Team:Kyoto/MethodAndMaterial

From 2012.igem.org

(Difference between revisions)
(Miniprep)
(Elecrophoresis)
Line 174: Line 174:
*Precipitation.<br>
*Precipitation.<br>
==Elecrophoresis==
==Elecrophoresis==
-
Prepare 200mL of a 1.0% agarose solution:
+
*Prepare 200mL of a 1.0% agarose solution:<br>
-
Measure 2.0g agarose into a beaker.
+
*Measure 2.0g agarose into a beaker.<br>
-
Add 200mL 1xTAE buffer.
+
*Add 200mL 1xTAE buffer.<br>
-
Wrap the top of the beaker with plastic wrap.
+
*Wrap the top of the beaker with plastic wrap.<br>
-
Punch a hole through the wrap with a pipette tip (To let out steam).
+
*Punch a hole through the wrap with a pipette tip (To let out steam).<br>
-
Dissolve the agarose by heating in microwave and swirling without boiling.
+
*Dissolve the agarose by heating in microwave and swirling without boiling.<br>
-
Allow the agarose to cool.
+
*Allow the agarose to cool.<br>
-
Pour the agarose solution into a gel tray on a gel maker.
+
*Pour the agarose solution into a gel tray on a gel maker.<br>
-
If there is air bubbles, pushing them with a pipette tip.
+
*If there is air bubbles, pushing them with a pipette tip.<br>
-
Place comb in the maker.
+
*Place comb in the maker.<br>
-
Cover the maker with a plastic wrap.
+
*Cover the maker with a plastic wrap.<br>
-
Let stand for about 45min.
+
*Let stand for about 45min.<br>
-
Remove the comb carefully.
+
*Remove the comb carefully.<br>
-
Store in the Tupperware in the refrigerator.
+
*Store in the Tupperware in the refrigerator.<br>
-
Place the tray in electrophoresis chamber.
+
*Place the tray in electrophoresis chamber.<br>
-
Cover the tray with 1xTAE buffer.
+
*Cover the tray with 1xTAE buffer.<br>
-
To prepare samples for electrophoresi, add 1µL of 6x Loading Buffer for every 5µL of DNA solution and mix well.
+
*To prepare samples for electrophoresi, add 1µL of 6x Loading Buffer for every 5µL of DNA solution and mix well.<br>
-
Load 6µL of the DNA solution per well.
+
*Load 6µL of the DNA solution per well.<br>
-
Electrophorese at 100V for about 30min until Loading Buffer have migrated approximately three-quaters of the gel.
+
*Electrophorese at 100V for about 30min until Loading Buffer have migrated approximately three-quaters of the gel.<br>
-
Stain the gel in 0.5µg/mL ethidium bromide for 20-30min.
+
*Stain the gel in 0.5µg/mL ethidium bromide for 20-30min.<br>
-
Rinse the gel with MilliQ.
+
*Rinse the gel with MilliQ.<br>
-
Place a plastic wrap on the transilluminator in the cabinet of Printgraph.
+
*Place a plastic wrap on the transilluminator in the cabinet of Printgraph.<br>
-
Place the gel on the transilluminator.
+
*Place the gel on the transilluminator.<br>
-
Turn on the transilluminator and confirm the position of the gel.
+
*Turn on the transilluminator and confirm the position of the gel.<br>
-
Shoot the picture.
+
*Shoot the picture.<br>
-
Turn off the transilluminator.
+
*Turn off the transilluminator.<br>
-
Dispose of the gel.
+
*Dispose of the gel.<br>
-
・PCR Purification
+
==PCR Purification==
-
Use Wizard SV Gel and PCR Clean-Up System by Promega.
+
Use Wizard SV Gel and PCR Clean-Up System by Promega.<br>
-
Combine 1 part sample (PCR product) with one part Membrane Binding Solution (e.g. 50μl sample+ 50μl).
+
*Combine 1 part sample (PCR product) with one part Membrane Binding Solution (e.g. 50μl sample+ 50μl).<br>
-
Apply the solution to the column, and let stand for 1min.
+
*Apply the solution to the column, and let stand for 1min.<br>
-
Centrifuge for 1min at 13000rpm. Discard the flow-through.
+
*Centrifuge for 1min at 13000rpm. Discard the flow-through.<br>
-
Add 700µl Membrane Wash Solution.
+
*Add 700µl Membrane Wash Solution.<br>
-
Centrifuge for 1min and discard the through.
+
*Centrifuge for 1min and discard the through.<br>
-
Add 500μl Membrane Wash Solution.
+
*Add 500μl Membrane Wash Solution.<br>
-
Centrifuge for 5min and discard the through.
+
*Centrifuge for 5min and discard the through.<br>
-
Place the column in a clean tube.
+
*Place the column in a clean tube.<br>
-
Add 60µl MilliQ to the center of each column, let stand for 1min.
+
*Add 60µl MilliQ to the center of each column, let stand for 1min.<br>
-
Centrifuge for 1min at 13000rpm.
+
*Centrifuge for 1min at 13000rpm.<br>
-
Discard the column.
+
*Discard the column.<br>
 +
 
 +
==qRT-PCR==
 +
Use QuantiTect SYBR green PCR kit Cat. No. 204143 by QIAGEN<br>
 +
*Dilute primer to 1.5μM.<br>
 +
*Dilute RT products.<br>
 +
*Mix the following;<br>
-
・qRT-PCR
 
-
Use QuantiTect SYBR green PCR kit Cat. No. 204143 by QIAGEN
 
-
Dilute primer to 1.5μM.
 
-
Dilute RT products.
 
-
Mix the following;
 
-
 
2x QuantiTect SYBR Green PCR Master Mix 22.5μL    
2x QuantiTect SYBR Green PCR Master Mix 22.5μL    
1/20xRT products 4.5μL    
1/20xRT products 4.5μL    

Revision as of 05:07, 25 September 2012

  • Home
  • Project
  • Method And Material
  • Notebook
  • Consideration
  • Team
  • SiteMap

Contents

Protocol

General

PCR

PCR: ToYoBo KOD FX or ToYoBo KOD PLUS
Dilute template DNA. If the concentration of DNA is 2-100ng/µL, transfer 1µL to a clean tube and add 99µL MilliQ.
Dilute Primer. If the concentration of Primer is XµM, dilute primer X timers and transfer 1µL to a clean tube and add 99µL MilliQ.
Mix the following.

  • For use of KOD plus ver2
25mM MgSO43µL
2mM dNTPs5µL
10xBuffer for KOD plus ver.25µL
Template DNA (5ng/µL)5µL
Primer Forward (10µM)1.5µL
Primer Reverse (10µM)1.5µL
KOD plus ver.21µL
MilliQ28µL
Total50µL
  • For use of KOD FX
2mM dNTPs10µL
2xBuffer for KOD FX25µL
Template DNA5µL
Primer Forward (10µM)1.5µL
Primer Reverse (10µM)1.5µL
KOD FX1µL
MilliQ6µL
Total50µL
  • Let stand for 2min at 94℃.
  • 25-40 cycles for 10s at 98℃, for 30s at Tm-5℃, and for 1min (1min for 1kb) at 68℃ (Tm is temparature at which primer will dissolve).
  • Agarose Gel Electrophoresis for confirmation.

PCR: Takara Ex taq

  • Mix the following (Do on PCR Bench).
10x PCR buffer (TAKARA)40µL
2.5mM dNTP8µL
Primer-1 (10pmol/µL)8µL
Primer-2 (10pmol/µL)8µL
Ex Taq HS (TAKARA)1.6µL
MilliQ334µL (to total 400µL)
Total400µL
  • Dispense 25µL to 15 tubes.
  • Pick a single colony and transfer it to each tubes.
  • Suspend the colony.
  • Let stand for 10min at 90℃.
  • 35 cycles for 30s at 94℃, for 30s 55℃, and for 1min at 72℃.
  • Let stand for 4min at 72℃.
  • Add 5mL Loading Buffer to the tubes.
  • Agalose Gel Electrophoresis for confirmation.
  • Negative Control: Use nothing.
  • Positive Control: Use a colony that will yield a product with this primers.

RNA Extraction

Use ISOGEN-LS(NIPPON GENE,311-02621

  • Add 1mL ISOGEN-LS to sample and vortex.
  • Store for 5min on ice.
  • Add 250µL chloroform and shake vigorously for 15 sec.
  • Store for 3min. on ice.
  • Centrifuge 17400xg for 10min. at 4℃.
  • Transfer aqueous phase to another tube and add 0.8 volume isopropanol.
  • Store for 10min. on ice.
  • Centrifuge 17400xg for 10min. at 4℃.
  • Discard the supernatant.
  • Add 800µL 80% ethanol and vortex.
  • Centrifuge 7500xg for 5min. at 4℃.
  • Discard the supernatant.
  • Dry briefly.
  • Dissolve in nuclease-free water.

Making Competent cells

  • Streak E.coli cells on an LB plate; (BL21(DE3)LysS cells on LB plate+34 mg/ml chloramphenicol)
  • Allow cells to grow at 37oC overnight
  • Place one colony in 10 mL LB media (+antibiotic selection if necessary), grow overnight at 37oC
  • Take 2 ml LB media and save for blank. Transfer 5 mL overnight DH5a culture into 500 mL LB media in 3 L flask
  • Allow cell to grow at 37oC (250 rpm), until OD600= 0.4 (~2-3 hours)
  • Transfer cells to 2 centrifuge bottles (250 mL), and place cells on ice for 20 mins
  • Centrifuge cells in Sorval GSA rotor at 4oC for 10 mins at 3,000 g.
  • Subsequent resuspensions may be done in the same bottle. Cells must remain cold for the rest of the procedure: Transport tubes on ice and resuspend on ice in the cold room
  • Pour off media and resuspend cells in 30 mL of cold 0.1 M CaCl2. Transfer the suspended cells into 50 mL polypropylene falcon tubes, and incubate on ice for 30 mins
  • Centrifuge cells using Sorval RT6000B rotor at 4oC for 10 mins at 3,000 g (2500 rpm)
  • Pour supernatant and resuspend cells (by pipetting) in 8 mL cold 0.1M CaCl2 containing 15% glycerol. Transfer 140 mL into (1.5 mL)
    *Ependorff tubes placed on ice. Freeze the cells in liquid nitrogen. Cells stored at -80oC can be used for transformation for up to ~6 months

Miniprep

Use QIAprep Spin Miniprep Kit Cat. No. 27104 by QIAGEN

  • Pick a single colony from a freshly streaked selective plate and inoculate a culture of about 3mL LB medium containing the appropriate selective antibiotic.
  • Incubate at 170rpm for 8h at 37℃ with vigorous shaking.
  • Transfer a half of the culture to a tube.
  • Harvest the bacterial cells by centrifugation at 14,000g for 1min at 4℃. Remove the medium by decanting.
  • Transfer the half of the culture to same tube and harvest as same. Remove the medium by pippetting.
  • Resuspend pelleted bacterial cells in 250µL Buffer P1 and mix thoroughly by pippeting.
  • Add 250µL Buffer P2 and mix thoroughly by inverting the tube gently 4-6 times.
  • Add 350µL Buffer N3 and mix immediately and thoroughly by inverting the tube 4-6 times.
  • Centrifuge for 10min at 14,000g at 4℃.
  • Apply the supernatants from step 10 to the QIAprep spin column by pipetting.
  • Centrifuge for 10s in a table-top microcentrifuge. Discard the flow-through.
  • Wash the QIAprep spin column by adding 0.5mL Buffer PB and centrifuging for 10s in a table-top microcentrifuge. Discard the flow-through.
  • Wash QIAprep spin column by adding 0.65mL Buffer PeE and centrifuging fo 10s in a table-top microcentrifuge.
  • Discard the flow-through, and centrifuge for and additional 1min to remove residual wash buffer.
  • Place the QIAprep column in a clean tube. To elute DNA, add 50µL water to the center of each QIAprep spin column, let stand for 1min, and centrifuge for 1min.
  • Discard the QIAprep spin column.
  • Measure the concentration of DNA by using eppendorf BioPhotometer plus.
  • Restriction Digestion.
  • Agarose Gel Electrophoresis for Confirmation.

Ethanol Precipitation=

Use Ethachinmate (NIPPON GENE、312-01791).

  • Add 3.3 µL of 3M Sodium Acetate (attached with Ethachinmate) into 100µL of DNA solution.
  • Add 1µL of Ethachinmate.
  • Vortex.
  • Add ethanol, 200-250µL.
  • Vortex.
  • Centrifuge at 12000xg for 5min.
  • Precipitation.

Elecrophoresis

  • Prepare 200mL of a 1.0% agarose solution:
  • Measure 2.0g agarose into a beaker.
  • Add 200mL 1xTAE buffer.
  • Wrap the top of the beaker with plastic wrap.
  • Punch a hole through the wrap with a pipette tip (To let out steam).
  • Dissolve the agarose by heating in microwave and swirling without boiling.
  • Allow the agarose to cool.
  • Pour the agarose solution into a gel tray on a gel maker.
  • If there is air bubbles, pushing them with a pipette tip.
  • Place comb in the maker.
  • Cover the maker with a plastic wrap.
  • Let stand for about 45min.
  • Remove the comb carefully.
  • Store in the Tupperware in the refrigerator.
  • Place the tray in electrophoresis chamber.
  • Cover the tray with 1xTAE buffer.
  • To prepare samples for electrophoresi, add 1µL of 6x Loading Buffer for every 5µL of DNA solution and mix well.
  • Load 6µL of the DNA solution per well.
  • Electrophorese at 100V for about 30min until Loading Buffer have migrated approximately three-quaters of the gel.
  • Stain the gel in 0.5µg/mL ethidium bromide for 20-30min.
  • Rinse the gel with MilliQ.
  • Place a plastic wrap on the transilluminator in the cabinet of Printgraph.
  • Place the gel on the transilluminator.
  • Turn on the transilluminator and confirm the position of the gel.
  • Shoot the picture.
  • Turn off the transilluminator.
  • Dispose of the gel.

PCR Purification

Use Wizard SV Gel and PCR Clean-Up System by Promega.

  • Combine 1 part sample (PCR product) with one part Membrane Binding Solution (e.g. 50μl sample+ 50μl).
  • Apply the solution to the column, and let stand for 1min.
  • Centrifuge for 1min at 13000rpm. Discard the flow-through.
  • Add 700µl Membrane Wash Solution.
  • Centrifuge for 1min and discard the through.
  • Add 500μl Membrane Wash Solution.
  • Centrifuge for 5min and discard the through.
  • Place the column in a clean tube.
  • Add 60µl MilliQ to the center of each column, let stand for 1min.
  • Centrifuge for 1min at 13000rpm.
  • Discard the column.

qRT-PCR

Use QuantiTect SYBR green PCR kit Cat. No. 204143 by QIAGEN

  • Dilute primer to 1.5μM.
  • Dilute RT products.
  • Mix the following;

2x QuantiTect SYBR Green PCR Master Mix 22.5μL 1/20xRT products 4.5μL MilliQ 9μL total 36μL Mix the reaction mix thoroughly ,and dispense 36μL into 96 wells plate. Add primer set 9μL. Mix by inverting and voltex. Dispense 10μL into 384 wells plate and centrifuge. Let stand for 2min at 50°C and for 15min for 95°C. 40 cycles for 15sec at 95°C, for 30sec at 60°C, and for 1min at 72°C. Let stand for 15sec at 95°C. ・Ligation Make 2µL of Mixture (the vector and the insert at 1 : 5-10) and Control (only the vector). Add 5µL Ligation High, 1µL T4 Kinase, and 7µL MilliQ to create a solution. Incubate at 16℃ for 30 min. If the colonies of E.coli transformed with the Control ・Restrictive Digestion Use EcoRI, XbaI, SpeI, PstI, (NEB) Mix the following.

Sample 5µL 10xBuffer 1µL Restriction Enzyme 0.1µL MilliQ -3.9µL Let stand for 2h at 37℃

・Media M9 medium Stir Na2HPO4 6 g, KH2PO4 3 g, NaCl 0.5 g and NH4Cl 1 g with water 1 l. After autoclave, add 10 ml filter sterilized 100 mM MgSO4, 20 % glucose, 10 mM CaCl2, 100 mM thiamine-HCl. If you need, add 10 ml filter sterilized 20 % casamino acid. LB medium Stir Tryptone 20 g, Yeast extract 10 g and NaCl 10 g with water 200ml. If you make LB plates, add agar 10 g. Autoclave. SOB medium Stir Tryptone 20g and Yeast extract 5g with water. Add 2 ml 5 M NaCl and 840 ul 3 M KCl and add water up to 1 l. After autoclave, add 10 ml filter sterilized 1 M MgSO4 and 1 M MgCl2. SOC medium Add 2 M glucose 1 ml to 100 ml SOB. Buffer TB Stir PIPES and CaCl2・2H2O with 100 ml water. Add 8.315 ml 3 M KCl. Add KOH and adjust pH 6.8. Add MnCl2・4H2O. Add water up to 200 ml. Filter sterilize DNS reaegnt Add 1% DNS 88ml and Rochelle salt 25.5 g to 4.5% NaOH 30 ml (A solution) Add Phenol 1 g and water 7.8 ml to 10% NaOH 2.2 ml (B solution) Add NaHCO3 6.9g to B solution 6.9 ml Add A solution 118ml to B solution 6.9 ml Leave 2 days Store in brown bottle

Solubilization of Antibiotics Mix the following (Final concentration is 50mg/mL). Ampicillin: Ampicillin 1.0g MilliQ 20mL Kanamycin: Kanamycin 0.5g MilliQ 10mL Dispense 1.1mL of the solution into 1.5mL tubes. Store in the -20℃ freezer. Transformation Unfreeze conpitent cells on ice. Dry a plate by letting the plate upside down and partly open in incubator. Add 1µL DNA solution and 20µL compitent cells to 1.5mL tube, let stand for 30min on ice. If few colony is observed, increase the amount of the compitent cells or DNA, but make the amount of DNA not to get over that of the compitent cells. Heatshock for 60s at 42℃. Let stand for 2min on ice. Culture for 1h in preculture medium (LB or SOC medium), and plate by using spreader. Do not heat spreader too much because e.coli will dead for heat. ・Sequence Use Big Dye Terminator 3.1(ABI) Mix the following 5xBuffer 2µL Primer (3.2µM) 1µL Template Plasmid  200ng Big Dye Terminator 3.1 0.5µL MilliQ up to 10µL Let stand for 1min at 96℃. 35 cycles for 5s at 98℃, for 5s 50℃, and for 2.5min at 68℃. Add 25µL 100% ethanol and 1µL NAOAC

Florigen

Western blotting

Gel solution
Running gelStacking gel
1.5M Tris-HCl(pH8.8)2.5mL-
0.25M Tris-HCl(pH6.8)-3.0mL
30% Acrylamide5mL0.6mL
10% SDS0.2mL0.12mL
DW2.3mL2.3mL
TEMED15µL7µL
10% APS100µL60µL
Total10mL6mL
4x Sample buffer
1M Tris-HCl 2mL
SDS 0.8g
100% glycerol 4mL
14.7M mercaptoethanol 0.4mL
0.5M EDTA 1mL
Bromophenol blue 8.0mg
DW 2.6mL
10x electrode buffer
Tris 15.15g
Glycin 71.55g
10%SDS 50mL
DW 450mL
Total 500mL
blotting buffer
Tris 12g
Glycin 14.4g
DW 800mL
Methanol 200mL
TBST
50mM Tris
150mM NaCl
0.1% Tween-20
blocking buffer
  • TBST
  • 5% skim milk
AP color development buffer
  • 100mM Tris (pH8.5)
  • 100mM NaCl
  • 5mM MgCl2
  1. Spin down 100µL culture and suspend into sample buffer.
  2. Boil at 95°C for 10 min.
  3. Apply 10µL to polyacrylamide gel.
  4. Electrophorese at 500V, 30mA for 50 min.
  5. Transfer at 50V, 100mA for 30 min.
  6. Add blocking buffer to the membrane and incubate with shaking for 30 min. at room temperature.
  7. Add appropriate primary antibody diluted in TBST and incubate with shaking for 30 min. at RT.
  8. Wash with TBST and incubate with shaking for 10 min, two times.
  9. Add secondary antibody conjugated with AP and incubate with shaking for 30 min. at RT.
  10. Wash with TBST and incubate with shaking for 10 min, three times.
  11. Add 66µL NBT and 33µLof BCIP into color development buffer., and add the mixture to the membrane.
  12. After the coloring, wash with DW.

Verification of R9 function by GFP

Verification of R9 function by TAKEUCHI

R9(20µg/µL)0.9µL
GFP(1.2mg/mL)2.23µL
RBS16.85µL
total20µL

X5

Method:
1. Peel cuticles on parafilm by using the head of pencil.(Menasha,wI,54952)
2. Put plant cells into GFP&R9 or GFP for 5~30min.
3. Put plant cells into PBS.
4. Hoechst dyeing.

123456
R9oooxoo
cuticleooooxx
soak in GFP5min15min30min5min5min30min

<groupparts>iGEM012 Kyoto</groupparts>

Strains

E.coli

JM109 endA, recA1, gyrA96,thi,hsdR17,(rκ-,mκ+),relA1, supE44,λ-,Δ(lac-proAB),[F',traD36,proAB,laclqZΔM15]
BL21(DE3) F-, ompT, hsdSB(rB -mB - ), gal, dcm, (DE3)

Plant

Arabidopsis thaliana ecotype Columbia

Primers

Florigen

Namesequence
FT(RBS+)forwardgctctagagaaagaggagaaaGTCGACATGTCTATAAATATAAGAGACCCTCT
FT(RBS+)reverseaaactgcagcggccgctactagtaCCTTGAGCTCCTAAAGTCTTCTTCCTC
FT(RBS-)forwardggaattcgcggccgcttctagagATGTCTATAAATATAAGAGACCCTCTT
FT for sequence forwardTGACCATGATTACGCCAAGC
FT for sequence reverseACGGCCAGTGAATTGTAATACG
FT(+His)forwardTCTATAAATATAAGAGACCCTCTTATAGTAAGCAGAGTTG
FT(+His)reverseATGGTGATGGTGATGGTGCATGTCGACtttctcctctttctctagtatctcc
FT mutation forwardCATTCATCGTGTCGTGTTTATATTGTTTCG
FT mutation reverseCCAGCAGTGGGACTTGGATTTTCGTAACAC
FT mutation forward2CATTCATCGTGTCGTGTTTATATTGTTTCGACAGC
TUBULIN forwardAAACTCACTACCCCCAGCTTTG
TUBULIN reverseCACCAGACATAGTAGCAGAAATCAAGT
SEP3 forwardCTAAGACTAAGGTTAGCTGATGGGTA
SEP3 reverseATGATGACGACCGTAGTGATCAA
FUL forwardTGCGTAACCTCCTCCAGAGAT
FUL reverseGTTCTACTCGTTCGTAGTGGTAGGAC
AP1 forwardACATCCGCACTAGAAAAAACCAAC
AP1 reverseCTTGGTTCTGCTGATCCCACA