Team:LMU-Munich/Data/Vectors

pSB_Bs1C

pSB_Bs1C is one of our empty vectors. It integrates into the amyE locus of Bacillus subtilis and carries a Chloramphenicol resistance as well as an Ampicillin resistance for E. coli. Inbetween the two recombination sites, there is the constitutively expressed Cm resistance and the multiple cloning site which contains RFP to simplify the insertion of your BioBrick.

The plasmid is then transformed into B. subtilis and checked via the resistance for "integration at all" and via a starch test for "integration into the right locus". Please note that the colonies without a bright surounding are correct.

We tested this vector with various inserts, for example the final construct of our Sporobeads with GFP. The starch test shows that the insertion in in the amyE locus and fluorescence microscopy reveals the functionality of the construct.

pSB_Bs4S

pSB_Bs4S also is an empty vector with only the multiple cloning site and the spectinomycine resistence gene in between the homologous regions. This vector integrates into the thrC locus of B. subtilis.

We tested the integration of this plasmid with the threonine test and a construct from the Suicideswitch as insert.

pSB_Bs2E

pSB_Bs2E is our third empty vector, aiming to provide a set of three empty vectors with three different integration loci and three different resistances for full flexibility in their combinations.

This vector is still in work. By now, only the multiple cloning site is missing. Of course, it is not tested yet.

pSB_Bs1C-lacZ

pSB_Bs1C-lacZ is a reporter vector which includes a ribosome binding site, a β-galactosidase (lacZ) and a terminator downstream of the multiple cloning site. Also, a chloramphenicol resistance is in between the two flanking homolgy regions. This vector integrates into the amyE locus which is tested by the starch test.

This vector was used for several promoter evaluations.

pSB_Bs3C-luxABCDE

pSB_Bs3C-luxABCDE is our second reporter vector. Downstream of the multiple cloning site, there are a ribosome binding site, the luxABCDE operon and a terminator. Also, a chloramphenicol resistance is in between the two flanking homolgy regions. This vector integrates into the sacA locus of B. subtilis which is tested for by colony PCR.

One primer is located outside of the region and its respective partner is located on the inegrative part of the vector, facing outwards. gDNA from W168 as a negative control should not give a PCR product.

A pre version of this vector with one in BioBrick standard forbidden PstI site was used for several promoter evaluations. All graphs that you can find in the Data section of the promoters derive from this pre version of the vector. To show that our last version of this vector also works we did another experiment where we compared the luminescence of P_lepA in the "old" vector with the version whithout any forbidden sites. Here you can see the results of this experiment:

In this experiment with the same promoter P_lepA the finished vector showed about half of the activity of the pre version where there was still one forbidden PstI site left.</p>

pSB_Bs4S-P_Xyl

CAUTION: DOES NOT WORK! CANNOT BE TRANSFORMED INTO B. SUBTILIS

pSB_Bs4S-P_Xyl is an integrative expression vector. Upstream of the multiple cloning site, there is P_Xyl, a xylose-inducible promoter, and downstream there is a terminator. In absence of Xylose, P_Xyl is blocked by the repressor XylR which is expressed in B. subtilis and not part of this vector. Apart from that, also a spectinomycine resistance is located in between the two recombination sites. This vector integrates into the thrC locus which is checked for by the threonine test.

However, we could not manage to transform this vector into B. subtilis, although we tried three times. Also the team from Groningen tested this vector, but was not able to transform it into B. subtilis, either.

pSB_Bs0K-P_spac

CAUTION: THIS VECTOR DOES NOT WORK AS EXPECTED! THE PROMOTER IS STRONG CONSTITUTIVE INSTEAD OF IPTG-INDUCIBLE!

pSB_Bs0K-P_spac is a replicative expression vector with a kanamycin resistance. The IPTG (isopropylbeta-D-thiogalactopyranoside)-inducible Promoter P_spac is followed by the multiple cloning site and a terminator. Also expressed are lacY, a transporter for IPTG (naturally allolactose), and lac, the repressor. In presence of IPTG, LacI releases from the promoter and the gene of interest is expressed.

The ble gene encodes the bleomycin resisitance protein (BRP) which can be selected for by bleomycine or phleomycin in E. coli and B. subtilis. We did not use this resistance.

The presence of the vector can be checked for via colony PCR with the primers: CTACATCCAGAACAACCTCTGC and TTCGGAAGGAAATGATGACCTC. We did not perfom the colony PCR because we selected for functionality on plates with X-Gal and IPTG and we got blue colonies.

lacZ-activity in Miller units in pSBBs0K-Pspac depending on B. subtilis growth phase. This expression vector was tested by insertion of lacZ into the multiple cloning site, transformation into W168 and ONPG assays. Overnight cultures were diluted 1:100 in LB-medium and incubated at 37°C, 230 rpm. Cells were harvested in 2 ml reaction tubes and frozen. For the induction assay, at an OD600 around 0.9 were split into 3 ml aliquots in test tubes with the given IPTG-concentrations and incubated for another hour. Data for splitting at OD600 around 0.3 is not shown, but similar. In summary, the figures show that the expression is very strong, even without induction [in comparison to the native B. subtilis promoters] and does not change with IPTG addition. It does change depending on the growth phase, with a maximum strength in the stationary phase. This vector was designed for overexpression of proteins, but is not inducible but constitutively active. Sporovector