Team:Shenzhen/Result/YAO.Channel
From 2012.igem.org
(Difference between revisions)
Line 81: | Line 81: | ||
XbaI 2ul</p><p> | XbaI 2ul</p><p> | ||
10 x M Buffer 5ul</p><p> | 10 x M Buffer 5ul</p><p> | ||
- | ddH2O 50ul</p><p> | + | ddH2O 50ul</p><p> - Reaction conditions:37℃ x 3h + 70℃ x 30min</p><ul> |
- | Reaction conditions:37℃ x 3h + 70℃ x 30min</p><ul> | + | |
<ul><p>7. Run a 1% agarose gel 120V 45 min, and EB staining.</p><ul> | <ul><p>7. Run a 1% agarose gel 120V 45 min, and EB staining.</p><ul> | ||
<ul><p>8. Gel Extraction( QIAquick Gel Extraction Kit).</p><ul> | <ul><p>8. Gel Extraction( QIAquick Gel Extraction Kit).</p><ul> | ||
<ul><p>9. Measure the concentration of the recycle fragments.</p><ul> | <ul><p>9. Measure the concentration of the recycle fragments.</p><ul> | ||
- | <ul><p>10. Ligation:</p><p> | + | <ul><p>10. Ligation:</p><p> |
- | (1) ZIM17(ECoRI/SpeI) 6ul (2) ZIM17(ECoRI/SpeI) 6ul</p><p> | + | (1) ZIM17(ECoRI/SpeI) 6ul (2) ZIM17(ECoRI/SpeI) 6ul</p><p> |
- | BBa-E0030(ECoRI/XbaI) 2ul BBa-E1010(ECoRI/XbaI) 2ul</p><p> | + | BBa-E0030(ECoRI/XbaI) 2ul BBa-E1010(ECoRI/XbaI) 2ul</p><p> |
- | T4 ligase 1ul T4 ligase 1ul</p><p> | + | T4 ligase 1ul T4 ligase 1ul</p><p> |
- | T4 ligase Buffer 1ul T4 ligase Buffer 1ul</p><p> | + | T4 ligase Buffer 1ul T4 ligase Buffer 1ul</p><p> |
- | and the same to (3) ~ (14).</p><p> | + | and the same to (3) ~ (14).</p><p> - Ligation condition: Room temperature, 3h.</p><ul> |
- | Ligation condition: Room temperature, 3h.</p><ul> | + | |
<ul><p>11. Transformation</p> | <ul><p>11. Transformation</p> | ||
- | <p> (1) UV sterilization half an hour earlier, and melt competent cells (DH5a) with ice bath.</p><p> | + | <p> (1) UV sterilization half an hour earlier, and melt competent cells (DH5a) with ice bath.</p><p> |
(2) 10 μl ligation product + 50 μl of competent cells, with 30 min ice bath.</p><p> | (2) 10 μl ligation product + 50 μl of competent cells, with 30 min ice bath.</p><p> | ||
(3) 42 ℃ water bath heat shock 50s.</p><p> | (3) 42 ℃ water bath heat shock 50s.</p><p> | ||
Line 100: | Line 98: | ||
(5) Adding 500μl LB liquid medium without antibiotics, 37 ℃ shake (225 rpm) 1 h, recovery.</p><p> | (5) Adding 500μl LB liquid medium without antibiotics, 37 ℃ shake (225 rpm) 1 h, recovery.</p><p> | ||
(6) 3000 rpm × 5 min, discard 400μl supernatant and percussion of the remaining liquid and mix.</p><p> | (6) 3000 rpm × 5 min, discard 400μl supernatant and percussion of the remaining liquid and mix.</p><p> | ||
- | (7) Overlay 60μl broth on solid LB medium with Kan resistance, 37 ℃, inverted overnight culture in incubator.</p></ul> | + | (7) Overlay 60μl broth on solid LB medium with Kan resistance, 37 ℃, inverted overnight culture in incubator.</p></ul> |
<ul><p>12. Validation positive clones</p> | <ul><p>12. Validation positive clones</p> | ||
<p> dNTP mix (2.5mM) 1μl</p><p> | <p> dNTP mix (2.5mM) 1μl</p><p> | ||
Line 107: | Line 105: | ||
VR 0.5μl</p><p> | VR 0.5μl</p><p> | ||
Ex Taq 0.5μl</p><p> | Ex Taq 0.5μl</p><p> | ||
- | H2O 15.5μl</p><p> | + | H2O 15.5μl</p><p> - Primer sequence: </p><p> |
- | Primer sequence: </p><p> | + | |
VF: TGCCACCTGACGTCTAAGAA</p><p> | VF: TGCCACCTGACGTCTAAGAA</p><p> | ||
VR: ATTACCGCCTTTGAGTGAGC</p><p> | VR: ATTACCGCCTTTGAGTGAGC</p><p> | ||
Line 117: | Line 114: | ||
72℃ 10 min</p><p> | 72℃ 10 min</p><p> | ||
12℃ ∞</p><p> | 12℃ ∞</p><p> | ||
- | 1% to 1.5% agarose gel electrophoresis, voltage <130, time ≈ 40 min.</p><p> | + | 1% to 1.5% agarose gel electrophoresis, voltage <130, time ≈ 40 min.</p><p> - Result:</p></ul> |
- | Result:</p></ul> | + | <ul><p>13. Sequencing</p></ul> |
- | <ul><p>13. Sequencing<p></ul> | + | |
Pick single colony of PCR positive clones to sequencing</p><ul> | Pick single colony of PCR positive clones to sequencing</p><ul> | ||
- | <ul><p>14. Named the correct vectors( for convenient description)<p></ul> | + | <ul><p>14. Named the correct vectors( for convenient description)</p></ul> |
ZIM17-E0030, ZIM17-E1010, FER-E0030, sp|P07839|1- | ZIM17-E0030, ZIM17-E1010, FER-E0030, sp|P07839|1- | ||
32-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010</p></ul> | 32-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010</p></ul> |
Revision as of 08:19, 25 September 2012