Team:University College London/LabBook/Week10

From 2012.igem.org

Revision as of 13:31, 24 August 2012 by Rwilkinson (Talk | contribs)

Contents

Tuesday 14.8.12

Aim - Repeat experiment 9.2: We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.

Method

PCR Protocol

Step 1 - Setting up PCR tubes: Thaw reagents and add to PCR tubes in the proportions described in the table below

PCR Components Volume (ul)
5x Reaction Buffer 10
25mM MgCl2 4
10mM dNTPs 1
10uM Forward primer 5
10uM Reverse primer 5
DNA Polymerase 0.25
Nuclease Free Water 24.25
Template DNA 0.5
Total Volume 0.5

Step 2 - PCR program: Add PCR tubes to a thermocycler and run under the following conditions.

PCR conditions Temp (oC) Time (s)
Initial Denaturation (1 cycle) 95 30
Denaturation/Annealing/Extension (30 cycles) 95/55/72 10/25/120
Final Extension (1 cycle) 72 600
Hold 4


Step 1 - Setting up PCR tubes: The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2.

DNA Template Function Module Primer Pair Primer Primer Sequence
BBa_K729002 Laccase GeneDegradation LR1/LF1 LR1 gaatacggtctttttataccg
LF1 gaaataactatgcaacgtcg
REVLF2/LFTW0 REVLF2 gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg
LFTW0 gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg
No Template (Negative Control) N/A Degradation LR1/LF1LR1 gaatacggtctttttataccg
LF1 gaaataactatgcaacgtcg
BBa_K729001 irrESalt Tolerance STF1/ST2RSTF1 atggggccaaaagctaaagctgaagcc
ST2R tcactgtgcagcgtcctgcg
STF3/ST4R STF3 gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc
ST4R gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg
No Template (Negative Control) N/A Salt Tolerance STF1/STF2STF1 atggggccaaaagctaaagctgaagcc
ST2R tcactgtgcagcgtcctgcg


Results: The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered.

Conclusion: We will revise the protocol to see if we can detect any bands.

Wednesday 15.08.12

Aim - Repeat the PCR again to optimise results: As an improvement we are using: - Phusion polymerase - Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday. - Changing the annealing temperature from 55C to 57C

Method

PCR Protocol

Step 1 - Setting up PCR tubes: Thaw reagents and add to PCR tubes in the proportions described in the table below

PCR Components Volume (ul)
5x Reaction Buffer 10
25mM MgCl2 4
10mM dNTPs 1
10uM Forward primer 5
10uM Reverse primer 5
DNA Polymerase 0.25
Nuclease Free Water 24.25
Template DNA 0.5
Total Volume 0.5

Step 2 - PCR program: Add PCR tubes to a thermocycler and run under the following conditions.

PCR conditions Temp (oC) Time (s)
Initial Denaturation (1 cycle) 95 30
Denaturation/Annealing/Extension (30 cycles) 95/55/72 10/25/120
Final Extension (1 cycle) 72 600
Hold 4


Step 1 - Setting up PCR tubes: The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.

DNA Template Function Module Primer Pair Primer Primer Sequence
BBa_K729002 Laccase GeneDegradation LR1/LF1 LR1 gaatacggtctttttataccg
LF1 gaaataactatgcaacgtcg
REVLF2/LFTW0 REVLF2 gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg
LFTW0 gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg
No Template (Negative Control) N/A Degradation LR1/LF1LR1 gaatacggtctttttataccg
LF1 gaaataactatgcaacgtcg
BBa_K729001 irrESalt Tolerance STF1/ST2RSTF1 atggggccaaaagctaaagctgaagcc
ST2R tcactgtgcagcgtcctgcg
STF3/ST4R STF3 gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc
ST4R gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg
No Template (Negative Control) N/A Salt Tolerance STF1/STF2STF1 atggggccaaaagctaaagctgaagcc
ST2R tcactgtgcagcgtcctgcg


Step 2 – PCR Program: An annealing temperature of 57oC was used instead of the standard 55oC.

Results: The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The reason for this are unclear.


Monday 13.8.12

Aim - Check the results of the weekend culture of plates: At the end of last week we set up Expt 9.4, to assess whether poor activity of our antibiotics was a cause of the poor results we get after colony picking. We proposed that our antibiotics may be weak, allowing opportunistic colonies to grow on agar. Therefore we set up a series of agar plates with various antibiotics and controls, to see if we could prove that bacteria without resistance is capable of growing on antibiotic inoculated agar. If this is the case, we know our antibiotic is weak.

Monday 13.8.12

Aims – To test the growth of marine bacteria in different media: This is to optimise the conditions of growth for the bacteria. A test for the marine bacteria will be compared to control E.coli, and the difference in growth measured using a spectrometer. The two media being tested are LB media (typically used for E.coli) and marine media. We expect to have greater optical density of indoliflex in marine medium & greater optical density for W3110 in LB.


Methods

Picking Colonies Protocol
Step 1 – Creating culture media: In a sterile environment, set up X numbers of falcons, each with 5mls of media.


Step 2 - Inoculating Colonies into a Selective Broth:: Add Yul of antibiotic to reach desired antibiotic concentration.


(For Ampicillin this is 50ug/ml, For Kanamycin it is 25ug/ml, for Tetracycline it is 15ug/ml, and for Chloramphenicol it is 25ug/ml)


Step 4 – Selecting a Colony: Select a clear, isolated colony and using an inoculation hoop scoop up a colony onto the tip. Deposit in the falcon tube


Step 5 - Culture: Culture your falcon tubes overnight at a temperature of 37 oC. Leave for no longer than 16 hours.

Step 2 – Inoculating Colonies into a Selective Broth: The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick. Each cell type will be inoculated into both types of media.

Type of Bacterium LB media Marine media
No. Falcons Volume Used (ml) No. Falcons Volume Used
W3100 (control) 3 2 1 2
Oceanibulbus indoliflex (marine) 2 2 4 2