Team:Cornell/testing/project/wetlab/4/3

From 2012.igem.org

(Difference between revisions)
 
Line 72: Line 72:
<div class="row last-ele">
<div class="row last-ele">
<div class="three columns">
<div class="three columns">
-
<img src="http://placehold.it/250x250/331642">
+
<img src="http://2012.igem.org/wiki/images/c/ce/Cornell12_Stock_4.jpg">
</div>
</div>
<div class="nine columns">
<div class="nine columns">

Latest revision as of 03:27, 4 October 2012

qPCR

RT-qPCR

We are currently using two-step RT-qPCR to confirm that our engineered Shewanella strains respond to arsenic and naphthalene. Total RNA will be isolated using the E.Z.N.A.™ Bacterial RNA Isolation Kit from Omega bio-tek; cDNA will be synthesized using the qScript™ Flex cDNA Kit from Quanta Biosciences; and we are using the ABI ViiA7 platform along with the KAPA SYBR(R) FAST qPCR Kit from KAPA Biosystems. Our primers are as follows:

FOR_enzA: CAGCCTTTTACCCAAGGTGA
REV_enzA: CACGATTCGAGAGGGTGATT
FOR_RecA: TTCCCCTCGACATTGTCATCATCGGA
REV_RecA: AAGGGCGATAAAATTGGTCAAGGCCG
3'_FOR_qPCR_mtrB: ACGCTCAATATCAAGCCACCGAGA
3'_REV_qPCR_mtrB: TGTGCGGTGTAGTCATGGCTGT