Team:Shenzhen/Result/YAO.Suicider

1. Plasmid extraction for T-Gal, T-holin

2. PCR amplification of linear vector PSB1C3, purification(Qiagen PCR purification kits)

3. Digestion:

    T-GAL1    2ug

    ECoRI2ul

    SpeI    2ul

    10 x H Buffer    5ul

    ddH2O50ul

    T-holin    2ug

    XbaI    2ul

    PstI    2ul

    10 x H    5ul

    ddH2O    50ul

    purified backbone PSB1C3    1ug

    ECoRI    2ul

    PstI    2ul

    10 x H Buffer    5ul

    ddH2O    50ul

    37oC    1h

    80oC    20min

4. Electrophoresis:

    1% agarose gel, 120V, after 45min,EB dye.

5. Gel recovery of GAL(EcoRI/SpeI), Holin(XbaI/PstI) (Qiagen Gel recovery kits)

6. Linage:

    PSB1C3    2ul

    GAL1( ECoRI / SpeI)    100ng

    Holin（ XbaI/PstI)    100ng

    T4 buffer    1ul

    T4 ligase    1ul

    ddH2O    10ul

    16 oC    overnight

7. Transduction:

    1. UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

    2. 10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

    3. 42oC ice-bath heat shock for 50s.

    4. Stewing on ice for 2mins.

    5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

    6. 3000rpm/min for 5mins, abandon the supermate, mixing the left.

    7. 60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

8.Colony PCR:

    dNTPmix(2.5mM)    1μl

    PCR 10×buffer    2μl

    VF    0.5μl

    VR    0.5μl

    Ex Taq    0.5μl

    H2O    15.5μl

    Primer    

        VF: TGCCACCTGACGTCTAAGAA

        VR:ATTACCGCCTTTGAGTGAGC

    94℃    3min

    94℃    30s

    55℃    30s

    72℃    1min

    72℃    10min

    12℃    ∞

    30 cycles

9. 1%~1.5% agarose gel electrophoresis, <130V, 40mins.

10. Sequencing:

    Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector PSB1C3-GAL

1. Plasmid extraction: BBa-J63002(ADH terminator）, PSB1C3-GAL1-Holin.

2. Digestion:

    BBa-J63002     2ug    

    XbaI     2ul    

    PstI     2ul        

    10 x H Buffer    5ul    

    ddH2O    50ul    

    37oC    1h        

    PSB1C3-GAL1-Holin    2ug

    SpeI    2ul

    PstI    2ul

    10 x H Buffer    5ul     <p>    ddH2O    50ul

    80oC    20min

3. Electrophoresis:

    1% agarose gel, 120V, after 45min,EB dye.

4. Gel recovery of BBa-J63002 (XbaI /PstI),PSB1C3-GAL1-Holin(SpeI/ PstI) (Qiagen Gel recovery kits)

5. Linkage:

    PSB1C3-GAL1-Holin(SpeI/ PstI)    100ng

    BBa-J63002 (XbaI /PstI)    100ng

    T4 buffer    1ul

    T4 ligase    1ul

    ddH2O    10ul

    16 oC overnight

6. Transduction:

    1. UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

    2. 10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

    3. 42oC ice-bath heat shock for 50s.

    4. Stewing on ice for 2mins.

    5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

    6. 3000rpm/min for 5mins, abandon the supermate, mixing the left.

    7. 60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

7. Colony PCR:

    dNTPmix(2.5mM)v1μl

    PCR 10×buffer    2μl

    VF    0.5μl

    VR    0.5μl

    Ex Taq    0.5μl

    H2O    15.5μl

    Primer

        VF: TGCCACCTGACGTCTAAGAA

        VR: ATTACCGCCTTTGAGTGAGC

    94℃    3min

    94℃    30s

    55℃    30s     <p>    72℃    1.5min

    72℃    10min

    12℃    ∞

    30 cycles

8. 1%~1.5% agarose gel electrophoresis, <130V, 40mins.

9. Sequencing:

    Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector PSB1C3-GAL1, Holin-ADH1

1. Culture of PSB1C3-GAL1-Holin-ADH1 (Cmr resistant) YEP352 (AmpResistant)

2. Plasmid extraction: PSB1C3-GAL1-Holin-ADH1，YEP352

3. Digestion:

         YEP352             2ug    

         XbaI                 2ul    

         PstI                     2ul    

         10 x H Buffer        5ul    

         ddH2O             50ul    

PSB1C3-GAL1-Holin-ADH1 2ug

XbaI                                        2ul

PstI                                         2ul

10 x H Buffer                             5ul    

ddH2O                                     50ul

4. Electrophoresis:

1% agarose gel, 120V, after 45min,EB dye.

5. Gel recovery of YEP352 (XbaI /PstI),PSB1C3-GAL1-Holin-ADH1(XbaI / PstI) (Qiagen Gel recovery kits)

6. Lingake:

        YEP352 (XbaI /PstI)                                    100ng

        PSB1C3-GAL1-Holin-ADH1(XbaI / PstI) 100ng

         T4 buffer                                                     1ul

         T4 ligase                                                     1ul

        ddH2O                                                    10ul

         16oC                                                     overnight

7. Transduction:

1.     UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

2.     10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

3.     42oC ice-bath heat shock for 50s.

4.     Stewing on ice for 2mins.

5.     Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

6.     3000rpm/min for 5mins, abandon the supermate, mixing the left.

7.     60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

8. Clony PCR: <p>                 dNTPmix(2.5mM)         1μl

                 PCR 10×buffer                2μl

                 M13_pUC_fwd_primer 0.5μl

                 M13_reverse_primer     0.5μl

                 Ex Taq                            0.5μl

                 H2O                             15.5μl

                 94℃                             3min

                 94℃     30s

                 55℃     30s

                 72℃     1.5min

                 72℃     10min

                 12℃     ∞

            30 cycles

9. 1.5% agarose gel electrophoresis, <130V, 40mins.

10. Sequencing:

        Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector:EP352-GAL1,

        Holin-ADH1

• IV. Yeast transformation experiment:

1. plasmid extraction.

2. Preparation of Competent Yeast Cells—LiAc Method

        1.treak a YPDA agar plate with     a small portion of     AH109 or Y187. Incubate the plate upside down at 30°C until colonies appear(~3days).     Yeast strains can be stored for up to 1 month at     4°C on    YPDA medium in culture plates    

        2.Prepare 1.1X     TE/LiAc Solution

        3.Prepare YPDA liquid medium     (Yeast Protocols Handbook)

        4.Inoculate one colony(<4 weeks old, 2–3mm in diameter) into 3ml of YPDA medium in a sterile, 15-ml centrifuge tube.

        5.Incubate at 30°C with shaking    for 8hr.

        6.Transfer 5µl of the culture to a 250-ml flask containing 50ml of YPDA.

        7.Incubate at 30°C with shaking at 230–250 rpm for 16–20hr.The OD600 should reach 0.15–0.3.

        8.Centrifuge the cells at 700 x g for 5min at     room temperature.

        9.Discard the supernatant and resuspend the cell pellet in 100 ml of YPDA.

        10.Incubate at 30°C for 3–5hr     (OD600= 0.4–0.5).

        11.Centrifuge the cells at 700 x g for 5min at room temperature.

        12.Discard the supernatant and resuspend the cell pellet in 60ml of sterile, deionized H2O.

        13.Centrifuge the cells at 700 x g for 5min at room temperature.

        14.Discard the supernatant and resuspend the cells in 3     ml of 1.1 X TE/LiAc Solution.

        15.Split the resuspension between two 1.5-ml microcentrifuge tubes (1.5 ml per tube).

        16.Centrifuge each tube at high speed for 15     sec.

        17.Discard the supernatant and resuspend each pellet in 600     µl of     1.1 X TE/LiAc Solution.

3.Transformation:

    1. plasmid                                     0.2ug

         Sperm DNA*(10 mg/ml)                     0.1mg

Sperm DNA  :when prepared, water-bath boiling for 20mins, then ice-bath, -20°C preservation.

    2. 100 ul dense medium of yeast competent cell by 1×TE/LiAc. Whirlpool oscillation.

    3. 600 ulPEG/LiAc, oscillation strongly, 30°C,200rpm, culture oscillating for 30mins.

    5. Centrifuging for 14,000rpm for 5sec, abandon the supermate, 0.1ml 1x TE suspense the cell precipitation, spread it to SD/Ura solid plat, 30°C culture reversely for 3 days.

        6. Holin function identification:

Pick a better-cultured colony and inoculate it to 50ml YPDA medium, 30°C,220rpm culture reelingly to OD-0.1, transfer 20ml to 50ml sterile medium (alpha-galactose), versus is         added by equivalent water. Measuring the OD value one time for one hour and drawing the curve.

Result analyzation:

If the bacteria in alpha-galactose grow slower that in water, that shows holing can work.

</div> </div>