Team:Shenzhen/Result/YAO.Channel
From 2012.igem.org
(Difference between revisions)
Line 58: | Line 58: | ||
</div> | </div> | ||
- | + | <div class="context"> | |
+ | <h5>Signal Peptides Validation Protocol</h5> | ||
+ | <ul><p>Purpose</p><ul> | ||
+ | <ul><p>Verify that the mitochondrial signal peptides can lead peptides into the mitochondria, or onto the mitochondrial membrane, while the chloroplast signal peptides can not.</p><ul> | ||
+ | <ul><p>Materials</p><ul> | ||
+ | <ul><p>GFP, Signal peptides (ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40), yeast strain.</p><ul> | ||
+ | <ul><p>Methods</p><ul> | ||
+ | <ul><li>I. First Vector Construction</li></ul> | ||
+ | <ul><p>1. Synthesis of ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40.</p><ul> | ||
+ | <ul><p>2. The synthetic fragments are connected with PUC57 the carrier. Mix the strain which containing the carrier and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight.</p></ul> | ||
+ | <ul><p>3. Mix other two strains( BBa-E0030, BBa-E1010 containing biobrick) and 4 ml of LB+AMP liquid medium in 15 ml centrifuge tube, shake at 37 ℃, 220 rpm overnight.</p><ul> | ||
+ | <ul><p>4. Extract plasmid ( ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40, BBa-E0030, BBa-E1010).</p><ul> | ||
+ | <ul><p>5. Use NANODROP 2000 from Thermo Co. to measure plasmid concentration.</p><ul> | ||
+ | <ul><p>6. Digest: </p><p> | ||
+ | ZIM17, FER, TIM21, TOM22, TOM70, TOM20, TOM40 2-3ug respectively.</p><p> | ||
+ | ECoRI 2ul</p><p> | ||
+ | SpeI 2ul</p><p> | ||
+ | 10 x H Buffer 5ul</p><p> | ||
+ | ddH2O 50ul</p><p> | ||
+ | BBa-E0030, BBa-E1010 2-3ug respectively</p><p> | ||
+ | ECoRI 2ul</p><p> | ||
+ | XbaI 2ul</p><p> | ||
+ | 10 x M Buffer 5ul</p><p> | ||
+ | ddH2O 50ul</p><p> | ||
+ | Reaction conditions:37℃ x 3h + 70℃ x 30min</p><ul> | ||
+ | <ul><p>7. Run a 1% agarose gel 120V 45 min, and EB staining.</p><ul> | ||
+ | <ul><p>8. Gel Extraction( QIAquick Gel Extraction Kit).</p><ul> | ||
+ | <ul><p>9. Measure the concentration of the recycle fragments.</p><ul> | ||
+ | <ul><p>10. Ligation:</p><p> | ||
+ | (1) ZIM17(ECoRI/SpeI) 6ul (2) ZIM17(ECoRI/SpeI) 6ul</p><p> | ||
+ | BBa-E0030(ECoRI/XbaI) 2ul BBa-E1010(ECoRI/XbaI) 2ul</p><p> | ||
+ | T4 ligase 1ul T4 ligase 1ul</p><p> | ||
+ | T4 ligase Buffer 1ul T4 ligase Buffer 1ul</p><p> | ||
+ | and the same to (3) ~ (14).</p><p> | ||
+ | Ligation condition: Room temperature, 3h.</p><ul> | ||
+ | <ul><li>11. Transformation</li> | ||
+ | <p>(1) UV sterilization half an hour earlier, and melt competent cells (DH5a) with ice bath.</p><p> | ||
+ | (2) 10 μl ligation product + 50 μl of competent cells, with 30 min ice bath.</p><p> | ||
+ | (3) 42 ℃ water bath heat shock 50s.</p><p> | ||
+ | (4) cool down with ice for 2 min.</p><p> | ||
+ | (5) Adding 500μl LB liquid medium without antibiotics, 37 ℃ shake (225 rpm) 1 h, recovery.</p><p> | ||
+ | (6) 3000 rpm × 5 min, discard 400μl supernatant and percussion of the remaining liquid and mix.</p><p> | ||
+ | (7) Overlay 60μl broth on solid LB medium with Kan resistance, 37 ℃, inverted overnight culture in incubator.</p></ul> | ||
+ | <ul><li>12. Validation positive clones</li> | ||
+ | <p>dNTP mix (2.5mM) 1μl</p><p> | ||
+ | PCR 10×buffer 2μl</p><p> | ||
+ | VF 0.5μl</p><p> | ||
+ | VR 0.5μl</p><p> | ||
+ | Ex Taq 0.5μl</p><p> | ||
+ | H2O 15.5μl</p><p> | ||
+ | Primer sequence: </p><p> | ||
+ | VF: TGCCACCTGACGTCTAAGAA</p><p> | ||
+ | VR: ATTACCGCCTTTGAGTGAGC</p><p> | ||
+ | 94℃ 3 min</p><p> | ||
+ | 94℃ 30s</p><p> | ||
+ | 55℃ 30s 30 cycles</p><p> | ||
+ | 72℃ 1 min</p><p> | ||
+ | 72℃ 10 min</p><p> | ||
+ | 12℃ ∞</p><p> | ||
+ | 1% to 1.5% agarose gel electrophoresis, voltage <130, time ≈ 40 min.</p><p> | ||
+ | Result:</p></ul> | ||
+ | <ul><li>13. Sequencing | ||
+ | Pick single colony of PCR positive clones to sequencing</p><ul> | ||
+ | <ul><li>14. Named the correct vectors( for convenient description) | ||
+ | ZIM17-E0030, ZIM17-E1010, FER-E0030, sp|P07839|1- | ||
+ | 32-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, | ||
+ | TOM70-E1010, TOM20-E0030, | ||
+ | TOM20-E1010, Tom40-E0030, Tom40-E1010</p></ul> | ||
+ | <ul><li>II. Second Vector Construction</li></ul> | ||
+ | 1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml | ||
+ | centrifuge tube, shake at 37 ℃, 220 rpm overnight. | ||
+ | ZIM17-E0030, ZIM17-E1010, FER-E0030, sp|P07839|1- | ||
+ | 32-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, | ||
+ | TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010(kan | ||
+ | resistant), T-gz-GAL1(Amp resistant). | ||
+ | 2. Extract plasmid | ||
+ | 3. Measure plasmid concentration | ||
+ | 4. Digestion | ||
+ | ECoRI and XbaI: | ||
+ | ZIM17-E0030, ZIM17-E1010, FER-E0030, FER- | ||
+ | E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, | ||
+ | TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010 | ||
+ | ECoRI and SpeI: | ||
+ | T-gz-GAL1 | ||
+ | 5. Gel electrophoresis, recycle and measure plasmid concentration | ||
+ | 6. Ligation | ||
+ | ZIM17-E0030, ZIM17-E1010, FER-E0030, sp|P07839|1- | ||
+ | 32-E1010, TIM2-E0030, TIM2-E1010, TOM22-E0030, TOM22-E1010, TOM70-E0030, | ||
+ | TOM70-E1010, TOM20-E0030, TOM20-E1010, Tom40-E0030, Tom40-E1010 2ul | ||
+ | respectively ligating with T-gz-GAL1 6ul. | ||
+ | 7. Transformation | ||
+ | 8. PCR | ||
+ | 9. Shake culture | ||
+ | 10. Sequencing | ||
+ | 11. Named the correct vectors( for convenient description) | ||
+ | GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, | ||
+ | GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, | ||
+ | GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, GALTOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010. | ||
+ | <ul><li>III. Third Vector Construction</li></ul> | ||
+ | 1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml | ||
+ | centrifuge tube, shake at 37 ℃, 220 rpm overnight. | ||
+ | GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, | ||
+ | GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, | ||
+ | GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, | ||
+ | GAL-TOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010(kan resistant) | ||
+ | BBa-J63002(Amp resistant, yeast ADH terminator) | ||
+ | 2. Extract plasmid | ||
+ | 3. Measure plasmid concentration | ||
+ | 4. Digestion SpeI and PstI with 10X H Buffer: | ||
+ | GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, | ||
+ | GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, | ||
+ | GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, | ||
+ | GAL-TOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010 | ||
+ | XbaI and PstI with 10X H Buffer: | ||
+ | BBa-J63002 | ||
+ | 5. Gel electrophoresis, recycle and measure plasmid concentration | ||
+ | 6. Ligation | ||
+ | GAL-ZIM17-E0030, GAL-ZIM17-E1010, GAL-FER-E0030, | ||
+ | GAL-FER-E1010, GAL-TIM2-E0030, GAL-TIM2-E1010, GAL-TOM22-E0030, | ||
+ | GAL-TOM22-E1010, GAL-TOM70-E0030, GAL-TOM70-E1010, GAL-TOM20-E0030, | ||
+ | GAL-TOM20-E1010, GAL-Tom40-E0030, GAL-Tom40-E1010 | ||
+ | 2ul respectively ligating with BBa-J63002 6ul. | ||
+ | 7. Transformation | ||
+ | 8. PCR | ||
+ | 9. Shake culture | ||
+ | 10. Sequencing | ||
+ | 11. Named the correct vectors( for convenient description) | ||
+ | GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-sp|P07839| | ||
+ | 1-32-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, | ||
+ | GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GALTOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GALTOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002 | ||
+ | <ul><li>IV. Construction of yeast expression vector</li></ul> | ||
+ | 1. Mix the strain which containing following carrier and 4 ml of LB+AMP liquid medium in 15 ml | ||
+ | centrifuge tube, shake at 37 ℃, 220 rpm overnight | ||
+ | GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-sp|P07839| | ||
+ | 1-32-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, | ||
+ | GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GALTOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GALTOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002(kan | ||
+ | resistant) | ||
+ | YEP352(Amp resistant, yeast ADH terminator) | ||
+ | 2. Extract plasmid | ||
+ | 3. Measure plasmid concentration | ||
+ | 4. Digestion | ||
+ | XbaI and PstI: | ||
+ | GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-sp|P07839| | ||
+ | 1-32-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, | ||
+ | GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, GALTOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, GAL-TOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002, YEP352 | ||
+ | 5. Gel electrophoresis, recycle and measure plasmid concentration | ||
+ | 6. Ligation | ||
+ | GAL-ZIM17-E0030-J63002, GAL-ZIM17-E1010-J63002, GAL-sp|P07839| | ||
+ | 1-32-E0030-J63002, GAL-FER-E1010-J63002, GAL-TIM2-E0030-J63002, | ||
+ | GAL-TIM2-E1010-J63002, GAL-TOM22-E0030-J63002, GAL-TOM22-E1010-J63002, | ||
+ | GAL-TOM70-E0030-J63002, GAL-TOM70-E1010-J63002, GAL-TOM20-E0030-J63002, | ||
+ | GAL-TOM20-E1010-J63002, GAL-Tom40-E0030-J63002, GAL-Tom40-E1010-J63002 6ul | ||
+ | respectively ligating with YEP532 2ul. | ||
+ | 7. Transformation | ||
+ | 8. PCR | ||
+ | 9. Shake culture | ||
+ | 10. Sequencing | ||
+ | 11. Named the correct vectors( for convenient description) | ||
+ | YEP-GAL-ZIM17-E0030-J63002, YEP-GAL-ZIM17-E1010-J63002, YEPGAL-FER-E0030-J63002, YEP-GAL-FER-E1010-J63002, YEP-GALTIM2-E0030-J63002, YEP-GAL-TIM2-E1010-J63002, YEP-GAL-TOM22-E0030-J63002, | ||
+ | YEP-GAL-TOM22-E1010-J63002, YEP-GAL-TOM70-E0030-J63002, YEP-GAL-TOM70- | ||
+ | E1010-J63002, YEP-GAL-TOM20-E0030-J63002, YEP-GAL-TOM20-E1010-J63002, YEPGAL-Tom40-E0030-J63002, YEP-GAL-Tom40-E1010-J63002 | ||
+ | <ul><li>V. Yeast transformation</li></ul> | ||
+ | 1. Extract plasmid | ||
+ | YEP-GAL-ZIM17-E0030-J63002, YEP-GAL-ZIM17-E1010-J63002, YEPGAL-FER-E0030-J63002, YEP-GAL-FER-E1010-J63002, YEP-GALTIM2-E0030-J63002, YEP-GAL-TIM2-E1010-J63002, YEP-GAL-TOM22-E0030-J63002, | ||
+ | YEP-GAL-TOM22-E1010-J63002, YEP-GAL-TOM70-E0030-J63002, YEP-GAL-TOM70- | ||
+ | E1010-J63002, YEP-GAL-TOM20-E0030-J63002, YEP-GAL-TOM20-E1010-J63002, YEPGAL-Tom40-E0030-J63002, YEP-GAL-Tom40-E1010-J63002 | ||
+ | 2. Preparation of yeast competent | ||
+ | (1). Streak a YPDA agar plate with a small portion of AH109 or | ||
+ | Y187. Incubate the plate upside down at 30°C until colonies appear(~3days). Yeast | ||
+ | strains can be stored for up to 1 month at 4°C on YPDA medium in culture | ||
+ | plates | ||
+ | (2).Prepare 1.1X TE/LiAc Solution | ||
+ | (3).Prepare YPDA liquid medium (Yeast Protocols Handbook) | ||
+ | (4).Inoculate one colony(<4 weeks old, 2–3mm in diameter) into 3ml of YPDA | ||
+ | medium in a sterile, 15-ml centrifuge tube. | ||
+ | (5).Incubate at 30°C with shaking for 8hr. | ||
+ | (6).Transfer 5µl of the culture to a 250-ml flask containing 50ml of YPDA. | ||
+ | (7).Incubate at 30°C with shaking at 230–250 rpm for 16–20hr.The OD600 should reach | ||
+ | 0.15–0.3. | ||
+ | (8).Centrifuge the cells at 700 x g for 5min at room temperature. | ||
+ | (9).Discard the supernatant and resuspend the cell pellet in 100 ml of YPDA.(10).Incubate at 30°C for 3–5hr(OD600= 0.4–0.5). | ||
+ | (11).Centrifuge the cells at 700 x g for 5min at room temperature. | ||
+ | (12).Discard the supernatant and resuspend the cell pellet in 60ml of sterile, | ||
+ | deionized H2O. | ||
+ | (13).Centrifuge the cells at 700 x g for 5min at room temperature. | ||
+ | (14).Discard the supernatant and resuspend the cells in 3 ml of 1.1 X TE/LiAc Solution. | ||
+ | (15).Split the resuspension between two 1.5-ml microcentrifuge tubes (1.5 ml per | ||
+ | tube). | ||
+ | (16).Centrifuge each tube at high speed for 15 sec. | ||
+ | (17).Discard the supernatant and resuspend each pellet in 600 µl of 1.1 X TE/LiAc | ||
+ | Solution. | ||
+ | 3. Transformation | ||
+ | (1). 1.5ml centrifuge: | ||
+ | plasmid 0.2ug | ||
+ | Sperm DNA*(10 mg/ml) 0.1mg | ||
+ | *Sperm DNA When freshly prepared water bath boil for 20 minutes, and immediately inserted | ||
+ | into the ice bath and stored at -20 °C | ||
+ | (2). Add 100 ul with 1 × TE / LiAc resuspended yeast competent cells per tube, mixed with | ||
+ | shaking; | ||
+ | (3). Each added 600ul PEG / LiAc, shaken vigorously (to improve the conversion efficiency), | ||
+ | 30 °C, 200 rpm shaking culture 30 min; | ||
+ | (4). Each adding 70 ul DMSO, slowly inverted mix (not oscillating), 42 °C water bath thermal | ||
+ | shock 15 min, insert into the ice bath to cool 1-2 min; | ||
+ | (5). 14,000rpm × 5 sec, discard supernatant, resuspend cells with 0.1 ml 1×TE, overlay on SD/- | ||
+ | Ura solid medium, 30°C inverted culture 3 days in incubator. | ||
+ | 4. Check out | ||
+ | Draw the colonies grown on the said plate in the galactose-containing SD/-Ura solid plates, | ||
+ | until the colonies grow, single colonies were picked, and microscopic examination under a | ||
+ | fluorescence microscope and record the results. | ||
</div> | </div> | ||
{{:Team:Shenzhen/Temp/gallery.htm}} | {{:Team:Shenzhen/Temp/gallery.htm}} |
Revision as of 08:09, 25 September 2012