Team:Shenzhen/Result/YAO.Suicider

Preview for Whole Experiments

GAL1 promoter + signal peptide to mitochondria + T7 RNAP + ADH terminator (backbone:YEP325)

T7 promoter + DNase + terminator for mitochondria (under consideration)

DLD3 promoter + Holin +ADH terminator

Identification of T7 RNAP Function in Nucleus

• I. Construction of Vector

1. Bacterial culture (BBa_I712074（T7 poromter，Amp resistant or Kana resistant），E0840（GFP generator，Amp resistant）

2. Plasmid extraction for BBa_I712074，E0840( Tiangen normal plasmid extraction kits

3. Measure the concentration of plasmid by NANODROP 2000(Thermo)

4. Digestion: (enzymes are all from Takara

    BBa_I712074    2-3ug

    PstI    2ul

    SpeI    2ul

    10 x H Buffer    5ul

    ddH2O    50ul

    E0840    2-3ug

    XbaI    2ul

    PstI    2ul

    10 x H Buffer    5ul

    ddH2O    50ul

    37oC    3h

    80 oC     20min

5. Electrophoresis:

    1% agarose gel, 120V, after 45min,EB dye.

6. Gel recovery of GAL(EcoRI/SpeI), Holin(XbaI/PstI) (QIAquick Gel recovery kits)

7. Measure the concentration of fragment of interest by NANODROP 2000(Thermo)

8. Linage:

    BBa_I712074 （(stI/SpeI)    2ul

    E0840 (PstI/XbaI)    6ul

    T4 ligase    1ul

    T4 ligase Buffer    1ul

    16 oC    3 hours

9. Transduction:

    1. UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

    2. 10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

    3. 42oC ice-bath heat shock for 50s.

    4. Stewing on ice for 2mins.

    5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

    6. 3000rpm/min for 5mins, abandon the supermate, mixing the left.

    7. 60μl broth spread the Amp anti-LB soli

• March 12th, 2012

<P>Events:</P> <P>March 12th. The first iGEM meeting was a very serious one, and there were only 5 members: Kang Chen Zhang Ou and Gong ,respectively.</P> <P>We decided to build a list about the whole previous iGEM projects and divided it into five parts: America for Kang and Chen, Europe for Zhang and Ou, Asia for Gong. All of us were in charge of scanning the projects, summarized them and gave the other members a brief description. Each one for one minute.</P>

• March 15th – April 13th, 2012

<P>Events:</P> <P>Though a recruitment talk with the other classmate in BGI, nearly 20 students and two instructors became members of us. We established a team consisted of eight schools—SCUT, SCNU, SCU, UESTC, WHU, HUST, SEU, UST.</P> <P>We continued to sum up the projects from 2008 to 2011, and in the meanwhile, we separated the whole into more parts and assigned to the other members.</P> <P>Finally, we finished the summary. </P> <P>And we also discussed what we should do, we originally put up with 4 schemes: Schrodinger’s cat—randomly producing 0 and 1; Density sensing application--based on the result of JIandong Wang’s research; Christmas tree—sparks different colors ceaselessly; Yeast artificial organelle—transform mitochondria into a biofactory. The former 3 projects were gave up due to the similarity to the previous iGEM projects. We lay down our consideration on Yeast artificial organelle.</P> <P>Chen Yu search more articles about mitochondria transgene and mitochondrial signaling pathways he can and pack it as a file of endnote.</P> <P>We clarify our projects as a combination of five modules: NAD+/NADH Sensor, self-killer, post-invader, sel-control transporter and artemisinin producer.</P> <P>We divided our group into five parts according to the modules and select two members of each modules to make up two new squads—modeling construction and lab experiments.</P>

2012/3/7 MISSION START 1. TEAM BUILDING: OICQ GROUP; 2. ARRANGEMENTS FOR THE FIRST SEMINAR. 2012/3/8 noon THE FIRST SEMINAR: 1. Discussion about our project; 2. Registration for iGEM 2012 and self-introduce. 2012/3/14 THE SECOND SEMINAR: 1. Discussion about our project; 2. Task assignment for latter seminar mainly about previous teams’ projects; 3. New member’s introduction. 2012/3/15 Group email application succeeded. 2012/3/17 Quan ZHOU withdrew from the team. 2012/3/18 Jianhui GONG made a list of all projects of iGEM 2008-2011 and assigned each one’s seminar task. 2012/3/19 THE THIRD SEMINAR: 1. Introduction of new members; 2. Rearrangements for everyone’s task. 2012/3/22 THE FOURTH SEMINAR: Introduction of a few projects of iGEM 2008-2011. 2012/3/26 THE FIFTH SEMINAR: Introduction of a few projects of iGEM 2008-2011. 2012/3/29 THE SIXTH SEMINAR: 1. Introduction of a few projects of iGEM 2008-2011; 2. Introduction of new members; 3. Rearrangements for everyone’s task again. 2012/4/5 THE SEVENTH SEMINAR: Introduction of a few projects of iGEM 2008-2011. 2012/4/7 TEAM BUILDING ACTIVITY: KTV and dine outside together. 2012/4/10

THE EIGTHTH SEMINAR: Each modules and logo designed.</ul></div>d plat, 37℃ inversed culture in incubation overnight.

10. Colony PCR:

    dNTPmix(2.5mM)    1μl

    PCR 10×buffer2μl

    VF    0.5μl

    VR    0.5μl

    Ex Taq    0.5μl

    H2O    15.5μl

    Primer

        VF:    TGCCACCTGACGTCTAAGAA

        VR:    ATTACCGCCTTTGAGTGAGC

    94℃    3min

    94℃    30s

    55℃    30s

    72℃    1min

    72℃    10min

    12℃    ∞

    30 cycles

11. 1%~1.5% agarose gel electrophoresis, <130V, 40mins.

12. Sequencing:

    Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector PSB1AK3-T7 poromter+GFP+T7 terminater

• II. Construction of Yeast Expression Vector

1. Culture of PSB1AK3-T7 poromter+GFP+T7 terminater （Cmr resistant）gz-YEP352（AmpResistant, we have replaced the URA mark with trp mark）

2. Plasmid extraction: PSB1AK3-T7 poromter+GFP+T7 terminater，gz-YEP352

3. Digestion:

    Gz-YEP352    2ug

    XbaI    2ul

    PstI    2ul

    10 x H Buffer    5ul

    ddH2O        50ul

    PSB1AK3-T7 poromter+GFP+T7 terminater    2ug  

    XbaI    2ul

    Pst    2ul

    10 x H Buffer    5ul

    ddH2    50ul

4. Electrophoresis:

    1% agarose gel, 120V, after 45min,EB dye.

5. Gel recovery of gz-YEP352 (XbaI /PstI)PSB1AK3-T7 poromter+GFP+T7 terminater (XbaI / PstI) (Qiagen Gel recovery kits)

6. Lingake:

    Gz-YEP352 (XbaI /PstI)    100ng

    PSB1AK3-T7 poromter+GFP+T7 terminater    100ng

    T4 buffer    1ul

    T4 ligase    1ul

    ddH2O    10ul

    16oC    overnight

7. Transduction:

    1. UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

    2. 10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

    3. 42oC ice-bath heat shock for 50s.

    4. Stewing on ice for 2mins.

    5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

    6. 3000rpm/min for 5mins, abandon the supermate, mixing the left.

    7. 60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

8. Clony PCR: <p>    dNTPmix(2.5mM)    1μl

    PCR 10×buffer    2μl

    M13_pUC_fwd_primer    0.5μl

    M13_reverse_primer    0.5μl

    Ex Taq    0.5μl

    H2O    15.5μl

    94℃    3min

    94℃    30s

    55℃    30s

    72℃    1.5min

    72℃    10min

    12℃    ∞

    30 cycles

9. 1.5% agarose gel electrophoresis, <130V, 40mins.

10. Sequencing:

    Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector:EP352-GAL1,Holin-ADH1

• III. Yeast Transformation Experiment:

1. plasmid extraction.

2. Preparation  of Competent Yeast Cells - LiAc Method

    1.treak a YPDA agar plate with a small portion of AH109 or Y187. Incubate the plate upside down at 30°C until colonies appear(~3days). Yeast strains can be stored for up to 1 month at 4°C on YPDA medium in culture plates.

    2.Prepare 1.1X TE/LiAc Solution

    3.Prepare YPDA liquid medium (Yeast Protocols Handbook)

    4.Inoculate one colony(<4 weeks old, 2–3mm in diameter) into 3ml of YPDA medium in a sterile, 15-ml   centrifuge tube.

    5.Incubate at 30°C with shaking    for   8hr.

    6.Transfer 5µl of the culture  to a 250-ml flask containing  50ml of YPDA.

    7.Incubate at 30°C with shaking at 230–250 rpm for   16–20hr.The OD600 should reach 0.15–0.3.

    8.Centrifuge the cells at 700 x g for 5min at room temperature.

    9.Discard the supernatant and resuspend the  cell  pellet in 100 ml of YPDA.

    10.Incubate at 30°C for 3–5hr (OD600= 0.4–0.5).

    11.Centrifuge the cells at 700 x g for 5min at room  temperature.

    12.Discard the supernatant and resuspend the cell pellet in 60ml of sterile, deionized H2O.

    13.Centrifuge the cells at 700 x g for 5min at room  temperature.

    14.Discard the supernatant and resuspend the cells in 3 ml of 1.1 X TE/LiAc Solution.

    15.Split the resuspension between two 1.5-ml microcentrifuge tubes (1.5 ml per tube).

    16.Centrifuge each tube at high speed for 15 sec.

    17.Discard the supernatant and resuspend each pellet in 600 µl of 1.1 X TE/LiAc Solution.

3.Transformation:

    1. Gz-YEP352-T7poromter+GFP+T7terminater 0.2ug

    Sperm DNA*(10 mg/ml) 0.1mg

    Sperm DNA  :when prepared, water-bath boiling for 20mins, then ice-bath, -20°C preservation.

    2. 100 ul dense medium of yeast competent cell by 1×TE/LiAc. Whirlpool oscillation.

    3. 600 ulPEG/LiAc, oscillation strongly, 30°C,200rpm, culture oscillating for 30mins.

    4. Add 70ul DMSO, mixing it slightly and 42oC heat shock by water-bath for 15mins, ice-bath for 1-2mins

    5. Centrifuging for 14,000rpm for 5sec, abandon the supermate, 0.1ml 1x TE suspense the cell precipitation, spread it to SD/ -Ura-trp solid plat, 30°C culture reversely for 3 days.

6. Holin function identification:

    Pick a SD/ -Ura-trp-cultured colony and inoculate it to 50ml YPDA medium, 30°C,220rpm culture reelingly to OD-0.1, transfer 20ml to 50ml sterile medium (alpha-galactose), versus is added by equivalent water. Measuring the OD value one time for one hour and drawing the curve.

    Result analyzation:

        If the bacteria in alpha-galactose show flurorescence, that shows T7 RNAP/T7 promoter can work.

Protocol: Test of Holin Function

• I. Construction of Vector (GAL promoter+Holin) in PSB1C3

1. Plasmid extraction for T-Gal, T-holin

2. PCR amplification of linear vector PSB1C3, purification(Qiagen PCR purification kits)

3. Digestion:

    T-GAL1    2ug

    ECoRI2ul

    SpeI    2ul

    10 x H Buffer    5ul

    ddH2O50ul

    T-holin    2ug

    XbaI    2ul

    PstI    2ul

    10 x H    5ul

    ddH2O    50ul

    purified backbone PSB1C3    1ug

    ECoRI    2ul

    PstI    2ul

    10 x H Buffer    5ul

    ddH2O    50ul

    37oC    1h

    80oC    20min

4. Electrophoresis:

    1% agarose gel, 120V, after 45min,EB dye.

5. Gel recovery of GAL(EcoRI/SpeI), Holin(XbaI/PstI) (Qiagen Gel recovery kits)

6. Linage:

    PSB1C3    2ul

    GAL1( ECoRI / SpeI)    100ng

    Holin（ XbaI/PstI)    100ng

    T4 buffer    1ul

    T4 ligase    1ul

    ddH2O    10ul

    16 oC    overnight

7. Transduction:

    1. UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

    2. 10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

    3. 42oC ice-bath heat shock for 50s.

    4. Stewing on ice for 2mins.

    5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

    6. 3000rpm/min for 5mins, abandon the supermate, mixing the left.

    7. 60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

8.Colony PCR:

    dNTPmix(2.5mM)    1μl

    PCR 10×buffer    2μl

    VF    0.5μl

    VR    0.5μl

    Ex Taq    0.5μl

    H2O    15.5μl

    Primer    

        VF: TGCCACCTGACGTCTAAGAA

        VR:ATTACCGCCTTTGAGTGAGC

    94℃    3min

    94℃    30s

    55℃    30s

    72℃    1min

    72℃    10min

    12℃    ∞

    30 cycles

9. 1%~1.5% agarose gel electrophoresis, <130V, 40mins.

10. Sequencing:

    Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector PSB1C3-GAL

• II. Construction of vector(GAL promoter+holing) in PSB1C3

1. Plasmid extraction: BBa-J63002(ADH terminator）, PSB1C3-GAL1-Holin.

2. Digestion:

    BBa-J63002     2ug    

    XbaI     2ul    

    PstI     2ul        

    10 x H Buffer    5ul    

    ddH2O    50ul    

    37oC    1h        

    PSB1C3-GAL1-Holin    2ug

    SpeI    2ul

    PstI    2ul

    10 x H Buffer    5ul     <p>    ddH2O    50ul

    80oC    20min

3. Electrophoresis:

    1% agarose gel, 120V, after 45min,EB dye.

4. Gel recovery of BBa-J63002 (XbaI /PstI),PSB1C3-GAL1-Holin(SpeI/ PstI) (Qiagen Gel recovery kits)

5. Linkage:

    PSB1C3-GAL1-Holin(SpeI/ PstI)    100ng

    BBa-J63002 (XbaI /PstI)    100ng

    T4 buffer    1ul

    T4 ligase    1ul

    ddH2O    10ul

    16 oC overnight

6. Transduction:

    1. UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

    2. 10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

    3. 42oC ice-bath heat shock for 50s.

    4. Stewing on ice for 2mins.

    5. Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

    6. 3000rpm/min for 5mins, abandon the supermate, mixing the left.

    7. 60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

7. Colony PCR:

    dNTPmix(2.5mM)v1μl

    PCR 10×buffer    2μl

    VF    0.5μl

    VR    0.5μl

    Ex Taq    0.5μl

    H2O    15.5μl

    Primer

        VF: TGCCACCTGACGTCTAAGAA

        VR: ATTACCGCCTTTGAGTGAGC

    94℃    3min

    94℃    30s

    55℃    30s    

    72℃    1.5min

    72℃    10min

    12℃    ∞

    30 cycles

8. 1%~1.5% agarose gel electrophoresis, $lt;130V, 40mins.

9. Sequencing:

    Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector PSB1C3-GAL1, Holin-ADH1

• III. Construction of Yeast Expression Vector

1. Culture of PSB1C3-GAL1-Holin-ADH1 (Cmr resistant) YEP352 (AmpResistant)

2. Plasmid extraction: PSB1C3-GAL1-Holin-ADH1，YEP352

3. Digestion:

    YEP352    2ug

    XbaI    2ul

    PstI    2ul

    10 x H    5ul

    ddH2O    50ul

    PSB1C3-GAL1-Holin-ADH1    2ug

    XbaI    2ul

    PstI    2ul

    10 x H Buffer    5ul

    ddH2O    50ul

4. Electrophoresis:

    1% agarose gel, 120V, after 45min,EB dye.

5. Gel recovery of YEP352 (XbaI /PstI),PSB1C3-GAL1-Holin-ADH1(XbaI / PstI) (Qiagen Gel recovery kits)

6. Lingake:

    YEP352 (XbaI /PstI)    100ng

    PSB1C3-GAL1-Holin-ADH1(XbaI / PstI)    100ng

    T4 buffer    1ul

     T4 ligase    1ul

    ddH2O    10ul

    16oC overnight

7. Transduction:

1.    UV sterilization half an hour before, get DH5a (competent yeast) out of fridge, thawing in water bath.

2.    10μlinkage production with 50μl competent yeast cells, ice-bath for 30mins.

3.    42oC ice-bath heat shock for 50s.

4.    Stewing on ice for 2mins.

5.    Add 500μl LB medium without antibiotic, 37℃ shaking(225rpm/min), recover it for culturing it for 1 hour.

6.    3000rpm/min for 5mins, abandon the supermate, mixing the left.

7.    60μl broth spread the Amp anti-LB solid plat, 37℃ inversed culture in incubation overnight.

8. Clony PCR: <p>    dNTPmix(2.5mM)    1μl

    PCR 10×buffer    2μl

    M13_pUC_fwd_primer    0.5μl

    M13_reverse_primer    0.5μl

    Ex Taq    0.5μl

    H2O    15.5μl

    94℃    3min

    94℃    30s

    55℃    30s

    72℃    1.5min

    72℃    10min

    12℃    ∞

    30 cycles

9. 1.5% agarose gel electrophoresis, <130V, 40mins.

10. Sequencing:

    Pick the positive colony(colony PCR verification), marking lines and culture(Cmr resistant), sequencing. Name the right vector:EP352-GAL1, Holin-ADH1

• IV. Yeast transformation experiment:

1. plasmid extraction.

2. Preparation of Competent Yeast Cells—LiAc Method

    1.treak a YPDA agar plate with a small portion of AH109 or Y187. Incubate the plate upside down at 30°C until colonies appear(~3days). Yeast strains can be stored for up to 1 month at 4°C on YPDA medium in culture plates

    2.Prepare 1.1X TE/LiAc Solution

    3.Prepare YPDA liquid medium     (Yeast Protocols Handbook)

    4.Inoculate one colony (<4 weeks old, 2–3mm in diameter) into 3ml of YPDA medium in a sterile, 15-ml centrifuge tube.

    5.Incubate at 30°C with shaking

    6.Transfer 5µl of the culture to a 250-ml flask containing 50ml of YPDA.

    7.Incubate at 30°C with shaking at 230–250 rpm for 16–20hr.The OD600 should reach 0.15–0.3.

    8.Centrifuge the cells at 700 x g for 5min at room temperature.

    9.Discard the supernatant and resuspend the cell pellet in 100 ml of YPDA.

    10.Incubate at 30°C for 3–5hr     (OD600= 0.4–0.5).

    11.Centrifuge the cells at 700 x g for 5min at room temperature.

    12.Discard the supernatant and resuspend the cell pellet in 60ml of sterile, deionized H2O.

    13.Centrifuge the cells at 700 x g for 5min at room temperature.

    14.Discard the supernatant and resuspend the cells in 3ml of 1.1 X TE/LiAc Solution.

    15.Split the resuspension between two 1.5-ml microcentrifuge tubes (1.5 ml per tube).

    16.Centrifuge each tube at high speed for 15     sec.

    17.Discard the supernatant and resuspend each pellet in 600µl of 1.1 X TE/LiAc Solution.

3.Transformation:

    1. plasmid    0.2ug

        Sperm DNA*(10 mg/ml)    0.1mg

        *Sperm DNA: when prepared, water-bath boiling for 20mins, then ice-bath, -20°C preservation.

    2. 100 ul dense medium of yeast competent cell by 1×TE/LiAc. Whirlpool oscillation.

    3. 600 ulPEG/LiAc, oscillation strongly, 30°C,200rpm, culture oscillating for 30mins.

    5. Centrifuging for 14,000rpm for 5sec, abandon the supermate, 0.1ml 1x TE suspense the cell precipitation, spread it to SD/Ura solid plat, 30°C culture reversely for 3 days.

    6. Holin function identification:

        Pick a better-cultured colony and inoculate it to 50ml YPDA medium, 30°C,220rpm culture reelingly to OD-0.1, transfer 20ml to 50ml sterile medium (alpha-galactose), versus is         added by equivalent water. Measuring the OD value one time for one hour and drawing the curve.

        Result analyzation:

        If the bacteria in alpha-galactose grow slower that in water, that shows holing can work.