Team:BAU-Indonesia/Abstract

From 2012.igem.org

Revision as of 11:24, 26 September 2012 by Aditrianr (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)


Metamorphosis Design Free Css Templates

Abstract == Plastic Terminator ==

Indonesia is known as the 4th highest population densities around the world. Nowadays, 1.5 million tons/year from human activity which is used in the world is PET. PET is a thermoplastic polymer resin, not easily degraded naturally. Based on this background, the BAU-Indonesia team designs a plasmid which is contains of encoding cutinase degrading enzymes of producing PET. The early stage of this project was done by the preservation of plastic waste bacteria from landfills at Galuga. The bacteria were cultured in liquid media which is contained yeast extract powder and PET enrichment. The result of this preservation will be followed by the isolation of DNA and PCR with Cutinase F primer'ACGCGCCGGGCGTCACCGAGCA'3 and R 5'ACGCGTCGTGCCGTCAGGGCCA'3. Cutinase gen that were amplified will be inserted to plasmid pSB1C3. The recombinant plasmid which contained the cutinase gene will be introduced into E. coli. Finally it will be used as PET biodegradator product.