Team:Shenzhen/Result/YAO.Channel
From 2012.igem.org
(Difference between revisions)
Line 60: | Line 60: | ||
<div class="context"> | <div class="context"> | ||
<h5>Signal Peptides Validation Protocol</h5> | <h5>Signal Peptides Validation Protocol</h5> | ||
- | <ul>< | + | <ul><li>Purpose</li><ul> |
<ul><p>Verify that the mitochondrial signal peptides can lead peptides into the mitochondria, or onto the mitochondrial membrane, while the chloroplast signal peptides can not.</p><ul> | <ul><p>Verify that the mitochondrial signal peptides can lead peptides into the mitochondria, or onto the mitochondrial membrane, while the chloroplast signal peptides can not.</p><ul> | ||
- | <ul>< | + | <ul><li>Materials</li><ul> |
<ul><p>GFP, Signal peptides (ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40), yeast strain.</p><ul> | <ul><p>GFP, Signal peptides (ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40), yeast strain.</p><ul> | ||
- | <ul>< | + | <ul><li>Methods</li><ul> |
<ul><li>I. First Vector Construction</li></ul> | <ul><li>I. First Vector Construction</li></ul> | ||
<ul><p>1. Synthesis of ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40.</p><ul> | <ul><p>1. Synthesis of ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40.</p><ul> | ||
Line 72: | Line 72: | ||
<ul><p>5. Use NANODROP 2000 from Thermo Co. to measure plasmid concentration.</p><ul> | <ul><p>5. Use NANODROP 2000 from Thermo Co. to measure plasmid concentration.</p><ul> | ||
<ul><p>6. Digest: </p><p> | <ul><p>6. Digest: </p><p> | ||
- | ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40 2-3ug respectively.</p><p> | + | ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40 2-3ug respectively.</p><p> |
- | ECoRI 2ul</p><p> | + | ECoRI 2ul</p><p> |
- | SpeI 2ul</p><p> | + | SpeI 2ul</p><p> |
- | 10 x H Buffer 5ul</p><p> | + | 10 x H Buffer 5ul</p><p> |
- | ddH2O 50ul</p><p> | + | ddH2O 50ul</p><p> |
- | BBa-E0030, BBa-E1010 2-3ug respectively</p><p> | + | BBa-E0030, BBa-E1010 2-3ug respectively</p><p> |
- | ECoRI 2ul</p><p> | + | ECoRI 2ul</p><p> |
- | XbaI 2ul</p><p> | + | XbaI 2ul</p><p> |
- | 10 x M Buffer 5ul</p><p> | + | 10 x M Buffer 5ul</p><p> |
ddH2O 50ul</p><p> | ddH2O 50ul</p><p> | ||
Reaction conditions:37℃ x 3h + 70℃ x 30min</p><ul> | Reaction conditions:37℃ x 3h + 70℃ x 30min</p><ul> | ||
Line 93: | Line 93: | ||
and the same to (3) ~ (14).</p><p> | and the same to (3) ~ (14).</p><p> | ||
Ligation condition: Room temperature, 3h.</p><ul> | Ligation condition: Room temperature, 3h.</p><ul> | ||
- | <ul>< | + | <ul><p>11. Transformation</p> |
- | <p>(1) UV sterilization half an hour earlier, and melt competent cells (DH5a) with ice bath.</p><p> | + | <p> (1) UV sterilization half an hour earlier, and melt competent cells (DH5a) with ice bath.</p><p> |
- | (2) 10 μl ligation product + 50 μl of competent cells, with 30 min ice bath.</p><p> | + | (2) 10 μl ligation product + 50 μl of competent cells, with 30 min ice bath.</p><p> |
- | (3) 42 ℃ water bath heat shock 50s.</p><p> | + | (3) 42 ℃ water bath heat shock 50s.</p><p> |
- | (4) cool down with ice for 2 min.</p><p> | + | (4) cool down with ice for 2 min.</p><p> |
- | (5) Adding 500μl LB liquid medium without antibiotics, 37 ℃ shake (225 rpm) 1 h, recovery.</p><p> | + | (5) Adding 500μl LB liquid medium without antibiotics, 37 ℃ shake (225 rpm) 1 h, recovery.</p><p> |
- | (6) 3000 rpm × 5 min, discard 400μl supernatant and percussion of the remaining liquid and mix.</p><p> | + | (6) 3000 rpm × 5 min, discard 400μl supernatant and percussion of the remaining liquid and mix.</p><p> |
- | (7) Overlay 60μl broth on solid LB medium with Kan resistance, 37 ℃, inverted overnight culture in incubator.</p></ul> | + | (7) Overlay 60μl broth on solid LB medium with Kan resistance, 37 ℃, inverted overnight culture in incubator.</p></ul> |
- | <ul>< | + | <ul><p>12. Validation positive clones</p> |
- | <p>dNTP mix (2.5mM) 1μl</p><p> | + | <p> dNTP mix (2.5mM) 1μl</p><p> |
- | PCR 10×buffer 2μl</p><p> | + | PCR 10×buffer 2μl</p><p> |
- | VF 0.5μl</p><p> | + | VF 0.5μl</p><p> |
- | VR 0.5μl</p><p> | + | VR 0.5μl</p><p> |
- | Ex Taq 0.5μl</p><p> | + | Ex Taq 0.5μl</p><p> |
- | H2O 15.5μl</p><p> | + | H2O 15.5μl</p><p> |
- | Primer sequence: </p><p> | + | Primer sequence: </p><p> |
- | VF: TGCCACCTGACGTCTAAGAA</p><p> | + | VF: TGCCACCTGACGTCTAAGAA</p><p> |
- | VR: ATTACCGCCTTTGAGTGAGC</p><p> | + | VR: ATTACCGCCTTTGAGTGAGC</p><p> |
- | 94℃ 3 min</p><p> | + | 94℃ 3 min</p><p> |
- | 94℃ 30s</p><p> | + | 94℃ 30s</p><p> |
- | 55℃ 30s 30 cycles</p><p> | + | 55℃ 30s 30 cycles</p><p> |
- | 72℃ 1 min</p><p> | + | 72℃ 1 min</p><p> |
- | 72℃ 10 min</p><p> | + | 72℃ 10 min</p><p> |
- | 12℃ ∞</p><p> | + | 12℃ ∞</p><p> |
1% to 1.5% agarose gel electrophoresis, voltage <130, time ≈ 40 min.</p><p> | 1% to 1.5% agarose gel electrophoresis, voltage <130, time ≈ 40 min.</p><p> | ||
Result:</p></ul> | Result:</p></ul> | ||
- | <ul>< | + | <ul><p>13. Sequencing<p></ul> |
Pick single colony of PCR positive clones to sequencing</p><ul> | Pick single colony of PCR positive clones to sequencing</p><ul> | ||
- | <ul>< | + | <ul><p>14. Named the correct vectors( for convenient description)<p></ul> |
ZIM17-E0030, ZIM17-E1010, FER-E0030, sp|P07839|1- | ZIM17-E0030, ZIM17-E1010, FER-E0030, sp|P07839|1- | ||
- | 32-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, | + | 32-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010</p></ul> |
- | TOM70-E1010, TOM20-E0030, | + | |
- | TOM20-E1010, Tom40-E0030, Tom40-E1010</p></ul> | + | |
<ul><li>II. Second Vector Construction</li></ul> | <ul><li>II. Second Vector Construction</li></ul> | ||
1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml | 1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml |
Revision as of 08:13, 25 September 2012