Team:Cornell/project/wetlab/results/protein

From 2012.igem.org

(Difference between revisions)
Line 79: Line 79:
To assess translational efficiency of mtrB in our constructs, we will be conducting western blots for MtrB. Because we were unable to obtain MtrB antibodies, we decided to use the commonly used cell biological method of appending poly-His tags for detection by poly-His antibodies. We are in the process of separately adding poly His tags with short Gly linkers to the N and C termini of p14K, p16K, SAL, and SAL2 for a total of 8 potential biobricks. In addition, the attachment of these His tags will facilitate purification of MtrB which may have future application for in vitro characterization of MtrB.  The primers used were as follows:  
To assess translational efficiency of mtrB in our constructs, we will be conducting western blots for MtrB. Because we were unable to obtain MtrB antibodies, we decided to use the commonly used cell biological method of appending poly-His tags for detection by poly-His antibodies. We are in the process of separately adding poly His tags with short Gly linkers to the N and C termini of p14K, p16K, SAL, and SAL2 for a total of 8 potential biobricks. In addition, the attachment of these His tags will facilitate purification of MtrB which may have future application for in vitro characterization of MtrB.  The primers used were as follows:  
<br><br>
<br><br>
-
<h4>p14K</h4>
+
 
-
<br>
+
-
<b>A. Poly-His Tag at N-terminus</b>
+
-
<br>
+
-
1. F: 5'- CATCACCAT-<span style="color:#FF0000;">GGATCC</span>-ATG- <span style="color:#00FF00;">CATCACCATCACCATCAC-GGAAGTGGA</span>- <span style="color:#0000FF;">AAATTTAAACTGAATTTG</span>- 3' (Dummy sequence- <span style="color:#FF0000;">BamHI</span>- Start codon- <span style="color:#00FF00;">His Tag- Linker</span>- <span style="color:#0000FF;">mtrB</span>)
+
-
<br>
+
-
2. R: REV_PRIME_mtrB
+
-
<br>
+
-
<b>B. Poly-His Tag at C-terminus</b>
+
-
<br>
+
-
3. F: FOR_Prime_mtrB
+
-
<br>
+
-
4. R: 5'- CATCACCAT-<span style="color:#FF0000;">GGTACC</span>- TTA-<span style="color:#00FF00;">GTGATGGTGATGGTGATG-TCCACTTCC</span>-<span style="color:#0000FF;">GAGTTTGTAACTCATGCT</span>- 3' (Dummy Sequence- <span style="color:#FF0000;">KpnI</span>- Stop Codon- <span style="color:#00FF00;">His Tag- Linker</span>- <span style="color:#0000FF;">mtrB)</span>
+
-
<br><br>
+
-
<h4>p16K</h4>
+
-
<br>
+
-
<b>C. Poly-His Tag at N-terminus</b>
+
-
<br>
+
-
F: 5'- CATCACCAT- <span style="color:#FF0000;">GGCGCGCC</span>- ATG- <span style="color:#00FF00;">CATCACCATCACCATCAC-GGAAGTGGA</span>- <span style="color:#0000FF;">AAATTTAAACTGAATTTG</span>- 3' (Dummy Sequence- <span style="color:#FF0000;">AscI</span>- Start Codon- <span style="color:#00FF00;">His Tag-Linker</span>- <span style="color:#0000FF;">mtrB</span>)
+
-
<br>
+
-
R: 5' - CATCACCAT- <span style="color:#FF0000;">ACTAGT</span>- <span style="color:#0000FF;">TTAGAGTTTGTAACTCATGCT</span>- 3' (Dummy Sequence- <span style="color:#FF0000;">SpeI</span>- <span style="color:#0000FF;">mtrB</span>)
+
-
<br>
+
-
<b>D. Poly-His at C-terminus</b>
+
-
<br>
+
-
F: 5'- CATCACCAT- <span style="color:#FF0000;">GGCGCGCC</span>- <span style="color:#0000FF;">ATGAAATTTAAACTGAATTTG</span>- 3' (Dummy Sequence- <span style="color:#FF0000;">AscI</span>- <span style="color:#0000FF;">mtrB</span>)
+
-
<br>
+
-
R: 5' - CATCACCAT- <span style="color:#FF0000;">ACTAGT</span>- TTA- <span style="color:#00FF00;">GTGATGGTGATGGTGATG-TCCACTTCC</span>-<span style="color:#0000FF;">GAGTTTGTAACTCATGCT</span>- 3' (Dummy Sequence- <span style="color:#FF0000;">SpeI</span>- Stop Codon- <span style="color:#00FF00;">His Tag- Linker</span>- <span style="color:#0000FF;">mtrB</span>)
+
-
<br><br>
+
-
<h4>Sal 1</h4>
+
-
<br>
+
-
Same as A and B
+
-
<br><br>
+
-
<h4>Sal 2</h4>
+
-
<br>
+
-
Same as C and D
+
</div>
</div>
</div>
</div>

Revision as of 01:04, 27 October 2012

MtrB Protein Expression

Western Blots for MtrB

To assess translational efficiency of mtrB in our constructs, we will be conducting western blots for MtrB. Because we were unable to obtain MtrB antibodies, we decided to use the commonly used cell biological method of appending poly-His tags for detection by poly-His antibodies. We are in the process of separately adding poly His tags with short Gly linkers to the N and C termini of p14K, p16K, SAL, and SAL2 for a total of 8 potential biobricks. In addition, the attachment of these His tags will facilitate purification of MtrB which may have future application for in vitro characterization of MtrB. The primers used were as follows:

Retrieved from "http://2012.igem.org/Team:Cornell/project/wetlab/results/protein"