Team:TU Munich/Project/Caffeine

From 2012.igem.org

Revision as of 01:01, 25 September 2012 by VolkerMorath (Talk | contribs)


Contents

Caffeine


Responsible: Saskia König, Roman Prechtl and Dennis Hell
Hops is not only one of the main ingredients of beer it also is responsible for the sedative effect of beer ([http://www.ncbi.nlm.nih.gov/pubmed/22849837| Franco et al. 2012]).

In contrast, caffeine wards of drowsiness and already enjoys great popularity as additive in a multitude of beverages. As hops is essential to the brewing process, omitting is not an option. This makes caffeine a desirable agent to counteract the soporific effect of beer.


Background and principles


Caffeine is a purine-alkaloid and its biosynthesis is known in coffee plants and tea plants, for example. Its
Caffeine and Adenosine
chemical structure is similar to the ribonucleoside adenosine. Hence it can block specific receptors in the hypothalamus in a competitive manner, which leads to decreased neurotransmitter-release and therefore decreased neuron activity. Biological background is to beware the brain of overexertion by inducing sleep and that is the reason for using caffeine to stay awake. On average, one cup of coffee contains about 50 - 130 mg Caffeine.

At higher doses (1g), caffeine leads to higher pulse rates and hyperactivity, but until that, the beer will already have done its work... Caffeine was shown to decrease the growth of E. Coli and Yeast reversibly as of a concentration of 0.1% by acting as a mutagen (Putrament et al., On the Specificity of Caffeine Effects, MGG, 1972), but previous caffeine synthesis experiments (see below) have only led to a concentration of about 5 µg/g (per g fresh weight of tobacco leaves), so we do not expect to reach critical concentrations. It has already been achieved to produce caffeine in tobacco plants (Uefuji et al., 2005; Yun- Soo Kim et al., 2007), but has never been performed in yeast.

Biosynthetic Pathway of Caffeine in Plants

Biosynthesis

The biosynthetic pathway of caffeine (1,3,7 Trimethylxanthine) starts with xanthosine, which is a natural component of the purine- metabolism of all organism. Necessary for its production are three distinct N- methyl transferases and one nucleosidase, whereupon it has not been totally elucidated whether the nucleosidase reaction is catalyzed by any purine nucleosidase or by the first N- methyl transferase of the reaction cascade shown in the picture (but the latter assumption is favoured (H. Ashihara et al., 2008), because an in vitro synthesis of caffeine with the three N- methyl transferases has already been shown). The enzyme caffeine synthase (last reaction step) can catalyze both, the conversion of 7- methyl xanthine to theobromine and the methylation of theobromine to caffeine. This is true, indeed, but Uefuji et al. (2003) showed, that the affinity to 7- methyl xanthosine is less than one sixth of that of CaMXMT1 (there are two isoformes of CaMXMT), so it is much better to express both enzymes. One can also see the Km values for the required enzymes in this paper - it shows that the substrate affinity decreases continiously towards the endpoint (caffeine), "making the reaction proceed irreversibly and stepwise" (Uefuji et al., 2003, p.377).

Xanthosine routes

The chemical compound xanthosine is produced via at least four different routes, shown in the picture "xanthosine routes". To improve caffeine production, these pathways could be a possible target for metabolic engineering. Anyway it should be interesting/ necessary for this project to determine the in vivo xanthosine concentration of yeast.

Bildbeschreibung

Catabolism

  • please delete this heading to ensure unity in all our pages

Caffeine is demethylated to theophylline by 7N-demethylase (main pathway). The decreased rate of this reaction is the reason for accumulating caffeine in the plant. Afterwards, theophylline is degraded to xanthine via 3-methylxanthine and xanthine enters the conventional purine catabolism pathway (degradation to CO2 and NH3) (see H. Ashihara et al., 2008, p. 846). This catabolistic pathway is another possible target for metabolic engineering to increase the amount of caffeine.

The molecular and physiological effects of caffeine


Results


BioBricks

  • include here all the informations about the enzymes

Characterization

Gene expression

The expression of the three neccessary enzymes involved in caffeine biosynthesis will be prooved by SDS page and Western Blot analysis, making use of the Strep-tag II and a detection system based on two antibodies: StrepMAB-Classic (from mouse) and an Anti-Mouse-alk. phosphatase conjugate.

Enzyme-function

First of all, the function of the three enzymes will be demonstrated in vitro in a combinated reaction batch, containing all three enzymes. After adding the initial substrate xanthosine, we will detect the synthesized caffeine after organic extraction and HPLC separation (densitometrically).

Function of expression cartridge and membran-permeability of compounds

At first, the fuction of our expression cartridge will be prooved by Western Blot analysis, as mentioned above. To investigate wether both, the initial substrate xanthosine and the final product caffeine are able to penetrate the yeast cell wall, we will apply the substrate xanthosine to a cell suspension, in which the cells contain our created "caffeine synthesis biobrick" with the constitutive promoters Tef1 and Tef2. Caffeine presence will be detected as mentioned above.

Toxicity Assay

Evaluation of the Toxicity Assay for Caffeine.

References


  • Putrament et al., On the Specificity of Caffeine Effects, MGG, 1972
  • H. Uefuji et al., Plant Physiology, 2003, Vol. 132, pp. 372–380
  • H. Uefuji et al., Plant Molecular Biology, 2005, Vol. 59, p. 221–227
  • H. Ashihara et al., Phytochemistry, 2008, Vol. 69, p. 841–856
  • Yun-Soo Kim, Hiroshi Sano, Phytochemistry, 2008, Vol. 69, p. 882–888
  • Franco et al., 2012



older blocks

- please integrate the informations into the other blocks and delete the sequences here (copy them into the registry)


Idea


The idea is to perform a heterologous gene expression of the distinct N-methyl transferases required for caffeine biosynthesis. At first, this will be accomplished by cloning each gene in a single, RFC25 compatible pYES2 vector, which will be created by the iGEM- team TU- Munich 2012. Expression will be proofed by western blot analysis, making use of a strep-tagII. Simultaneously, we will construct composite parts, each consisting of coding sequence, Adh1 terminator and a constitutive promoter with appropriate strength. The chosen promoters are Tef2 for CaXMT1 and CaDXMT1 and Tef1 for CaMXMT1. This decission was made with respect to the fact, that the synthesis of caffeine shall be an irreversible reaction. In vivo, this irreversibility is realized by continuously increasing Km values (Km(CaXMT1) < Km(CaMXMT1) < Km(CaDXMT1)); as soon as a certain amount of theobromine is available, the caffeine synthesis can go on. We will support this stepwise reaction- principle by using the strongest promoter for the theobromine synthesis (performed by CaMXMT1), resulting in higher concentrations of this chemical compound and making the last reaction step irreversible. In order to limit the metabolic stress, we will use the weaker Tef2 promoter for the first and last enzymes CaXMT1 and CaDXMT1, although it could theoretically lead to higher amounts of caffeine, when using a stronger initial promoter. Finally, we will fuse all these three composite parts and create the "caffeine synthesis device", which can be used for genome integration in yeasts.

The research groups which accomplished caffeine production in transgenic tobacco plants used the following three genes:

  • CaMXMT1 (AB048794)
    • UniProt entry: Q9AVJ9
    • 2.1.1.159
    • This gene is eventually not essential, for CaDXMT1 is able to catalyze this reaction, too.
    • Complete mRNA- sequence: http://www.ncbi.nlm.nih.gov/nuccore/AB048794 CaMXMT1 (coffea arabica)
    • Coding sequence: bp 32 - 1168 ==> total length: 1137 bp
    • Problematic restriction sites: EcoR1 at bp 722- 728


All mentionend methyltransferases use SAM als methyl- donor and are located in the cytoplasm of the plants. Furthermore they exist as homodimers, being also able to form heterodimers with each other (see http://www.brenda-enzymes.info BRENDA, also for further characteristics). The temperature and pH optimum of all three enzymes is quite similar between 20°C - 37°C and 7,5 - 8,5, respectively (beer brewing: slightly acid).

General remarks and issues


Analytical Methods

Gene Expression

To increase gene expression, we are taking care about the following aspects:

  • N-end rule
  • codon optimization
  • yeast consensus sequence for improved ribosome binding
  • use of adequate promoters

Since all enzymes are localized in the cytoplasm, they should all be soluble.

Ordered Sequences

The sequences were ordered and synthesized by GeneArt and constructed as follows:

  • the 5' UTR and 3' UTR of the sequences above were removed
  • the yeast consensus sequence for improved ribosome binding (TACACA) was added 5' of the start codon ATG
  • according to N- end rule and the yeast consensus sequence for improved ribosome binding, the first triplet after ATG (GAG) was exchanged with TCT (serine), to optimize both, protein stability and mRNA translation. This decision was made after proofing the 3D- structure of the enzyme CaDXMT1. Due to the fact, that the the first two residues of the amino acid sequence are not shown in the crystalized structure (probably because of high flexibility), Prof. Skerra said we can risk the exchange of this amino acid, for it is probably not that necessary for the uptake of the ligands (uniprot entry further shows, that it is not immediately involved in ligand binding in one of the three enzymes). Because of the high similarity of the enzyme- sequences, we also exchanged this amino acid in the enzyme CaMXMT1, although here is no 3D- structure available
  • we added a c- terminal strep-tag for purification
  • the remaining coding sequence was extended with the standard RFC10 prefix and suffix, respectively
  • at last we made an optimization of the coding sequences with respect to the codon usage and mRNA structures (online tool of a gene- synthesis company)
  • annotated sequences:

CaXMT1

Show/hide sequence

              10        20        30        40        50        60        70        80        90        100
               *         *         *         *         *         *         *         *         *         *
    1 gaattcgcggccgcttctagagtacacaatgtctttacaagaagtcttgagaatgaacggtggtgaaggtgatacttcttacgctaaaaactccgcctac 100
      cttaagcgccggcgaagatctcatgtgttacagaaatgttcttcagaactcttacttgccaccacttccactatgaagaatgcgatttttgaggcggatg
                                  M  S  L  Q  E  V  L  R  M  N  G  G  E  G  D  T  S  Y  A  K  N  S  A  Y  
                                  1
      >>>>>>>>>>>>>>>>>>>>>>      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      RFC10 Prefix                CaXMT1_Strep-tag
                            >>>>>>>>>>>>
                            RBS Yeast Consensus Sequence
              110       120       130       140       150       160       170       180       190       200
               *         *         *         *         *         *         *         *         *         *
  101 aatcaattggttttggctaaagttaagccagtcttggaacaatgcgtcagagaattattgagagctaacttgccaaacatcaacaagtgcattaaggttg 200
      ttagttaaccaaaaccgatttcaattcggtcagaaccttgttacgcagtctcttaataactctcgattgaacggtttgtagttgttcacgtaattccaac
      N  Q  L  V  L  A  K  V  K  P  V  L  E  Q  C  V  R  E  L  L  R  A  N  L  P  N  I  N  K  C  I  K  V  A
      25
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaXMT1_Strep-tag
              210       220       230       240       250       260       270       280       290       300
               *         *         *         *         *         *         *         *         *         *
  201 ctgatttgggttgtgcttctggtccaaatactttgttgactgttagagacatcgtccaatccattgataaggttggtcaagaaaagaagaacgaattgga 300
      gactaaacccaacacgaagaccaggtttatgaaacaactgacaatctctgtagcaggttaggtaactattccaaccagttcttttcttcttgcttaacct
        D  L  G  C  A  S  G  P  N  T  L  L  T  V  R  D  I  V  Q  S  I  D  K  V  G  Q  E  K  K  N  E  L  E 
      59
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaXMT1_Strep-tag
              310       320       330       340       350       360       370       380       390       400
               *         *         *         *         *         *         *         *         *         *
  301 aagaccaaccatccaaattttcttgaacgacttgttcccaaacgacttcaactctgtttttaagttgttgccatccttctacagaaagttggaaaaagaa 400
      ttctggttggtaggtttaaaagaacttgctgaacaagggtttgctgaagttgagacaaaaattcaacaacggtaggaagatgtctttcaacctttttctt
       R  P  T  I  Q  I  F  L  N  D  L  F  P  N  D  F  N  S  V  F  K  L  L  P  S  F  Y  R  K  L  E  K  E  
      92
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaXMT1_Strep-tag
              410       420       430       440       450       460       470       480       490       500
               *         *         *         *         *         *         *         *         *         *
  401 aacggtagaaagatcggttcctgtttgattggtgctatgccaggttctttctactccagattatttcctgaagaatccatgcatttcttgcactcttgtt 500
      ttgccatctttctagccaaggacaaactaaccacgatacggtccaagaaagatgaggtctaataaaggacttcttaggtacgtaaagaacgtgagaacaa
      N  G  R  K  I  G  S  C  L  I  G  A  M  P  G  S  F  Y  S  R  L  F  P  E  E  S  M  H  F  L  H  S  C  Y
      125
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaXMT1_Strep-tag
              510       520       530       540       550       560       570       580       590       600
               *         *         *         *         *         *         *         *         *         *
  501 attgcttgcaatggttgtctcaagttccatctggtttggttactgaattgggtatttctaccaacaagggttccatctactcttctaaagcttcaagatt 600
      taacgaacgttaccaacagagttcaaggtagaccaaaccaatgacttaacccataaagatggttgttcccaaggtagatgagaagatttcgaagttctaa
        C  L  Q  W  L  S  Q  V  P  S  G  L  V  T  E  L  G  I  S  T  N  K  G  S  I  Y  S  S  K  A  S  R  L 
      159
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaXMT1_Strep-tag
              610       620       630       640       650       660       670       680       690       700
               *         *         *         *         *         *         *         *         *         *
  601 gccagttcaaaaggcctacttggatcaattcactaaggatttcaccacctttttgagaatccactccgaagaattattctcccacggtagaatgttgttg 700
      cggtcaagttttccggatgaacctagttaagtgattcctaaagtggtggaaaaactcttaggtgaggcttcttaataagagggtgccatcttacaacaac
       P  V  Q  K  A  Y  L  D  Q  F  T  K  D  F  T  T  F  L  R  I  H  S  E  E  L  F  S  H  G  R  M  L  L  
      192
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaXMT1_Strep-tag
              710       720       730       740       750       760       770       780       790       800
               *         *         *         *         *         *         *         *         *         *
  701 acctgtatatgtaagggtgttgaattggatgctagaaacgccattgatttgttggaaatggctatcaacgatttggttgttgaaggtcacttagaagaag 800
      tggacatatacattcccacaacttaacctacgatctttgcggtaactaaacaacctttaccgatagttgctaaaccaacaacttccagtgaatcttcttc
      T  C  I  C  K  G  V  E  L  D  A  R  N  A  I  D  L  L  E  M  A  I  N  D  L  V  V  E  G  H  L  E  E  E
      225
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaXMT1_Strep-tag
              810       820       830       840       850       860       870       880       890       900
               *         *         *         *         *         *         *         *         *         *
  801 aaaagttggactctttcaacttgccagtttacattccatctgccgaagaagttaagtgcatcgttgaagaagaaggttccttcgaaatcttgtacttgga 900
      ttttcaacctgagaaagttgaacggtcaaatgtaaggtagacggcttcttcaattcacgtagcaacttcttcttccaaggaagctttagaacatgaacct
        K  L  D  S  F  N  L  P  V  Y  I  P  S  A  E  E  V  K  C  I  V  E  E  E  G  S  F  E  I  L  Y  L  E 
      259
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaXMT1_Strep-tag
              910       920       930       940       950       960       970       980       990      1000
               *         *         *         *         *         *         *         *         *         *
  901 aactttcaaggtcttgtacgatgccggtttctctattgatgatgaacatattaaggccgaatacgttgcctcttctgttagagctgtttacgaacctatt 1000
      ttgaaagttccagaacatgctacggccaaagagataactactacttgtataattccggcttatgcaacggagaagacaatctcgacaaatgcttggataa
       T  F  K  V  L  Y  D  A  G  F  S  I  D  D  E  H  I  K  A  E  Y  V  A  S  S  V  R  A  V  Y  E  P  I  
      292
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaXMT1_Strep-tag
             1010      1020      1030      1040      1050      1060      1070      1080      1090      1100
               *         *         *         *         *         *         *         *         *         *
 1001 ttggcttctcatttcggtgaagccattatcccagatatctttcatagatttgctaagcacgctgctaaggttttgccattgggtaaaggtttttacaaca 1100
      aaccgaagagtaaagccacttcggtaatagggtctatagaaagtatctaaacgattcgtgcgacgattccaaaacggtaacccatttccaaaaatgttgt
      L  A  S  H  F  G  E  A  I  I  P  D  I  F  H  R  F  A  K  H  A  A  K  V  L  P  L  G  K  G  F  Y  N  N
      325
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaXMT1_Strep-tag
             1110      1120      1130      1140      1150      1160      1170      1180      1190      1200
               *         *         *         *         *         *         *         *         *         *
 1101 acttgatcatctccttggccaaaaagccagaaaagtctgatgtttctgcttggtcacatccacaattcgaaaagtgatgatactagtagcggccgctgca 1200
      tgaactagtagaggaaccggtttttcggtcttttcagactacaaagacgaaccagtgtaggtgttaagcttttcactactatgatcatcgccggcgacgt
                                                                                      >>>>>>>>>>>>>>>>>>>>
                                                                                      RFC10 Suffix
        L  I  I  S  L  A  K  K  P  E  K  S  D  V  S  A  W  S  H  P  Q  F  E  K  *  *  
      359
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaXMT1_Strep-tag
 1201 g 1201
      c
      >
      RFC10 Suffix

Theoretical molecular weight: 42998,4 Da (ProtParam)

Probable posttranslational modifications:

  • acetylation at serine (second amino acid)
  • O-GlcNAc modifikation at several positions
  • phosphorylation at several positions

(see http://2d.bjmu.edu.cn/show2d/Proteomics%20tools.asp)

CaMXMT1

Show/hide sequence

              10        20        30        40        50        60        70        80        90        100
               *         *         *         *         *         *         *         *         *         *
    1 gaattcgcggccgcttctagagtacacaatgtctttacaagaagtcttgcacatgaacgaaggtgaaggtgatacttcttacgctaagaatgcttcttac 100
      cttaagcgccggcgaagatctcatgtgttacagaaatgttcttcagaacgtgtacttgcttccacttccactatgaagaatgcgattcttacgaagaatg
                                  M  S  L  Q  E  V  L  H  M  N  E  G  E  G  D  T  S  Y  A  K  N  A  S  Y  
                                  1
      >>>>>>>>>>>>>>>>>>>>>>      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      RFC10 Prefix                CaMXMT1_Strep-tag
                            >>>>>>>>>>>>
                            RBS Yeast Consensus Sequence
              110       120       130       140       150       160       170       180       190       200
               *         *         *         *         *         *         *         *         *         *
  101 aacttggctttggctaaggttaagccattcttggaacaatgcatcagagaattattgagagccaacttgccaaacatcaacaagtgtattaaggttgctg 200
      ttgaaccgaaaccgattccaattcggtaagaaccttgttacgtagtctcttaataactctcggttgaacggtttgtagttgttcacataattccaacgac
      N  L  A  L  A  K  V  K  P  F  L  E  Q  C  I  R  E  L  L  R  A  N  L  P  N  I  N  K  C  I  K  V  A  D
      25
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaMXMT1_Strep-tag
              210       220       230       240       250       260       270       280       290       300
               *         *         *         *         *         *         *         *         *         *
  201 atttgggttgtgcttctggtccaaatactttgttgactgttagagacatcgtccaatccattgataaggttggtcaagaagaaaagaacgaattggaaag 300
      taaacccaacacgaagaccaggtttatgaaacaactgacaatctctgtagcaggttaggtaactattccaaccagttcttcttttcttgcttaacctttc
        L  G  C  A  S  G  P  N  T  L  L  T  V  R  D  I  V  Q  S  I  D  K  V  G  Q  E  E  K  N  E  L  E  R 
      59
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaMXMT1_Strep-tag
              310       320       330       340       350       360       370       380       390       400
               *         *         *         *         *         *         *         *         *         *
  301 accaaccatccaaattttcttgaacgacttgttccaaaacgacttcaactccgtttttaagttgttgccatccttctacagaaagttggaaaaagaaaac 400
      tggttggtaggtttaaaagaacttgctgaacaaggttttgctgaagttgaggcaaaaattcaacaacggtaggaagatgtctttcaacctttttcttttg
       P  T  I  Q  I  F  L  N  D  L  F  Q  N  D  F  N  S  V  F  K  L  L  P  S  F  Y  R  K  L  E  K  E  N  
      92
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaMXMT1_Strep-tag
              410       420       430       440       450       460       470       480       490       500
               *         *         *         *         *         *         *         *         *         *
  401 ggtagaaagatcggttcctgcttgatttctgctatgccaggttctttttacggtagattattccctgaagaatccatgcatttcttgcactcttgttact 500
      ccatctttctagccaaggacgaactaaagacgatacggtccaagaaaaatgccatctaataagggacttcttaggtacgtaaagaacgtgagaacaatga
      G  R  K  I  G  S  C  L  I  S  A  M  P  G  S  F  Y  G  R  L  F  P  E  E  S  M  H  F  L  H  S  C  Y  S
      125
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaMXMT1_Strep-tag
              510       520       530       540       550       560       570       580       590       600
               *         *         *         *         *         *         *         *         *         *
  501 ctgttcactggttgtctcaagttccatctggtttggttattgaattgggtattggtgctaacaagggttccatctattcttctaaaggttgtagaccacc 600
      gacaagtgaccaacagagttcaaggtagaccaaaccaataacttaacccataaccacgattgttcccaaggtagataagaagatttccaacatctggtgg
        V  H  W  L  S  Q  V  P  S  G  L  V  I  E  L  G  I  G  A  N  K  G  S  I  Y  S  S  K  G  C  R  P  P 
      159
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaMXMT1_Strep-tag
              610       620       630       640       650       660       670       680       690       700
               *         *         *         *         *         *         *         *         *         *
  601 agttcaaaaggcttacttggatcaattcactaaggacttcaccactttcttgagaatccactccaaagaattattctccagaggtagaatgttgttgacc 700
      tcaagttttccgaatgaacctagttaagtgattcctgaagtggtgaaagaactcttaggtgaggtttcttaataagaggtctccatcttacaacaactgg
       V  Q  K  A  Y  L  D  Q  F  T  K  D  F  T  T  F  L  R  I  H  S  K  E  L  F  S  R  G  R  M  L  L  T  
      192
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaMXMT1_Strep-tag
              710       720       730       740       750       760       770       780       790       800
               *         *         *         *         *         *         *         *         *         *
  701 tgtatctgtaaggttgacgaatttgatgaacctaacccattggatttgttggatatggccattaacgatttgatcgtcgaaggtttgttggaagaagaaa 800
      acatagacattccaactgcttaaactacttggattgggtaacctaaacaacctataccggtaattgctaaactagcagcttccaaacaaccttcttcttt
      C  I  C  K  V  D  E  F  D  E  P  N  P  L  D  L  L  D  M  A  I  N  D  L  I  V  E  G  L  L  E  E  E  K
      225
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaMXMT1_Strep-tag
              810       820       830       840       850       860       870       880       890       900
               *         *         *         *         *         *         *         *         *         *
  801 agttggactccttcaacattccattctttactccatctgccgaagaagttaagtgcatcgttgaagaagaaggttcttgcgaaatcttgtacttggaaac 900
      tcaacctgaggaagttgtaaggtaagaaatgaggtagacggcttcttcaattcacgtagcaacttcttcttccaagaacgctttagaacatgaacctttg
        L  D  S  F  N  I  P  F  F  T  P  S  A  E  E  V  K  C  I  V  E  E  E  G  S  C  E  I  L  Y  L  E  T 
      259
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaMXMT1_Strep-tag
              910       920       930       940       950       960       970       980       990      1000
               *         *         *         *         *         *         *         *         *         *
  901 tttcaaggctcattacgatgctgccttctctattgatgatgattacccagttagatcccacgaacaaatcaaagctgaatacgttgcctccttgatcaga 1000
      aaagttccgagtaatgctacgacggaagagataactactactaatgggtcaatctagggtgcttgtttagtttcgacttatgcaacggaggaactagtct
       F  K  A  H  Y  D  A  A  F  S  I  D  D  D  Y  P  V  R  S  H  E  Q  I  K  A  E  Y  V  A  S  L  I  R  
      292
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaMXMT1_Strep-tag
             1010      1020      1030      1040      1050      1060      1070      1080      1090      1100
               *         *         *         *         *         *         *         *         *         *
 1001 tctgtttacgaacctattttggcctctcatttcggtgaagctattatgccagatttgtttcacagattggctaaacatgctgctaaggttttacacatgg 1100
      agacaaatgcttggataaaaccggagagtaaagccacttcgataatacggtctaaacaaagtgtctaaccgatttgtacgacgattccaaaatgtgtacc
      S  V  Y  E  P  I  L  A  S  H  F  G  E  A  I  M  P  D  L  F  H  R  L  A  K  H  A  A  K  V  L  H  M  G
      325
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaMXMT1_Strep-tag
             1110      1120      1130      1140      1150      1160      1170      1180      1190      1200
               *         *         *         *         *         *         *         *         *         *
 1101 gtaagggttgttacaacaacttgattatctccttggccaaaaagccagaaaagtctgatgtttctgcttggtcacatccacaattcgaaaagtgatgata 1200
      cattcccaacaatgttgttgaactaatagaggaaccggtttttcggtcttttcagactacaaagacgaaccagtgtaggtgttaagcttttcactactat
                                                                                                        >>
                                                                                                        RFC10 Suffix
        K  G  C  Y  N  N  L  I  I  S  L  A  K  K  P  E  K  S  D  V  S  A  W  S  H  P  Q  F  E  K  *  *  
      359
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaMXMT1_Strep-tag
             1210
               *         
 1201 ctagtagcggccgctgcag 1219
      gatcatcgccggcgacgtc
      >>>>>>>>>>>>>>>>>>>
      RFC10 Suffix

Theoretical molecular weight: 43903,3 Da (ProtParam)

Probable posttranslational modifications:

  • acetylation at serine (second amino acid)
  • O-GlcNAc modifikation at several positions
  • phosphorylation at several positions

(see http://2d.bjmu.edu.cn/show2d/Proteomics%20tools.asp)

CaDXMT1

Show/hide sequence

              10        20        30        40        50        60        70        80        90        100
               *         *         *         *         *         *         *         *         *         *
    1 gaattcgcggccgcttctagagtacacaatgtctttacaagaagtcttgcatatgaacggtggtgaaggtgatacttcttacgctaagaactctttctac 100
      cttaagcgccggcgaagatctcatgtgttacagaaatgttcttcagaacgtatacttgccaccacttccactatgaagaatgcgattcttgagaaagatg
                                  M  S  L  Q  E  V  L  H  M  N  G  G  E  G  D  T  S  Y  A  K  N  S  F  Y  
                                  1
                                  >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
                                  CaDXMT1_Strep-tag
      >>>>>>>>>>>>>>>>>>>>>>
      RFC10 Prefix
                            >>>>>>>>>>>>
                            RBS Yeast Consensus Sequence
              110       120       130       140       150       160       170       180       190       200
               *         *         *         *         *         *         *         *         *         *
  101 aacttgttcttgatcagagtcaagccaatcttggaacaatgcatccaagaattattgagagccaacttgccaaacatcaacaagtgtattaaggttgctg 200
      ttgaacaagaactagtctcagttcggttagaaccttgttacgtaggttcttaataactctcggttgaacggtttgtagttgttcacataattccaacgac
      N  L  F  L  I  R  V  K  P  I  L  E  Q  C  I  Q  E  L  L  R  A  N  L  P  N  I  N  K  C  I  K  V  A  D
      25
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaDXMT1_Strep-tag
              210       220       230       240       250       260       270       280       290       300
               *         *         *         *         *         *         *         *         *         *
  201 atttgggttgtgcttctggtccaaatactttgttgactgttagagacatcgtccaatccattgataaggttggtcaagaaaagaagaacgaattggaaag 300
      taaacccaacacgaagaccaggtttatgaaacaactgacaatctctgtagcaggttaggtaactattccaaccagttcttttcttcttgcttaacctttc
        L  G  C  A  S  G  P  N  T  L  L  T  V  R  D  I  V  Q  S  I  D  K  V  G  Q  E  K  K  N  E  L  E  R 
      59
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaDXMT1_Strep-tag
              310       320       330       340       350       360       370       380       390       400
               *         *         *         *         *         *         *         *         *         *
  301 accaaccatccaaattttcttgaacgacttgttccaaaacgacttcaactccgtttttaagtccttgccatccttctacagaaagttggaaaaagaaaac 400
      tggttggtaggtttaaaagaacttgctgaacaaggttttgctgaagttgaggcaaaaattcaggaacggtaggaagatgtctttcaacctttttcttttg
       P  T  I  Q  I  F  L  N  D  L  F  Q  N  D  F  N  S  V  F  K  S  L  P  S  F  Y  R  K  L  E  K  E  N  
      92
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaDXMT1_Strep-tag
              410       420       430       440       450       460       470       480       490       500
               *         *         *         *         *         *         *         *         *         *
  401 ggtagaaagatcggttcctgtttgattggtgctatgccaggttctttttacggtagattattccctgaagaatccatgcatttcttgcattcttgttact 500
      ccatctttctagccaaggacaaactaaccacgatacggtccaagaaaaatgccatctaataagggacttcttaggtacgtaaagaacgtaagaacaatga
      G  R  K  I  G  S  C  L  I  G  A  M  P  G  S  F  Y  G  R  L  F  P  E  E  S  M  H  F  L  H  S  C  Y  C
      125
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaDXMT1_Strep-tag
              510       520       530       540       550       560       570       580       590       600
               *         *         *         *         *         *         *         *         *         *
  501 gcttgcactggttgtctcaagttccatctggtttggttactgaattgggtatttctgctaacaagggttgcatctactcttctaaagcttcaagaccacc 600
      cgaacgtgaccaacagagttcaaggtagaccaaaccaatgacttaacccataaagacgattgttcccaacgtagatgagaagatttcgaagttctggtgg
        L  H  W  L  S  Q  V  P  S  G  L  V  T  E  L  G  I  S  A  N  K  G  C  I  Y  S  S  K  A  S  R  P  P 
      159
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaDXMT1_Strep-tag
              610       620       630       640       650       660       670       680       690       700
               *         *         *         *         *         *         *         *         *         *
  601 aattcaaaaggcctacttggatcaattcactaaggatttcaccactttcttgagaatccactccgaagaattgatcagtagaggtagaatgttgttgacc 700
      ttaagttttccggatgaacctagttaagtgattcctaaagtggtgaaagaactcttaggtgaggcttcttaactagtcatctccatcttacaacaactgg
       I  Q  K  A  Y  L  D  Q  F  T  K  D  F  T  T  F  L  R  I  H  S  E  E  L  I  S  R  G  R  M  L  L  T  
      192
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaDXMT1_Strep-tag
              710       720       730       740       750       760       770       780       790       800
               *         *         *         *         *         *         *         *         *         *
  701 tggatctgcaaagaagatgaatttgaaaacccaaactccatcgatttgttggaaatgtccatcaacgatttggttatcgaaggtcacttagaagaagaaa 800
      acctagacgtttcttctacttaaacttttgggtttgaggtagctaaacaacctttacaggtagttgctaaaccaatagcttccagtgaatcttcttcttt
      W  I  C  K  E  D  E  F  E  N  P  N  S  I  D  L  L  E  M  S  I  N  D  L  V  I  E  G  H  L  E  E  E  K
      225
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaDXMT1_Strep-tag
              810       820       830       840       850       860       870       880       890       900
               *         *         *         *         *         *         *         *         *         *
  801 agttggactctttcaacgttccaatctatgctccatctaccgaagaagttaagtgcatcgttgaagaagaaggttccttcgaaatcttgtacttggaaac 900
      tcaacctgagaaagttgcaaggttagatacgaggtagatggcttcttcaattcacgtagcaacttcttcttccaaggaagctttagaacatgaacctttg
        L  D  S  F  N  V  P  I  Y  A  P  S  T  E  E  V  K  C  I  V  E  E  E  G  S  F  E  I  L  Y  L  E  T 
      259
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaDXMT1_Strep-tag
              910       920       930       940       950       960       970       980       990      1000
               *         *         *         *         *         *         *         *         *         *
  901 ctttaaggttccatacgatgccggtttctctatcgatgatgattatcaaggtagatcccactctccagtttcttgtgatgaacatgctagagctgctcat 1000
      gaaattccaaggtatgctacggccaaagagatagctactactaatagttccatctagggtgagaggtcaaagaacactacttgtacgatctcgacgagta
       F  K  V  P  Y  D  A  G  F  S  I  D  D  D  Y  Q  G  R  S  H  S  P  V  S  C  D  E  H  A  R  A  A  H  
      292
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaDXMT1_Strep-tag
             1010      1020      1030      1040      1050      1060      1070      1080      1090      1100
               *         *         *         *         *         *         *         *         *         *
 1001 gttgcttcagttgttagatctattttcgaacctatcgttgcctctcatttcggtgaagctattatgccagatttgtcccatagaattgctaagaatgctg 1100
      caacgaagtcaacaatctagataaaagcttggatagcaacggagagtaaagccacttcgataatacggtctaaacagggtatcttaacgattcttacgac
      V  A  S  V  V  R  S  I  F  E  P  I  V  A  S  H  F  G  E  A  I  M  P  D  L  S  H  R  I  A  K  N  A  A
      325
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaDXMT1_Strep-tag
             1110      1120      1130      1140      1150      1160      1170      1180      1190      1200
               *         *         *         *         *         *         *         *         *         *
 1101 ccaaggttttgagatctggtaagggtttttacgactccttgattatttccttggccaaaaagccagaaaagtccgatgtttctgcttggtcacatccaca 1200
      ggttccaaaactctagaccattcccaaaaatgctgaggaactaataaaggaaccggtttttcggtcttttcaggctacaaagacgaaccagtgtaggtgt
        K  V  L  R  S  G  K  G  F  Y  D  S  L  I  I  S  L  A  K  K  P  E  K  S  D  V  S  A  W  S  H  P  Q 
      359
      >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
      CaDXMT1_Strep-tag
             1210      1220      1230
               *         *         *       
 1201 attcgaaaagtgatgatactagtagcggccgctgcag 1237
      taagcttttcactactatgatcatcgccggcgacgtc
       F  E  K  *  *  
      392
      >>>>>>>>>>>>>>>>
      CaDXMT1_Strep-tag
                      >>>>>>>>>>>>>>>>>>>>>
                      RFC10 Suffix

Theoretical molecular weight: 44473,7 Da (ProtParam)

Probable posttranslational modifications:

  • acetylation at serine (second amino acid)
  • O-GlcNAc modifikation at several positions
  • phosphorylation at several positions

(see http://2d.bjmu.edu.cn/show2d/Proteomics%20tools.asp)