 2. SP of ferredoxi
  •     The signal peptide of ferredoxi, as a chloroplast-target transit peptide, has an α helix at its N-terminus, followed by an unstructured C-terminal domain of ~19 amino acids. The sequence can be found at http://www.uniprot.org/blast/?about=P07839%5b1-32%5d. We synthesized the sequence and linked it with RFP & YFP.

    The document we mainly refer to is:

    Bruce, B. D. (2000). "Chloroplast transit peptides: structure, function and evolution." Trends in Cell Biology 10(10): 440-447.

  • 3. SP of Tim21
  •     Tim21 is one component of the translocase of the inner mitochondrial membrane (TIM complex), and the signal peptide of Tim21 contains 239 amino acids with a N-terminally single transmembrane segment showing the characteristics of a positively charged mitochondrial presequence with a predicted cleavage site after residue 42. The sequence can be found at http://www.uniprot.org/blast/?about=P53220[1-70]. We synthesized the sequence and linked it with RFP & YFP.

    The document we mainly refer to is:

    Chacinska, A., M. Lind, et al. (2005). "Mitochondrial Presequence Translocase: Switching between TOM Tethering and Motor Recruitment Involves Tim21 and Tim17." Cell 120(6): 817-829.

  • 4. SP of Tom40
  •      Tom40 is the core component of the translocase of the outer mitochondrial membrane (TOM complex), presenting an β-barrel structure. The signal peptide of Tom40 is a conserved β-signal motif, located near the C-terminus, The sequence can be found in the document BMC Genomics, 12, 79. We synthesized the sequence and linked it with RFP & YFP.

    The document we mainly refer to is:

    Imai, K., Fujita, N., Gromiha, M.M. and Horton, P. (2011) Eukaryote-wide sequence analysis of mitochondrial beta-barrel outer membrane proteins. BMC Genomics, 12, 79.

  • 5. SP of Tom70
  •      Tom70 is also one component of TOM complex, but only contain a single transmembrane segment at their N terminus. The signal peptide of Tom70 is the transmembrane domain comprising a hydrophilic, positively charged segment. The sequence can be found in http://www.uniprot.org/blast/?about=P07213[11-30]. We synthesized the sequence and linked it with RFP & YFP.

    The document we mainly refer to is:

    Rapaport, D. (2003). "Finding the right organelle." EMBO Rep 4(10): 948-952.

  • 6. SP of Tom22
  •      Tom22 is similar with Tom70, but it’s a tail-anchored protein. The signal peptide of Tom22 is also similar with the one of Tom70: moderately hydrophobic, relatively short, with positive charges at the flanking regions. The sequence can be found in http://www.uniprot.org/blast/?about=P49334[98-119]. We synthesized the sequence and linked it with RFP & YFP.

    The document we mainly refer to is:

    Plant Physiology July 2000 vol. 123 no. 3 811-816.

Construction of Signal Peptide System

    Due to some inaccurate information in the iGEM website and our own mistakes, some errors accrued when we attempted to link the reporter gene with signal peptide.

    The followings are the reason why the errors took place and the approach we applied to solved the problem.

  • Causes

    The general adapter is:

        GAATTC GCGGCCGC T TCTAGA G[ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG

    And general adapter of fusion protein is:

        GAATTC GCGGCCGC T TCTAGA  [ATG ... TAA TAA]  ACTAGT A GCGGCCG CTGCAG         

    But our adapter of signal peptide is:

        GAATTC GCGGCCGC T TCTAG   [ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG

    Bad news came when we attempted to link the General adapter with the General adapter fragment. The fusion protein is as following:

        GAATTC GCGGCCGC T TCTAGA G[part1] T ACTAGA G [part2]T ACTAGT A GCGGCCG CTGCAG

    As we can see, there are 8 bases at the fused locus, and in this case, frame shift mutation will occur.

    We also produce fusion protein using two General adapter, the result is:

        GAATTC GCGGCCGC T TCTAGA [part1]  ACTAGA  [part2] ACTAGT A GCGGCCG CTGCAG

    There are 6 bases at the fused locus. No stop codon occurs, and it will not cause frame shift mutation.

    If we use our adapter to link the adapter we designed, the locus is:

        GAATTC GCGGCCGC T TCTAG [part1] CTACTAGAG [part2] T ACTAGT A GCGGCCG CTGCAG

    In this case, no frame shift mutation occurs, and there are a lot of GFPs available if we select this adapter for use.

    However, when sequencing the fusion protein, we found the fusion locus had lost 2 bases thus causing frameshift mutation, and that the adapter of E1010 linked by backbone PSB1A3  became:

        GAATTC GCGGCCGC T TCTAG   [ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG

    Result yao channel p1.jpg

    Figure 1. Sequence and mapping result.

  • Solution

    To correct this error, we designed some primers to perform the point mutation.

    Table 1. Primers we used in this experiment

Common

5'-GTTTCTTCGAATTCGCGGCCGCTTCTAG

ZIM17-R

5'-GTTTCTTCCTGCAGCGGCCGCTATACTAGTAGATGTGCGATGAT

FER-R

5'-GTTTCTTCCTGCAGCGGCCGCTATACTAGTAGGGCCATGCAGCT

TIM21-R

5'-GTTTCTTCCTGCAGCGGCCGCTATACTAGTAGGGATTTTACTTG

TOM22-R

5'-GTTTCTTCCTGCAGCGGCCGCTATACTAGTAGCGGCAAGTATAG

TOM70-R

5'-GTTTCTTCCTGCAGCGGCCGCTATACTAGTAGGTTGTAATAATA

TOM20-R

5'-GTTTCTTCCTGCAGCGGCCGCTATACTAGTAGCCTGAATTGCGG

TOM40-R

5'-GTTTCTTCCTGCAGCGGCCGCTATACTAGTAGCAATTGAGGAAG

    COM-F is the forward primer of all signal peptides, and the other seven are the reverse primers of signal peptides. After our experimental adapters are as followings:

        GAATTC GCGGCCGC T TCTAG [part] CT ACTAG TA T A GCGGCCG CTGCAG

    We add three bases in the adapter. If we link the signal peptide at N-terminal, the fused locus is:

        GAATTC GCGGCCGC T TCTAG [part1] CTACTAGAG [part2]T ACTAGT A GCGGCCG CTGCAG

        In this case, there are nine bases at the locus, and there aren’t stop codon or frame shift mutations, and our adapter can be used.

    After such treatment, final adapter is:

        GAATTC GCGGCCGC T TCTAGA G [part] CT ACTAG TA T A GCGGCCG CTGCAG

    If we add signal peptide at the N-terminal of adapter, fusion protein is:

        GAATTC GCGGCCGC T TCTAGAG [part1]  CTACTAGAG [part2] CT ACTAGT ATA GCGGCCG CTGCAG

  • Protocol

    Step 1:Extraction plasmid

        Zim17, FER, TIM21, TOM22, TOM70, TOM20, TOM50

    Step 2:Point mutation

        PCR system(take ZIM17 as example):

            ZIM17 plasmid template    0.2ul

            Ex Taq    0.5ul

            10 x Ex Taq Buffer    2.0ul

            dNTP Mix    1.0ul

            COM-Fv0.5ul

            ZIM17-R    0.5ul

            ddH2O    15.3ul

        Reaction condition:

            94℃    5min

            94℃v30s

            55&#8451    30s    30 cycle

            72℃    30s

            72℃    10min

            12℃    ∞

    Step 3:Add 4ul, 6 x loading Buffer, and Run agarose gel. The result are as followings:

    Result yao channel p2.jpg

    Figure 2. Result for point mutation. Lane 1=100bp Marker  2=Tom70  4=Tom40  6=Tom20  8=sZIM!&  10=FER  12=Tom22  13=Tim21

    Step 4:gel extraction(use QIAquick Gel Extraction Kit)

    Step 5:use NANODROP 2000 to measure concentration.

    Step 6: enzyme digestion

        enzyme digestion system:

            target fragment    8ul

            ECoRI    0.5ul

            SpeI    0.5u

            10 x H Buffer     1ul

        Reaction condition:    37℃ x 3h + 70℃ x 30min

Signal Peptides Validation Protocol
  • Purpose

    Verify that the mitochondrial signal peptides can lead peptides into the mitochondria, or onto the mitochondrial membrane, while the chloroplast signal peptides can not.

  • Materials

    GFP, Signal peptides (ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40), yeast strain.

  • Methods
  • I. First Vector Construction

    1. Synthesis of ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40.

    2. The synthetic fragments are connected with PUC57 the carrier. Mix the strain which containing the carrier and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight.

    3. Mix other two strains( BBa-E0030, BBa-E1010 containing biobrick) and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight.

    4. Extract plasmid ( ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40, BBa-E0030, BBa-E1010).

    5. Use NANODROP 2000 from Thermo Co. to measure plasmid concentration.

    6. Digest:

         ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40 2-3ug respectively.

         ECoRI 2ul

         SpeI 2ul

         10 x H Buffer 5ul

         ddH2O 50ul

         BBa-E0030, BBa-E1010 2-3ug respectively

         ECoRI 2ul

         XbaI 2ul

         10 x M Buffer 5ul

         ddH2O 50ul

         - Reaction conditions:37℃ x 3h + 70℃ x 30min

    7. Run a 1% agarose gel 120V 45 min, and EB staining.

    8. Gel Extraction( QIAquick Gel Extraction Kit).

    9. Measure the concentration of the recycle fragments.

    10. Ligation:

         (1) ZIM17(ECoRI/SpeI) 6ul (2) ZIM17(ECoRI/SpeI) 6ul

         BBa-E0030(ECoRI/XbaI) 2ul BBa-E1010(ECoRI/XbaI) 2ul

         T4 ligase 1ul T4 ligase 1ul

         T4 ligase Buffer 1ul T4 ligase Buffer 1ul

         and the same to (3) ~ (14).

         - Ligation condition: Room temperature, 3h.

    11. Transformation

         (1) UV sterilization half an hour earlier, and melt competent cells (DH5a) with ice bath.

         (2) 10 μl ligation product + 50 μl of competent cells, with 30 min ice bath.

         (3) 42 ℃ water bath heat shock 50s.

         (4) cool down with ice for 2 min.

         (5) Adding 500μl LB liquid medium without antibiotics, 37 ℃ shake (225 rpm) 1 h, recovery.

         (6) 3000 rpm × 5 min, discard 400μl supernatant and percussion of the remaining liquid and mix.

         (7) Overlay 60μl broth on solid LB medium with Kan resistance, 37 ℃, inverted overnight culture in incubator.

    12. Validation positive clones

         dNTP mix (2.5mM) 1μl

         PCR 10×buffer 2μl

         VF 0.5μl

         VR 0.5μl

         Ex Taq 0.5μl

         H2O 15.5μl

         Primer sequence:

             VF: TGCCACCTGACGTCTAAGAA

             VR: ATTACCGCCTTTGAGTGAGC

         94℃ 3 min

         94℃ 30s

         55℃ 30s 30 cycles

         72℃ 1 min

         72℃ 10 min

         12℃ ∞

         1% to 1.5% agarose gel electrophoresis, voltage <130, time ≈ 40 min.

         - Result:

    13. Sequencing

         Pick single colony of PCR positive clones to sequencing

    14. Named the correct vectors( for convenient description)

         ZIM17-E0030, ZIM17-E1010, FER-E0030, FER-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010

  • II. Second Vector Construction

    1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight.

         ZIM17-E0030, ZIM17-E1010, FER-E0030, FER-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010(kan resistant), T-gz-GAL1(Amp resistant).

    2. Extract plasmid

    3. Measure plasmid concentration

    4. Digestion

         ECoRI and XbaI:

         ZIM17-E0030, ZIM17-E1010, FER-E0030, FER-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010

         ECoRI and SpeI:

         T-gz-GAL1

    5. Gel electrophoresis, recycle and measure plasmid concentration

    6. Ligation

         ZIM17-E0030, ZIM17-E1010, FER-E0030, FER-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010 2ul

         respectively ligating with T-gz-GAL1 6ul.

    7. Transformation

    8. PCR

    9. Shake culture

    10. Sequencing

    11. Named the correct vectors( for convenient description)

         GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GALTOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010.

  • III. Third Vector Construction

    1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight.

         GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GAL-TOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010(kan resistant)

         BBa-J63002(Amp resistant, yeast ADH terminator)

    2. Extract plasmid

    3. Measure plasmid concentration

    4. Digestion SpeI and PstI with 10X H Buffer:

         GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GAL-TOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010

         XbaI and PstI with 10X H Buffer:

         BBa-J63002

    5. Gel electrophoresis, recycle and measure plasmid concentration

    6. Ligation

         GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GAL-TOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010 2ul respectively ligating with BBa-J63002 6ul.

    7. Transformation

    8. PCR

    9. Shake culture

    10. Sequencing

    11. Named the correct vectors( for convenient description)

         GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-FER-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GALTOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GALTOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002

  • IV. Construction of yeast expression vector

    1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight

         GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-FER-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GALTOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GALTOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002(kan resistant)

         YEP352(Amp resistant, yeast ADH terminator)

    2. Extract plasmid

    3. Measure plasmid concentration

    4. Digestion

         XbaI and PstI:

         GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-FER-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GALTOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GAL-TOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002, YEP352

    5. Gel electrophoresis, recycle and measure plasmid concentration

    6. Ligation

         GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-FER-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GAL-TOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GAL-TOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002 6ul respectively ligating with YEP532 2ul.

    7. Transformation

    8. PCR

    9. Shake culture

    10. Sequencing

    11. Named the correct vectors( for convenient description)

         YEP-GAL-ZIM17-E0030-J63002, YEP-GAL-ZIM17-E1010-J63002, YEPGAL-FER-E0030-J63002, YEP-GAL-FER-E1010-J63002, YEP-GALTIM2-E0030-J63002, YEP-GAL-TIM2-E1010-J63002, YEP-GAL-TOM22-E0030-J63002, YEP-GAL-TOM22-E1010-J63002, YEP-GAL-TOM70-E0030-J63002, YEP-GAL-TOM70-E1010-J63002, YEP-GAL-TOM20-E0030-J63002, YEP-GAL-TOM20-E1010-J63002, YEPGAL-Tom40-E0030-J63002, YEP-GAL-Tom40-E1010-J63002

  • V. Yeast transformation

    1. Extract plasmid

         YEP-GAL-ZIM17-E0030-J63002, YEP-GAL-ZIM17-E1010-J63002, YEPGAL-FER-E0030-J63002, YEP-GAL-FER-E1010-J63002, YEP-GALTIM2-E0030-J63002, YEP-GAL-TIM2-1010-J63002, YEP-GAL-TOM22-E0030-J63002,

         YEP-GAL-TOM22-E1010-J63002, YEP-GAL-TOM70-E0030-J63002, YEP-GAL-TOM70-E1010-J63002, YEP-GAL-TOM20-E0030-J63002, YEP-GAL-TOM20-E1010-J63002, YEPGAL-Tom40-E0030-J63002, YEP-GAL-Tom40-E1010-J63002

    2. Preparation of yeast competent

         (1) Streak a YPDA agar plate with a small portion of AH109 or Y187. Incubate the plate upside down at 30°C until colonies appear(~3days). Yeast strains can be stored for up to 1 month at 4°C on YPDA medium in culture plates.

         (2) Prepare 1.1X TE/LiAc Solution.

         (3) Prepare YPDA liquid medium (Yeast Protocols Handbook).

         (4) Inoculate one colony(<4 weeks old, 2–3mm in diameter) into 3ml of YPDA medium in a sterile, 15-ml centrifuge tube.

         (5) Incubate at 30°C with shaking for 8hr.

         (6) Transfer 5µl of the culture to a 250-ml flask containing 50ml of YPDA.

         (7) Incubate at 30°C with shaking at 230–250 rpm for 16–20hr.The OD600 should reach 0.15–0.3.

         (8) Centrifuge the cells at 700 x g for 5min at room temperature.

         (9) Discard the supernatant and resuspend the cell pellet in 100 ml of YPDA.

         (10) Incubate at 30°C for 3–5hr(OD600=0.4~0.5).

         (11) Centrifuge the cells at 700 x g for 5min at room temperature.

         (12) Discard the supernatant and resuspend the cell pellet in 60ml of sterile, deionized H2O.

         (13) Centrifuge the cells at 700 x g for 5min at room temperature.

         (14) Discard the supernatant and resuspend the cells in 3 ml of 1.1 X TE/LiAc Solution.

         (15) Split the resuspension between two 1.5-ml microcentrifuge tubes (1.5 ml pertube).

         (16) Centrifuge each tube at high speed for 15 sec.

         (17) Discard the supernatant and resuspend each pellet in 600 µl of 1.1 X TE/LiAc Solution.

    3. Transformation

         (1) 1.5ml centrifuge:

             plasmid 0.2ug

             Sperm DNA*(10 mg/ml) 0.1mg

             Note: Sperm DNA: When freshly prepared water bath boil for 20 minutes, and immediately inserted into the ice bath and stored at -20 °C

         (2) Add 100 ul with 1 × TE / LiAc resuspended yeast competent cells per tube, mixed with shaking;

         (3) Each added 600ul PEG / LiAc, shaken vigorously (to improve the conversion efficiency), 30 °C, 200 rpm shaking culture 30 min;

         (4) Each adding 70 ul DMSO, slowly inverted mix (not oscillating), 42 °C water bath thermal shock 15 min, insert into the ice bath to cool 1-2 min;

         (5) 14,000rpm × 5 sec, discard supernatant, resuspend cells with 0.1 ml 1×TE, overlay on SD/-Ura solid medium, 30°C inverted culture 3 days in incubator.

    4. Check out

         Draw the colonies grown on the said plate in the galactose-containing SD/-Ura solid plates, until the colonies grow, single colonies were picked, and microscopic examination under a fluorescence microscope and record the results.