http://2012.igem.org/wiki/index.php?title=Special:Contributions/Shepherd&feed=atom&limit=50&target=Shepherd&year=&month=2012.igem.org - User contributions [en]2024-03-28T18:17:59ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/Team:Freiburg/Project/OverviewTeam:Freiburg/Project/Overview2012-10-27T03:31:52Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= The GATE Assembly Kit =<br />
----<br />
<br><br />
<div align="justify">TALEs make sequence-specific genome modification much easier than before and therefore attract great interest in the synbio community and beyond. Interestingly, many of the researchers who hold the patents on TALEs also released open source toolkits for TALE assembly for academic research. However, most strategies of TALE gene assembly published thus far rely on a hierarchical procedure, that is very time consuming, laborious and not automatable.<br />
Therefore, we herein describe the Golden Gate cloning-based TAL Effector (GATE) Assembly platform, which enables literally everyone to produce low-cost, tailored TALEs within a few minutes of labwork and basic lab equipment. Moreover, we have automated this strategy and produced different TAL Effector Transcription Factors with 97 % success rate faster than any other method published before.<br />
<br><br />
<br />
<br />
== Review of existing TALE construction methods ==<br />
<br><br />
<div align="justify"><br />
Although TALE assembly is considerably easier than e.g. screening for novel zinc fingers, the highly repetitive structure of the TALE gene implies some challenges, because conventional PCR or homologous recombination-based gene assembly strategies cannot be applied.<br />
To our knowledge, the numerous approaches of TAL-Effector gene assembly, published so far, fall under the following three categories:<br />
<br />
<br />
1. Few groups have applied methods called unit assembly<sup>1</sup> or Restriction Enzyme And Ligation (REAL)<sup>2</sup>. In the first step, both strategies perform conventional restriction enzyme digestion in order to assemble two gene fragments of single repeats. The pairs of repeat gene fragments are subsequently assembled to form tetramers, and this highly hierarchical assembly strategy is continued until the desired number of repeats is assembled. These platforms obviously involve multiple laborious and time consuming rounds of digestion, ligation and isolation of the right ligation products. The recently published fast ligation-based automatable solid-phase high-throughput (FLASH) system circumvents major challenges of REAL by attaching the first repeat to streptavidin-coated magnetic beads and, successively, adding further repeats or oligorepeats from a 376-plasmid library. Although Reyon et al.<sup>11</sup> claim that FLASH can also be performed manually, this probably does not represent the most convenient and low-cost protocol for iGEM students.<br />
<br />
<br />
2. We call the second category of TALE production methods the synthesis optimization approach. The major challenge of TAL synthesis is the highly repetitive amino acid sequence of the DNA binding part. Since synthetic genes are typically produced from overlapping synthesized oligos, overlaps of different pairs of overlapping oligos need to be distinct. The synthesis optimization approach employs a sophisticated computer program that optimizes codon usage in order to reduce repetitiveness of the TAL gene and calculates optimal oligos for synthesis<sup>3,4</sup>. Although this approach might be the method of the future, it is currently too expensive for iGEM teams. <br />
<br />
<br />
3. The third category of TALE assembly protocols applies Golden Gate Cloning (GGC)<sup>5,6,7,8,9</sup> (for details on GGC, see the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard page]]). In all GGC-based TALE repeat assembly strategies, level 1 modules (i.e. single repeat gene fragments) are flanked by type IIs restriction sites adjacent to their first or last 4 nucleotides, respectively, that produce sticky ends after digestion with the type IIs restriction enzyme. Since each level 1 module codes for the same amino acid sequence (despite of the RVDs), the codon usage must be changed at these 4 external nucleotides for producing unique sticky ends that assemble in the predefined order after digestion. Consequently, the 4 bp overlaps of a level 1 module specify its future position within the TALE gene.<br />
So, in order to be able to target any sequence of DNA, a method that is using GGC requires N x K modules. N signifies the number of level 1 module positions (i.e. number of modules that the TALE should contain after GGC) and K signifies the number of different repeats that the user should be able to put into each of the N positions (in most kits K equals 4, one repeat for each DNA base, see figure 1).<br />
<br><br><br />
[[File:Conventionaltalconstruction.jpg|600px|center|link=]]<br />
<p align="center">Figure 1: Conventional TAL construction kit <sup>6</sup></p><br />
<br><br />
Unfortunately, using GGC, only up to 10 modules <sup>5</sup> can be assembled with high accuracy. So in the GGC-based protocols, level 1 modules get assembled to form level 2 modules (oligorepeats). These level 2 modules need to be amplified and isolated before a second GGC reaction assembles them to form the complete repeat array. The bottleneck of the GGC-based methods is the need for amplification and isolation of level 2 modules, which costs a lot of time, requires some extra knowledge, additional enzymes and lab equipment (we actually tried one of the GGC-based open source kits, but, even after 2.5 weeks, were not able to assemble the whole TALE).<br><br><br />
<br />
<br />
<br />
== GATE Assembly Kit ==<br />
<br />
<br><br />
<div align="justify">Right from the beginning, we were very much intrigued by the efficiency of Golden Gate Cloning and hypothesized, that instant TAL assembly would be possible if we overcame the need for a second (or even third) round of GGC. Since we were sure we were not able to improve GGC reaction conditions so much that we could actually assemble all repeats at once, we came up with another solution: Why not use direpeats instead of single repeats as level 1 modules? This would cut the number of level 1 modules half and allow us to perform TAL assembly in one single reaction. Unfortunately, our idea would not only cut half N but would also quadruple K, and thus would double the toolkit size.<br />
<br><br />
<br />
[[Image:Synthese_3.png|200px|center|no frame|link=]]<br />
<br />
<br><br />
So we needed to further reduce N down to 6 to obtain a reasonable toolkit size of 96 level 1 modules. We actually liked the idea that our kit would perfectly fit on a 96 well plate.<br />
<br><br><br />
<br />
[[Image:Toolkit.png|700px|center|no frame|link=]]<br />
<br />
<br><br />
Next, we looked into the literature to check, if TALEs that recognize 14 bp (instead of around 18 bp) are actually functional. We were very fortunate to see that efficiency of TAL transcription factors (TAL-TFs)<sup>10 </sup> and TAL effector nucleases (TALENs)<sup>11 </sup> remains constant between for target sequences between 13 and 20 bp. Moreover, Zhang et al. published splendid results with 14 bp-binding TAL-TFs in a human cell line<sup>7</sup>. <br />
Since we wanted our TALEs to function in both bacteria and eukaryotic systems, while published TAL repeats were always designed for one particular organism, we decided to design the direpeat nucleotide sequences from scratch: We used the amino acid sequence of the hex3 gene of Xanthomonas oryzae to find out the amino acid sequences for the 16 direpeats. Next, we reverse-tanslated the sequences into DNA, codon optimized them for E.coli and human cells and reduced homologies between and within gene fragments (only the extention PCR binding sites were the same for every direpeat gene).<br />
After receiving the sequences that were synthesized as G-blocks by IDT, we performed 6 extention PCRs on every sequence to add 4 bp overlaps, BsmBI restriction sites and iGEM prefix and suffix to the parts. The 4 bp overlaps would later determine the position of the respective direpeat in the repeat array of the TALE.<br />
<br><br><br />
<br />
[[Image:Biobrickfreigem.png|500px|center|no frame|link=]]<br />
<br><br><br><br><br />
<br />
[[Image:Extension3.png|600px|center|no frame|link=]]<br />
<br />
<br><br />
One of the advantages of GGC is that you can insert complete plasmids containing the parts you want to assemble. So we decided to clone all 96 parts into the standard iGEM vector pSB1C3. We hypothesized that the BsmBI restriction site in the chloramphenicol gene would decrease GGC efficiency, so we performed a mutagenesis PCR to introduce the silent mutation (G434C) prior to cloning the 96 PCR products into it. When doing so many cloning experiments at a time, error rate needs to be minimal, so at first, we spent weeks optimizing every single step from the G-block to the Golden Gate standard compatible BioBrick (see [[Team:Freiburg/Project/Golden#GGC|protocol section]]). In the end, we are very happy that we have a full GATE assembly kit with [[Team:Freiburg/Parts|96 unique direpeats]] and 100% accurate sequencing results.<br />
Our first attempts to use the GATE assembly kit were actually very discouraging - no colonies were found on the agar plates after transforming the GGC product into DH10B cells for more than one week - at least, we knew that our ccdb kill cassette was working well (details about the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">expression vector</a></html>). After systematically testing all kinds of buffers and reaction additives, the results where quite overwhelming. We were even able to dramatically reduce GGC reaction time down to 2.5 hours - which is probably the fastest way anyone has ever built a custom tal effector.<br />
<br />
<br><br><br />
<br />
== References ==<br />
<br><br />
1. Huang, P. et al. Heritable gene targeting in zebrafish using customized TALENs. ''Nat Biotechnol'' 29, 699–700 (2011).<br><br />
2. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol 2''9, 697–698 (2011).<br><br />
3. Hoover, D. M. & Lubkowski, J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. ''Nucl Acids Res'' 30, e43–e43 (2002).<br><br />
4. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nat Biotechnol'' 29, 143–148 (2010).<br><br />
5. Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. Assembly of Custom TALE-Type DNA Binding Domains by Modular Cloning. ''Nucl Acids Res'' 39, 5790–5799 (2011).<br><br />
6. Weber, E., Gruetzner, R., Werner, S., Engler, C. & Marillonnet, S. Assembly of designer TAL effectors by golden gate cloning. ''PloS one'' 6, e19722 (2011).<br><br />
7. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nat Biotechnol'' 29, 149–153 (2011).<br><br />
8. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucl Acids Res'' 39, e82 (2011).<br><br />
9. Li, T. et al. Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes. ''Nucl Acids Res'' 39, 6315–6325 (2011).<br><br />
10. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br><br />
11. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nat Biotechnol'' 30, 460–465 (2012).<br />
<br />
<br />
<br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<!--- The Mission, Experiments ---></div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T03:24:20Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorbs light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <br><img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/><br> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br><br></html><br />
<br />
== Precise Gene Knockout ==<br />
----<br />
<html><br />
<p><br><br />
TALENs are a very powerful tool for efficient gene knockout. In order to prove that our TALEN construct was functional, we decided to simply knock out a destabilized GFP gene on a plasmid, which we co-transfected with our TALEN plasmids into HEK cells. Moreover, we also transfected our cells with an mCherry vector to normalize for transfection efficiency. TAL constructs were designed to bind to opposite strands of the target plasmid in a way that the FokI monomers of each TALEN construct would be able to dimerize in the spacer region between the TALEN binding sites. 48 hours after transfection, gene knock-out efficiency was evaluated by FACS analysis.<br />
<br><br><br />
</html><br />
[[File:xx.png]]<br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/File:Xx.pngFile:Xx.png2012-10-27T03:23:38Z<p>Shepherd: </p>
<hr />
<div></div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T03:23:25Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorbs light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <br><img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/><br> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br><br></html><br />
<br />
== Precise Gene Knockout ==<br />
----<br />
<html><br />
<p><br><br />
TALENs are a very powerful tool for efficient gene knockout. In order to prove that our TALEN construct was functional, we decided to simply knock out a destabilized GFP gene on a plasmid, which we co-transfected with our TALEN plasmids into HEK cells. Moreover, we also transfected our cells with an mCherry vector to normalize for transfection efficiency. TAL constructs were designed to bind to opposite strands of the target plasmid in a way that the FokI monomers of each TALEN construct would be able to dimerize in the spacer region between the TALEN binding sites. 48 hours after transfection, gene knock-out efficiency was evaluated by FACS analysis.<br />
<br />
</html><br />
[[File:xx.png]]<br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T03:20:44Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorbs light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <br><img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/><br> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br><br></html><br />
<br />
== Precise Gene Knockout ==<br />
----<br />
<html><br />
<p><br><br />
TALENs are a very powerful tool for efficient gene knockout. In order to prove that our TALEN construct was functional, we decided to simply knock out a destabilized GFP gene on a plasmid, which we co-transfected with our TALEN plasmids into HEK cells. Moreover, we also transfected our cells with an mCherry vector to normalize for transfection efficiency. TAL constructs were designed to bind to opposite strands of the target plasmid in a way that the FokI monomers of each TALEN construct would be able to dimerize in the spacer region between the TALEN binding sites. 48 hours after transfection, gene knock-out efficiency was evaluated by FACS analysis.<br />
<br />
</html><br />
[[File:FOKI.png]]<br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/File:TALF.pngFile:TALF.png2012-10-27T03:19:56Z<p>Shepherd: asef</p>
<hr />
<div>asef</div>Shepherdhttp://2012.igem.org/File:FOKI.pngFile:FOKI.png2012-10-27T03:17:25Z<p>Shepherd: </p>
<hr />
<div></div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T03:16:57Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorbs light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <br><img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/><br> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br><br></html><br />
<br />
== Precise Gene Knockout ==<br />
----<br />
<html><br />
<p><br><br />
TALENs are a very powerful tool for efficient gene knockout. In order to prove that our TALEN construct was functional, we decided to simply knock out a destabilized GFP gene on a plasmid, which we co-transfected with our TALEN plasmids into HEK cells. Moreover, we also transfected our cells with an mCherry vector to normalize for transfection efficiency. TAL constructs were designed to bind to opposite strands of the target plasmid in a way that the FokI monomers of each TALEN construct would be able to dimerize in the spacer region between the TALEN binding sites. 48 hours after transfection, gene knock-out efficiency was evaluated by FACS analysis.<br />
<br />
</html><br />
[[File:FOKI]]<br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T03:16:10Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorbs light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <br><img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/><br> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br><br></html><br />
<br />
== Precise Gene Knockout ==<br />
----<br />
<html><br />
<p><br><br />
TALENs are a very powerful tool for efficient gene knockout. In order to prove that our TALEN construct was functional, we decided to simply knock out a destabilized GFP gene on a plasmid, which we co-transfected with our TALEN plasmids into HEK cells. Moreover, we also transfected our cells with an mCherry vector to normalize for transfection efficiency. TAL constructs were designed to bind to opposite strands of the target plasmid in a way that the FokI monomers of each TALEN construct would be able to dimerize in the spacer region between the TALEN binding sites. 48 hours after transfection, gene knock-out efficiency was evaluated by FACS analysis.<br />
<br />
</html><br />
[[File:TALEN.png]]<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/File:TALEN.pngFile:TALEN.png2012-10-27T03:08:03Z<p>Shepherd: </p>
<hr />
<div></div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T03:05:18Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorbs light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <br><img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/><br> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br><br></html><br />
<br />
== Precise Gene Knockout ==<br />
----<br />
<html><br />
<p><br><br />
TALENs are a very powerful tool for efficient gene knockout. In order to prove that our TALEN construct was functional, we decided to simply knock out a destabilized GFP gene on a plasmid, which we co-transfected with our TALEN plasmids into HEK cells. Moreover, we also transfected our cells with an mCherry vector to normalize for transfection efficiency. TAL constructs were designed to bind to opposite strands of the target plasmid in a way that the FokI monomers of each TALEN construct would be able to dimerize in the spacer region between the TALEN binding sites. 48 hours after transfection, gene knock-out efficiency was evaluated by FACS analysis.<br />
<br />
</html><br />
[[File:Unbenannt.xcf]]<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T03:04:38Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorbs light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <br><img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/><br> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br><br></html><br />
<br />
== Precise Gene Knockout ==<br />
----<br />
<html><br />
<p><br><br />
TALENs are a very powerful tool for efficient gene knockout. In order to prove that our TALEN construct was functional, we decided to simply knock out a destabilized GFP gene on a plasmid, which we co-transfected with our TALEN plasmids into HEK cells. Moreover, we also transfected our cells with an mCherry vector to normalize for transfection efficiency. TAL constructs were designed to bind to opposite strands of the target plasmid in a way that the FokI monomers of each TALEN construct would be able to dimerize in the spacer region between the TALEN binding sites. 48 hours after transfection, gene knock-out efficiency was evaluated by FACS analysis.<br />
<br />
[[File:Example.jpg]]</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T02:54:10Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorbs light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <br><img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/><br> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br><br></html><br />
<br />
== Precise Gene Knockout ==<br />
----<br />
<html><br />
<p><br><br />
TALENs are a very powerful tool for efficient gene knockout. In order to prove that our TALEN construct was functional, we decided to simply knock out a destabilized GFP gene on a plasmid, which we co-transfected with our TALEN plasmids into HEK cells. Moreover, we also transfected our cells with an mCherry vector to normalize for transfection efficiency. TAL constructs were designed to bind to opposite strands of the target plasmid in a way that the FokI monomers of each TALEN construct would be able to dimerize in the spacer region between the TALEN binding sites. 48 hours after transfection, gene knock-out efficiency was evaluated by FACS analysis.<br />
<br />
<br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T02:48:47Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorbs light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
<br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
<br />
== Precise Gene Knockout ==<br />
TALENs are a very powerful tool for efficient gene knockout. In order to prove that our TALEN construct was functional, we decided to simply knock out a destabilized GFP gene on a plasmid, which we co-transfected with our TALEN plasmids into HEK cells. Moreover, we also transfected our cells with an mCherry vector to normalize for transfection efficiency. TAL constructs were designed to bind to opposite strands of the target plasmid in a way that the FokI monomers of each TALEN construct would be able to dimerize in the spacer region between the TALEN binding sites. 48 hours after transfection, gene knock-out efficiency was evaluated by FACS analysis.<br />
<br />
<br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T02:16:10Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorbs light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
<br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T02:07:51Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow, you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorps light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
<br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T02:06:45Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorps light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
<br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T02:04:54Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the [[Team:Freiburg/Project/Golden Gate Standard|Golden Gate Standard section]] of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorps light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
<br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T02:02:57Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br>Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform.<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the Golden Gate Standard section of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorps light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
<br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T02:01:31Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
<br><br><br />
== The Toolkit ==<br />
----<br />
<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the Golden Gate Standard section of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br><br />
<br />
== Creation of TAL sequences - Golden Gate Cloning ==<br />
----<br />
<br><br />
Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform<br />
<br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vivo'' testing =<br />
<br><br><br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorps light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
<br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T02:00:47Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
----<br />
== The Toolkit ==<br />
----<br />
<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the Golden Gate Standard section of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br><br />
<br />
== Creation of TAL sequences - Golden Gate Cloning ==<br />
----<br />
<br><br />
Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform<br />
<br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
= ''In vitro'' testing =<br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorps light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
<br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T02:00:24Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
----<br />
== The Toolkit ==<br />
----<br />
<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the Golden Gate Standard section of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br><br />
<br />
== Creation of TAL sequences - Golden Gate Cloning ==<br />
----<br />
<br><br />
Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform<br />
<br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorps light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
<br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T01:58:21Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= ''In vitro'' testing =<br />
----<br />
== The Toolkit ==<br />
----<br />
<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the Golden Gate Standard section of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br><br />
<br />
== Creation of TAL sequences - Golden Gate Cloning ==<br />
----<br />
<br><br />
Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform<br />
<br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorps light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
== The Toolkit ==<br />
----<br />
<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the Golden Gate Standard section of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br><br />
<br />
== Creation of TAL sequences - Golden Gate Cloning ==<br />
----<br />
<br><br />
Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform<br />
<br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T01:54:51Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Experiments =<br />
----<br />
<br />
<br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorps light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
== The Toolkit ==<br />
----<br />
<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the Golden Gate Standard section of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br><br />
<br />
== Creation of TAL sequences - Golden Gate Cloning ==<br />
----<br />
<br><br />
Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform<br />
<br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP). In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T01:50:37Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Experiments =<br />
----<br />
<br />
<br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorps light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
== The Toolkit ==<br />
----<br />
<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the Golden Gate Standard section of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br><br />
<br />
== Creation of TAL sequences - Golden Gate Cloning ==<br />
----<br />
<br><br />
Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform<br />
<br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeat array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 33 clones of different GATE assemblies and analyzed the results: In 32 of the 33 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 97 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP).In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them two to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over a period of time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples, that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T01:46:43Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Experiments =<br />
----<br />
<br />
<br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorps light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
== The Toolkit ==<br />
----<br />
<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the Golden Gate Standard section of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br><br />
<br />
== Creation of TAL sequences - Golden Gate Cloning ==<br />
----<br />
<br><br />
Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform<br />
<br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeat array of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeats array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 28 clones of different GATE assemblies and analyzed the results: in 27 of the 28 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 96 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP).In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them two to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over a period of time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples, that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T01:45:37Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Experiments =<br />
----<br />
<br />
<br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorps light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
== The Toolkit ==<br />
----<br />
<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the Golden Gate Standard section of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br><br />
<br />
== Creation of TAL sequences - Golden Gate Cloning ==<br />
----<br />
<br><br />
Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform<br />
<br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To assess, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeats of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeats array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 28 clones of different GATE assemblies and analyzed the results: in 27 of the 28 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 96 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP).In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them two to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over a period of time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples, that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-27T01:09:15Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Experiments =<br />
----<br />
<br />
<br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorps light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
== The Toolkit ==<br />
----<br />
<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the Golden Gate Standard section of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br><br />
<br />
== Creation of TAL sequences - Golden Gate Cloning ==<br />
----<br />
<br><br />
Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang group in Nature this year<sup>1</sup> (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform<br />
<br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To asses, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeats of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>2</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeats array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 28 clones of different GATE assemblies and analyzed the results: in 27 of the 28 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 96 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP).In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them two to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids(++) yielded a high increase in SEAP activity, compared to the control samples. Also the control experiment with a TAL-VP64 targeting a random sequence shows the specificity of our system. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over a period of time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples, that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
<br><br><br><br />
== Reference ==<br />
1. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br><br />
2. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/RobotTeam:Freiburg/Project/Robot2012-10-27T01:01:26Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
<br />
= Automating TAL production =<br />
----<br />
<br><div align="justify">Because of the simplicity of our toolkit, it is easily possible to automate TAL production. This will help to meet the high demand for TAL effectors and, at the same time, will further reduce costs of TAL production.<br />
<br />
<br />
== How it is today ==<br />
<br />
<br />
Ordering TAL effectors today can be a tough decision for a scientist. Not only is it complicated but also unbelievably expensive and time consuming. We checked some of the commercially available TAL products and found prices up to 5000 Euros for production of just one custom TAL nuclease pair. For support, it was necessary to pay another 1000 Euros and you had to wait for several weeks until your TAL was finished and shipped.<br />
<br />
<br />
== How it will be tomorrow ==<br />
<br />
<br />
The market for TAL effectors, especially TAL nucleases, is dominated by only a few companies. These companies are setting prices for TAL effectors and make a living selling overpriced products to scientist all over the world. <br><br>With our toolkit, this practice hopefully comes to an end, as we shift the production of high quality TAL proteins into your hands. Our toolkit is not only easy to use and affordable, it is also automatable. The few steps that are necessary to produce TAL proteins with our kit are easily done by a pipetting robot in virtually no time. You can have 96 different TAL effectors on one plate in one run, put all of them into a thermocycler and use them directly afterwards.<br />
<br><br><br />
<html><br />
<div style="center"><br />
<iframe width="560" height="315" style="margin-left:80px; margin-top:20px ;margin-bottom:0;"<br />
src="http://www.youtube.com/embed/ethFqvq1g3U?feature=player_detailpage" <br />
frameborder="0" allowfullscreen></iframe><br />
<div style="text-align:center;margin-top:0;">Automated TAL production with a pippeting robot in our lab</div><br />
</div><br />
</html><br><br><br />
= Inventing new classes of TALEs =<br />
----<br />
<br><div align="justify">For the past three years, only two types of TAL effectors have been known: TAL transcription factors and TALENs. We believe that many more effectors can be fused to the TAL protein. We therefore created a platform that allows future iGEM students to easily produce their own new classes of TAL effectors.<br />
We are actually still working on two of them: We have fused the catalytic domain of Suv 39 H1 to the c-terminus of our TAL scaffold to set histone marks in a sequence specific manner. Unfortunately, optimizing a chip assay (which, in combination with qPCR is our readout for this effector) takes much longer than expected, but we hope, that we will one day be able to open the field of epigenetics to synthetic biology. Another interesting project we have started working on are TAL effector recombinases. These are n-terminal fusion proteins of TALEs and serine recombinases. Interestingly, in serine recombinases, the DNA binding domain is spatially distinct from the catalytic domain. We therefore wanted to replace the natural DNA binding domain by the TAL scaffold to obtain an universal recombinase.<br />
Very recently, Mercer et al.<sup>1</sup> published exactly the project we have been working on. Although their publication is only the starting point of this class of TAL Effector Recombinases (TALERs) this technology could be another TAL-based revolution in synthetic biology in the next few years. Imagine using this technology, that allows you to excise or integrate any sequence of DNA at any locus in a genome with high efficiency!<br><br />
We believe that the potential for new types of TAL effectors is huge and we are looking forward to seeing new such technologies arise from future iGEM competitions.<br />
<br><br><br />
= References =<br />
----<br />
1. Mercer, A. C., Gaj, T., Fuller, R. P. & Barbas, C. F. Chimeric TALE recombinases with programmable DNA sequence specificity. Nucl. Acids Res. (2012).doi:10.1093/nar/gks875<br />
<br />
<br><br><br><br><br>[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/RobotTeam:Freiburg/Project/Robot2012-10-27T01:00:34Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
<br />
= Automating TAL production =<br />
----<br />
<br><div align="justify">Because of the simplicity of our toolkit, it is easily possible to automate TAL production. This will help to meet the high demand for TAL effectors and, at the same time, will further reduce costs of TAL production.<br />
<br />
<br />
== How it is today ==<br />
<br />
<br />
Ordering TAL effectors today can be a tough decision for a scientist. Not only is it complicated but also unbelievably expensive and time consuming. We checked some of the commercially available TAL products and found prices up to 5000 Euros for production of just one custom TAL nuclease pair. For support, it was necessary to pay another 1000 Euros and you had to wait for several weeks until your TAL was finished and shipped.<br />
<br />
<br />
== How it will be tomorrow ==<br />
<br />
<br />
The market for TAL effectors, especially TAL nucleases, is dominated by only a few companies. These companies are setting prices for TAL effectors and make a living selling overpriced products to scientist all over the world. <br><br>With our toolkit, this practice hopefully comes to an end, as we shift the production of high quality TAL proteins into your hands. Our toolkit is not only easy to use and affordable, it is also automatable. The few steps that are necessary to produce TAL proteins with our kit are easily done by a pipetting robot in virtually no time. You can have 96 different TAL effectors on one plate in one run, put all of them into a thermocycler and use them directly afterwards.<br />
<br><br><br />
<html><br />
<div style="center"><br />
<iframe width="560" height="315" style="margin-left:80px; margin-top:20px ;margin-bottom:0;"<br />
src="http://www.youtube.com/embed/ethFqvq1g3U?feature=player_detailpage" <br />
frameborder="0" allowfullscreen></iframe><br />
<div style="text-align:center;margin-top:0;">Automated TAL production with a pippeting robot in our lab</div><br />
</div><br />
</html><br><br><br />
= Inventing new classes of TALEs =<br />
----<br />
<br><div align="justify">For the past three years, only two types of TAL effectors have been known: TAL transcription factors and TALENs. We believe that many more effectors can be fused to the TAL protein. We therefore created a platform that allows future iGEM students to easily produce their own new classes of TAL effectors.<br />
We are actually still working on two of them: We have fused the catalytic domain of Suv 39 H1 to the c-terminus of our TAL scaffold to set histone marks in a sequence specific manner. Unfortunately, optimizing a chip assay (which, in combination with qPCR is our readout for this effector) takes much longer than expected, but we hope, that we will one day be able to open the field of epigenetics to synthetic biology. Another interesting project we have started working on are TAL effector recombinases. These are n-terminal fusion proteins of TALEs and serine recombinases. Interestingly, in serine recombinases, the DNA binding domain is spatially distinct from the catalytic domain. We therefore wanted to replace the natural DNA binding domain by the TAL scaffold to obtain an universal recombinase.<br />
Very recently, Mercer et al.<sup>1</sup> published exactly the project we have been working on. Although their publication is only the starting point of this class of TAL Effector Recombinases (TALERs) this technology could be another TAL-based revolution in synthetic biology in the next few years. Imagine using this technology, that allows you to excise or integrate any sequence of DNA at any locus in a genome with high efficiency!<br />
We believe that the potential for new types of TAL effectors is huge and we are looking forward to seeing new such technologies arise from future iGEM competitions.<br />
<br><br><br />
= References =<br />
----<br />
1. Mercer, A. C., Gaj, T., Fuller, R. P. & Barbas, C. F. Chimeric TALE recombinases with programmable DNA sequence specificity. Nucl. Acids Res. (2012).doi:10.1093/nar/gks875<br />
<br />
<br><br><br><br><br>[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/RobotTeam:Freiburg/Project/Robot2012-10-27T00:56:30Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
<br />
= Automating TAL production =<br />
----<br />
<br><div align="justify">Because of the simplicity of our toolkit, it is easily possible to automate TAL production. This will help to meet the high demand for TAL effectors and, at the same time, will further reduce costs of TAL production.<br />
<br />
<br />
== How it is today ==<br />
<br />
<br />
Ordering TAL effectors today can be a tough decision for a scientist. Not only is it complicated but also unbelievably expensive and time consuming. We checked some of the commercially available TAL products and found prices up to 5000 Euros for production of just one custom TAL nuclease pair. For support, it was necessary to pay another 1000 Euros and you had to wait for several weeks until your TAL was finished and shipped.<br />
<br />
<br />
== How it will be tomorrow ==<br />
<br />
<br />
The market for TAL effectors, especially TAL nucleases, is dominated by only a few companies. These companies are setting prices for TAL effectors and make a living selling overpriced products to scientist all over the world. <br><br>With our toolkit, this practice hopefully comes to an end, as we shift the production of high quality TAL proteins into your hands. Our toolkit is not only easy to use and affordable, it is also automatable. The few steps that are necessary to produce TAL proteins with our kit are easily done by a pipetting robot in virtually no time. You can have 96 different TAL effectors on one plate in one run, put all of them into a thermocycler and use them directly afterwards.<br />
<br><br><br />
<html><br />
<div style="center"><br />
<iframe width="560" height="315" style="margin-left:80px; margin-top:20px ;margin-bottom:0;"<br />
src="http://www.youtube.com/embed/ethFqvq1g3U?feature=player_detailpage" <br />
frameborder="0" allowfullscreen></iframe><br />
<div style="text-align:center;margin-top:0;">Automated TAL production with a pippeting robot in our lab</div><br />
</div><br />
</html><br><br><br />
= Inventing new classes of TALEs =<br />
----<br />
<br><div align="justify">For the past three years, only two types of TAL effectors were known: TAL transcription factors and TALENs. We believe that many more effectors can be fused to the TAL protein. We therefore created a platform for future iGEM students that allows them to easily produce their own new classes of TAL effectors. We are actually still working on two of them: We have fused the catalytic domain of Suv 39 H1 to the c-terminus of our TAL scaffold to set histone marks in a sequence specific manner. Unfortunately, optimizing a chip assay (which, in combination with qPCR is our readout for this effector) takes much longer than expected, but we hope, that we will one day be able to open the field of epigenetics to synthetic biology. Another interesting project we have started working on are TAL effector recombinases. These are n-terminal fusion proteins of TALEs and serine recombinases. Interestingly, in serine recombinases, the DNA binding domain is spatially distinct from the catalytic domain. We therefore wanted to replace the natural DNA binding domain by the TAL scaffold to obtain an universal recombinase.<br />
Very recently, Mercer et al.<sup>1</sup> published exactly the project we have been working on. Although their publication is only the starting point of this class of TAL Effector Recombinases (TALERs) this technology could be another TAL-based revolution in synthetic biology in the next few years.<br />
We believe that the potential for new types of TAL effectors is huge and we are looking forward to seeing new such technologies arise from future iGEM competitions.<br />
<br><br><br />
= References =<br />
----<br />
1. Mercer, A. C., Gaj, T., Fuller, R. P. & Barbas, C. F. Chimeric TALE recombinases with programmable DNA sequence specificity. Nucl. Acids Res. (2012).doi:10.1093/nar/gks875<br />
<br />
<br><br><br><br><br>[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/RobotTeam:Freiburg/Project/Robot2012-10-27T00:54:16Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
<br />
= Automating TAL production =<br />
----<br />
<br><div align="justify">Because of the simplicity of our toolkit, it is easily possible to automate TAL production. This will help to meet the high demand for TAL effectors and, at the same time, will further reduce costs of TAL production.<br />
<br />
<br />
== How it is today ==<br />
<br />
<br />
Ordering TAL effectors today can be a tough decision for a scientist. Not only is it complicated but also unbelievably expensive and time consuming. We checked some of the commercially available TAL products and found prices up to 5000 Euros for production of just one custom TAL nuclease pair. For support, it was necessary to pay another 1000 Euros and you had to wait for several weeks until your TAL was finished and shipped.<br />
<br />
<br />
== How it will be tomorrow ==<br />
<br />
<br />
The market for TAL effectors, especially TAL nucleases, is dominated by only a few companies. These companies are setting prices for TAL effectors and make a living selling overpriced products to scientist all over the world. <br><br>With our toolkit, this practice hopefully comes to an end, as we shift the production of high quality TAL proteins into your hands. Our toolkit is not only easy to use and affordable, it is also automatable. The few steps that are necessary to produce TAL proteins with our kit are easily done by a pipetting robot in virtually no time. You can have 96 different TAL effectors on one plate in one run, put all of them into a thermocycler and use them directly afterwards.<br />
<br><br><br />
<html><br />
<div style="center"><br />
<iframe width="560" height="315" style="margin-left:80px; margin-top:20px ;margin-bottom:0;"<br />
src="http://www.youtube.com/embed/ethFqvq1g3U?feature=player_detailpage" <br />
frameborder="0" allowfullscreen></iframe><br />
<div style="text-align:center;margin-top:0;">Automated TAL production with a pippeting robot</div><br />
</div><br />
</html><br><br><br />
= Inventing new classes of TALEs =<br />
----<br />
<br><div align="justify">For the past three years, only two types of TAL effectors were known: TAL transcription factors and TALENs. We believe that many more effectors can be fused to the TAL protein. We therefore created a platform for future iGEM students that allows them to easily produce their own new classes of TAL effectors. We are actually still working on two of them: We have fused the catalytic domain of Suv 39 H1 to the c-terminus of our TAL scaffold to set histone marks in a sequence specific manner. Unfortunately, optimizing a chip assay (which, in combination with qPCR is our readout for this effector) takes much longer than expected, but we hope, that we will one day be able to open the field of epigenetics to synthetic biology. Another interesting project we have started working on are TAL effector recombinases. These are n-terminal fusion proteins of TALEs and serine recombinases. Interestingly, in serine recombinases, the DNA binding domain is spatially distinct from the catalytic domain. We therefore wanted to replace the natural DNA binding domain by the TAL scaffold to obtain an universal recombinase.<br />
Very recently, Mercer et al.<sup>1</sup> published exactly the project we have been working on. Although their publication is only the starting point of this class of TAL Effector Recombinases (TALERs) this technology could be another TAL-based revolution in synthetic biology in the next few years.<br />
We believe that the potential for new types of TAL effectors is huge and we are looking forward to seeing new such technologies arise from future iGEM competitions.<br />
<br><br><br />
= References =<br />
----<br />
1. Mercer, A. C., Gaj, T., Fuller, R. P. & Barbas, C. F. Chimeric TALE recombinases with programmable DNA sequence specificity. Nucl. Acids Res. (2012).doi:10.1093/nar/gks875<br />
<br />
<br><br><br><br><br>[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/RobotTeam:Freiburg/Project/Robot2012-10-27T00:52:33Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
<br />
= Automating TAL production =<br />
----<br />
<br><div align="justify">Because of the simplicity of our toolkit, it is easily possible to automate TAL production. This will help to meet the high demand for TAL effectors and, at the same time, will further reduce costs of TAL production.<br />
<br />
<br />
== How it is today ==<br />
<br />
<br />
Ordering TAL effectors today can be a tough decision for a scientist. Not only is it complicated but also unbelievably expensive and time consuming. We checked some of the commercially available TAL products and found prices up to 5000 Euros for production of just one custom TAL nuclease pair. For support, it was necessary to pay another 1000 Euros and you had to wait for several weeks until your TAL was finished and shipped.<br />
<br />
<br />
== How it will be tomorrow ==<br />
<br />
<br />
The market for TAL effectors, especially TAL nucleases, is dominated by only a few companies. These companies are setting prices for TAL effectors and make a living selling overpriced products to scientist all over the world. <br><br>With our toolkit, this practice hopefully comes to an end, as we shift the production of high quality TAL proteins into your hands. Our toolkit is not only easy to use and affordable, it is also automatable. The few steps that are necessary to produce TAL proteins with our kit are easily done by a pipetting robot in virtually no time. You can have 96 different TAL effectors on one plate in one run, put all of them into a thermocycler and use them directly afterwards.<br />
<br><br><br />
<html><br />
<div style="center"><br />
<iframe width="560" height="315" style="margin-left:80px; margin-top:20px ;margin-bottom:0;"<br />
src="http://www.youtube.com/embed/ethFqvq1g3U?feature=player_detailpage" <br />
frameborder="0" allowfullscreen></iframe><br />
<div style="text-align:center;margin-top:0;">Automated TAL production with a pippeting robot</div><br />
</div><br />
</html><br><br><br />
= Inventing new classes of TALEs =<br />
----<br />
<br><div align="justify">For the past three years, only two types of TAL effectors were known: TAL transcription factors and TALENs. We believe that many more effectors can be fused to the TAL protein. We therefore created a platform for future iGEM students that allows them to easily produce their own new classes of TAL effectors. We are actually still working on two of them: We have fused the catalytic domain of Suv 39 H1 to the c-terminus of our TAL scaffold to set histone marks in a sequence specific manner. Unfortunately, optimizing a chip assay (which, in combination with qPCR is our readout for this effector) takes much longer than expected, but we hope, that we will one day be able to open the field of epigenetics to synthetic biology. Another interesting project we have started working on are TAL effector recombinases. These are n-terminal fusion proteins of TALEs and serine recombinases. Interestingly, in serine recombinases, the DNA binding domain is spatially distinct from the catalytic domain. We therefore wanted to replace the natural DNA binding domain by the TAL scaffold to obtain an universal recombinase.<br />
Very recently, Mercer et al. published exactly the project we have been working on. Although their publication is only the starting point of this class of TAL Effector Recombinases (TALERs) this technology could be another TAL-based revolution in synthetic biology in the next few years.<br />
We believe that the potential for new types of TAL effectors is huge and we are looking forward to seeing new such technologies arise from future iGEM competitions.<br />
<br />
= References =<br />
----<br />
1. Mercer, A. C., Gaj, T., Fuller, R. P. & Barbas, C. F. Chimeric TALE recombinases with programmable DNA sequence specificity. Nucl. Acids Res. (2012).doi:10.1093/nar/gks875<br />
<br />
<br><br><br><br><br>[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/RobotTeam:Freiburg/Project/Robot2012-10-27T00:50:13Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
<br />
= Automating TAL production =<br />
----<br />
<br><div align="justify">Because of the simplicity of our toolkit, it is easily possible to automate TAL production. This will help to meet the high demand for TAL effectors and, at the same time, will further reduce costs of TAL production.<br />
<br />
<br />
== How it is today ==<br />
<br />
<br />
Ordering TAL effectors today can be a tough decision for a scientist. Not only is it complicated but also unbelievably expensive and time consuming. We checked some of the commercially available TAL products and found prices up to 5000 Euros for production of just one custom TAL nuclease pair. For support, it was necessary to pay another 1000 Euros and you had to wait for several weeks until your TAL was finished and shipped.<br />
<br />
<br />
== How it will be tomorrow ==<br />
<br />
<br />
The market for TAL effectors, especially TAL nucleases, is dominated by only a few companies. These companies are setting prices for TAL effectors and make a living selling overpriced products to scientist all over the world. <br><br>With our toolkit, this practice hopefully comes to an end, as we shift the production of high quality TAL proteins into your hands. Our toolkit is not only easy to use and affordable, it is also automatable. The few steps that are necessary to produce TAL proteins with our kit are easily done by a pipetting robot in virtually no time. You can have 96 different TAL effectors on one plate in one run, put all of them into a thermocycler and use them directly afterwards.<br />
<br><br><br />
<html><br />
<div style="center"><br />
<iframe width="560" height="315" style="margin-left:80px; margin-top:20px ;margin-bottom:0;"<br />
src="http://www.youtube.com/embed/ethFqvq1g3U?feature=player_detailpage" <br />
frameborder="0" allowfullscreen></iframe><br />
<div style="text-align:center;margin-top:0;">Automated TAL production with a pippeting robot</div><br />
</div><br />
</html><br><br><br />
= Inventing new classes of TALEs =<br />
----<br />
<br><div align="justify">For the past three years, only two types of TAL effectors were known: TAL transcription factors and TALENs. We believe that many more effectors can be fused to the TAL protein. We therefore created a platform for future iGEM students that allows them to easily produce their own new classes of TAL effectors. We are actually still working on two of them: We have fused the catalytic domain of Suv 39 H1 to the c-terminus of our TAL scaffold to set histone marks in a sequence specific manner. Unfortunately, optimizing a chip assay (which, in combination with qPCR is our readout for this effector) takes much longer than expected, but we hope, that we will one day be able to open the field of epigenetics to synthetic biology. Another interesting project we have started working on are TAL effector recombinases. These are n-terminal fusion proteins of TALEs and serine recombinases. Interestingly, in serine recombinases, the DNA binding domain is spatially distinct from the catalytic domain. We therefore wanted to replace the natural DNA binding domain by the TAL scaffold to obtain an universal recombinase.<br />
Very recently, Mercer et al. published exactly the project we have been working on. Although their publication is only the starting point of this class of TAL Effector Recombinases (TALERs) this technology could be another TAL-based revolution in synthetic biology in the next few years.<br />
We believe that the potential for new types of TAL effectors is huge and we are looking forward to seeing new such technologies arise from future iGEM competitions.<br />
<br />
= References =<br />
----<br />
<br />
<br><br><br><br><br>[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/TalTeam:Freiburg/Project/Tal2012-10-27T00:31:23Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Using the Toolkit =<br />
----<br />
<br><br />
<div align="justify">Here, we give you a manual on how to use our toolkit to design TAL proteins. We recommend reading through all of the manual prior to using the toolkit. Moreover, we included a short introductional video on how to use the toolkit.<br />
<br />
<html><br />
<br />
<br><br><br />
<iframe style="margin-left:200px; align:center;" src="http://player.vimeo.com/video/52254697" width="400" height="300" align="middle" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe><br />
<br><br><br><br><br />
</html><br />
= Step 1. Choosing effector and target sequence =<br />
----<br />
<br>First, you need to think about your experimental setup. When working with TAL proteins it's pretty clear you want to target a DNA sequence. To choose your sequence, you need to know some of the operational details of TAL proteins in order to pick it the right way. <br />
<br />
<br />
<b>1. Every TAL binding site starts and ends with a thymine</b><br />
<br />
These thymine binding modules are already inserted in our expression plasmids. So the protein won't bind to other sequences than those which start with a T and end with a T.<br />
<br />
<br />
<b>2. Your sequence must be twelve base pair long</b><br />
<br />
Our toolbox is optimized for sequences of twelve plus two (the thymine at upstream and downstream positions). This lenght guarantees a high specifity and a library size that's good to handle at the same time.<br />
<br />
<br />
You can check out the following online softwares for perfect TAL-TF or TALEN binding sites:<br><br><br />
https://boglab.plp.iastate.edu/node/add/talen (for TALENs)<br><br />
https://boglab.plp.iastate.edu/node/add/single-tale (for TAL-TFs)<br />
<br />
<br><br />
<br />
<br><br />
<br />
= Step 2. Building a TAL =<br />
----<br />
<br>Building your TAL starts with your selected sequence. In this manual, we use a fictive sequence that you can substitute with your own. <p>Our sequence will be as follows:</p><br />
<br />
<br />
[[Image:sequence1.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Because the two thymines are already in the cloning vector, they are of no interest for our TAL protein:<br />
<br />
[[Image:sequence2.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br>To build this sequence from our toolkit we need to split it up in pairs of two:<br />
<br />
<br />
[[Image:sequence3.png|350px|center|no frame|link=]]<br />
<br />
<br>Now, we need to give our pairs position numbers inside the TAL protein:<br />
<br />
<br />
[[Image:sequence4.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Next, we can start taking the parts out of the toolkit. A short look at the toolkit shows you that for every possible pair of bases, for example AA, we have 6 places. Every place stands for one of the six possible positions of the pair AA inside the TAL protein.<br />
<br />
<br />
[[Image:toolkit3.png|300px|center|no frame|link=]]<br />
<br />
<br />
<br>All you have to do now is pick the six direpeats consistent with the six pairs of your sequence. In our case, we would take the the first one of AA because the first pair of bases in our sequence is AA. Then we take the second one of TG the third of AG and so forth. The idea behind this is that every direpeat knows through his downstream and upstream part at which position of the final TAL protein it ought to be. You can find the exact mechanisms behind this in the [[Team:Freiburg/Project/Overview|'GATE Assembly Kit']] part of our project section. <br><br><br />
<br />
[[Image:sequence5.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
For lazy iGEM students, we have written a simple program. So you just have to type in your target DNA sequence and we give you a list of parts that you need to pipet into your Golden Gate reaction mix:<br><br><br />
<br />
<br />
<html><br />
<div align="center"><br />
<iframe src="http://omnibus.uni-freiburg.de/~lb125/index.html"; width=80%; frameborder="0"; scrolling="no"><br />
</iframe><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br><br />
<br />
= Step 3. Adding a Function =<br />
----<br />
<br><br />
Now that you have your TAL BioBricks, you are almost done. But targeting a sequence without doing anything is not really helpful, so you need a fusion protein that does something to your DNA. There are a couple of things you could do with your target sequence, and normally you have thought of this before you chose your sequence. With our toolkit you get a transcription factor (to turn on or enhance the trancription of a gene), a restriction enzyme (to make cuts wherever you want) and a desaminase (to make site-specific mutations). Every one of these factors is already placed inside the final TAL vector and designed to fit the 3'-end of your TAL BioBricks. Conveniently, you just choose one and put it in your reaction tube along with the other BioBricks.<br />
<br />
<br />
<br />
[[Image:TALfunction.png|600px|center|no frame|link=]]<br />
<br />
<br />
<br />
With the six TAL BioBricks and the fusion enzyme in your reaction tube you now only need the type two restriction enzyme BsmB1 and a T7 Ligase to put all the parts together.<br><br><br />
<br />
[[Image:protocolggc.png|300px|left|no frame|link=]]<br />
<br />
<br><br />
<br />
[[Image:thermocycler.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
= Step 4. Transformation and Use =<br />
----<br />
<br><br />
Transform 5 μl of the GATE assembly product into 50 μl of transformation competent bacteria.<br> <br />
<br>'''Important note:''' Your cells need to be sensitive to the ccdB kill cassette in our TAL expression vectors! Otherwise also bacteria that have taken up plasmids without the six direpeats will form false positive colonies. We used the DH10B E.coli strain.<br><br />
In case you want to express your TALE in bacteria, you need to induce the promoter of our prokaryotic expression plasmid with IPTG. <br>For use in a eukaryotic system, such as HEK 239 cells, perform a midiprep and directly transfect the eukaryotic TAL expression plasmid (or its derivatives pTAL-TF, pTALEN etc.) according to your transfection protocol. <br />
<!--- The Mission, Experiments ---><br />
<br><br><br><br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/TalTeam:Freiburg/Project/Tal2012-10-27T00:27:35Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Using the Toolkit =<br />
----<br />
<br><br />
<div align="justify">Here, we give you a manual on how to use our toolkit to design TAL proteins. We recommend reading through all of the manual prior to using the toolkit. Moreover, we included a short introductional video on how to use the toolkit.<br />
<br />
<html><br />
<br />
<br><br><br />
<iframe style="margin-left:200px; align:center;" src="http://player.vimeo.com/video/52254697" width="400" height="300" align="middle" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe><br />
<br><br><br><br><br />
</html><br />
= Step 1. Choosing effector and target sequence =<br />
----<br />
<br>First, you need to think about your experimental setup. When working with TAL proteins it's pretty clear you want to target a DNA sequence. To choose your sequence, you need to know some of the operational details of TAL proteins in order to pick it the right way. <br />
<br />
<br />
<b>1. Every TAL binding site starts and ends with a thymine</b><br />
<br />
These thymine binding modules are already inserted in our expression plasmids. So the protein won't bind to other sequences than those which start with a T and end with a T.<br />
<br />
<br />
<b>2. Your sequence must be twelve base pair long</b><br />
<br />
Our toolbox is optimized for sequences of twelve plus two (the thymine at upstream and downstream positions). This lenght guarantees a high specifity and a library size that's good to handle at the same time.<br />
<br />
<br />
You can check out the following online softwares for perfect TAL-TF or TALEN binding sites:<br><br><br />
https://boglab.plp.iastate.edu/node/add/talen (for TALENs)<br><br />
https://boglab.plp.iastate.edu/node/add/single-tale (for TAL-TFs)<br />
<br />
<br><br />
<br />
<br><br />
<br />
= Step 2. Building a TAL =<br />
----<br />
<br>Building your TAL starts with your selected sequence. In this manual, we use a fictive sequence that you can substitute with your own. <p>Our sequence will be as follows:</p><br />
<br />
<br />
[[Image:sequence1.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Because the two thymines are already in the cloning vector, they are of no interest for our TAL protein:<br />
<br />
[[Image:sequence2.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br>To build this sequence from our toolkit we need to split it up in pairs of two:<br />
<br />
<br />
[[Image:sequence3.png|350px|center|no frame|link=]]<br />
<br />
<br>Now, we need to give our pairs position numbers inside the TAL protein:<br />
<br />
<br />
[[Image:sequence4.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Next, we can start taking the parts out of the toolkit. A short look at the toolkit shows you that for every possible pair of bases, for example AA, we have 6 places. Every place stands for one of the six possible positions of the pair AA inside the TAL protein.<br />
<br />
<br />
[[Image:toolkit3.png|300px|center|no frame|link=]]<br />
<br />
<br />
<br>All you have to do now is pick the six direpeats consistent with the six pairs of your sequence. In our case, we would take the the first one of AA because the first pair of bases in our sequence is AA. Then we take the second one of TG the third of AG and so forth. The idea behind this is that every direpeat knows through his downstream and upstream part at which position of the final TAL protein it ought to be. You can find the exact mechanisms behind this in the [[Team:Freiburg/Project/Overview|'GATE Assembly Kit']] part of our project section. <br><br><br />
<br />
[[Image:sequence5.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
For lazy iGEM students, we have written a simple program. So you just have to type in your target DNA sequence and we give you a list of parts that you need to pipet into your Golden Gate reaction mix:<br><br><br />
<br />
<br />
<html><br />
<div align="center"><br />
<iframe src="http://omnibus.uni-freiburg.de/~lb125/index.html"; width=80%; frameborder="0"; scrolling="no"><br />
</iframe><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br><br />
<br />
= Step 3. Adding a Function =<br />
----<br />
<br><br />
Now that you have your TAL BioBricks, you are almost done. But targeting a sequence without doing anything is not really helpful, so you need a fusion protein that does something to your DNA. There are a couple of things you could do with your target sequence, and normally you have thought of this before you chose your sequence. With our toolkit you get a transcription factor to turn on or enhance the trancription of a gene and a restriction enzyme to make cuts wherever you want. Every one of these factors is already placed inside the final TAL vector and designed to fit the 3'-end of your TAL BioBricks. Conveniently, you just choose one and put it in your reaction tube along with the other BioBricks.<br />
<br />
<br />
<br />
[[Image:TALfunction.png|600px|center|no frame|link=]]<br />
<br />
<br />
<br />
With the six TAL BioBricks and the fusion enzyme in your reaction tube you now only need the type two restriction enzyme BsmB1 and a T7 Ligase to put all the parts together.<br><br><br />
<br />
[[Image:protocolggc.png|300px|left|no frame|link=]]<br />
<br />
<br><br />
<br />
[[Image:thermocycler.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
= Step 4. Transformation and Use =<br />
----<br />
<br><br />
Transform 5 μl of the GATE assembly product into 50 μl of transformation competent bacteria.<br> <br />
<br>'''Important note:''' Your cells need to be sensitive to the ccdB kill cassette in our TAL expression vectors! Otherwise also bacteria that have taken up plasmids without the six direpeats will form false positive colonies. We used the DH10B E.coli strain.<br><br />
In case you want to express your TALE in bacteria, you need to induce the promoter of our prokaryotic expression plasmid with IPTG. <br>For use in a eukaryotic system, such as HEK 239 cells, perform a midiprep and directly transfect the eukaryotic TAL expression plasmid (or its derivatives pTAL-TF, pTALEN etc.) according to your transfection protocol. <br />
<!--- The Mission, Experiments ---><br />
<br><br><br><br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/OverviewTeam:Freiburg/Project/Overview2012-10-27T00:25:41Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= The GATE Assembly Kit =<br />
----<br />
<br><br />
<div align="justify">TALEs make sequence-specific genome modification much easier than before and therefore attract great interest in the synbio community and beyond. Interestingly, many of the researchers who hold the patents on TALEs also released open source toolkits for TALE assembly for academic research. However, most strategies of TALE gene assembly published thus far rely on a hierarchical procedure, that is very time consuming, laborious and not automatable.<br />
Therefore, we herein describe the Golden Gate cloning-based TAL Effector (GATE) Assembly platform, which enables literally everyone to produce low-cost, tailored TALEs within a few minutes of labwork and basic lab equipment. Moreover, we have automated this strategy and produced different TAL Effector Transcription Factors with 97 % success rate faster than any other method published before.<br />
<br><br />
<br />
<br />
== Review of existing TALE construction methods ==<br />
<br><br />
<div align="justify"><br />
Although TALE assembly is considerably easier than e.g. screening for novel zinc fingers, the highly repetitive structure of the TALE gene implies some challenges, because conventional PCR or homologous recombination-based gene assembly strategies cannot be applied.<br />
To our knowledge, the numerous approaches of TAL-Effector gene assembly, published so far, fall under the following three categories:<br />
<br />
<br />
1. Few groups have applied methods called unit assembly<sup>1</sup> or Restriction Enzyme And Ligation (REAL)<sup>2</sup>. In the first step, both strategies perform conventional restriction enzyme digestion in order to assemble two gene fragments of single repeats. The pairs of repeat gene fragments are subsequently assembled to form tetramers, and this highly hierarchical assembly strategy is continued until the desired number of repeats is assembled. These platforms obviously involve multiple laborious and time consuming rounds of digestion, ligation and isolation of the right ligation products. The recently published fast ligation-based automatable solid-phase high-throughput (FLASH) system circumvents major challenges of REAL by attaching the first repeat to streptavidin-coated magnetic beads and, successively, adding further repeats or oligorepeats from a 376-plasmid library. Although Reyon et al.<sup>11</sup> claim that FLASH can also be performed manually, this probably does not represent the most convenient and low-cost protocol for iGEM students.<br />
<br />
<br />
2. We call the second category of TALE production methods the synthesis optimization approach. The major challenge of TAL synthesis is the highly repetitive amino acid sequence of the DNA binding part. Since synthetic genes are typically produced from overlapping synthesized oligos, overlaps of different pairs of overlapping oligos need to be distinct. The synthesis optimization approach employs a sophisticated computer program that optimizes codon usage in order to reduce repetitiveness of the TAL gene and calculates optimal oligos for synthesis<sup>3,4</sup>. Although this approach might be the method of the future, it is currently too expensive for iGEM teams. <br />
<br />
<br />
3. The third category of TALE assembly protocols applies Golden Gate Cloning (GGC)<sup>5,6,7,8,9</sup> (for details on GGC, see the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard page]]). In all GGC-based TALE repeat assembly strategies, level 1 modules (i.e. single repeat gene fragments) are flanked by type IIs restriction sites adjacent to their first or last 4 nucleotides, respectively, that produce sticky ends after digestion with the type IIs restriction enzyme. Since each level 1 module codes for the same amino acid sequence (despite of the RVDs), the codon usage must be changed at these 4 external nucleotides for producing unique sticky ends that assemble in the predefined order after digestion. Consequently, the 4 bp overlaps of a level 1 module specify its future position within the TALE gene.<br />
So, in order to be able to target any sequence of DNA, a method that is using GGC requires N x K modules. N signifies the number of level 1 module positions (i.e. number of modules that the TALE should contain after GGC) and K signifies the number of different repeats that the user should be able to put into each of the N positions (in most kits K equals 4, one repeat for each DNA base, see figure 1).<br />
<br><br><br />
[[File:Conventionaltalconstruction.jpg|600px|center|link=]]<br />
<p align="center">Figure 1: Conventional TAL construction kit <sup>6</sup></p><br />
<br><br />
Unfortunately, using GGC, only up to 10 modules <sup>5</sup> can be assembled with high accuracy. So in the GGC-based protocols, level 1 modules get assembled to form level 2 modules (oligorepeats). These level 2 modules need to be amplified and isolated before a second GGC reaction assembles them to form the complete repeat array. The bottleneck of the GGC-based methods is the need for amplification and isolation of level 2 modules, which costs a lot of time, requires some extra knowledge, additional enzymes and lab equipment (we actually tried one of the GGC-based open source kits, but, even after 2.5 weeks, were not able to assemble the whole TALE).<br><br><br />
<br />
<br />
<br />
== GATE Assembly Kit ==<br />
<br />
<br><br />
<div align="justify">Right from the beginning, we were very much intrigued by the efficiency of Golden Gate Cloning and hypothesized, that instant TAL assembly would be possible if we overcame the need for a second (or even third) round of GGC. Since we were sure we were not able to improve GGC reaction conditions so much that we could actually assemble all repeats at once, we came up with another solution: Why not use direpeats instead of single repeats as level 1 modules? This would cut the number of level 1 modules half and allow us to perform TAL assembly in one single reaction. Unfortunately, our idea would not only cut half N but would also quadruple M, and thus would double the toolkit size.<br />
<br><br />
<br />
[[Image:Synthese_3.png|200px|center|no frame|link=]]<br />
<br />
<br><br />
So we needed to further reduce N down to 6 to obtain a reasonable toolkit size of 96 level 1 modules. We actually liked the idea that our kit would perfectly fit on a 96 well plate.<br />
<br><br><br />
<br />
[[Image:Toolkit.png|700px|center|no frame|link=]]<br />
<br />
<br><br />
Next, we looked into the literature to check, if TALEs that recognize 14 bp (instead of around 18 bp) are actually functional. We were very fortunate to see that efficiency of TAL transcription factors (TAL-TFs)<sup>10 </sup> and TAL effector nucleases (TALENs)<sup>11 </sup> remains constant between for target sequences between 13 and 20 bp. Moreover, Zhang et al. published splendid results with 14 bp-binding TAL-TFs in a human cell line<sup>7</sup>. <br />
Since we wanted our TALEs to function in both bacteria and eukaryotic systems, while published TAL repeats were always designed for one particular organism, we decided to design the direpeat nucleotide sequences from scratch: We used the amino acid sequence of the hex3 gene of Xanthomonas oryzae to find out the amino acid sequences for the 16 direpeats. Next, we reverse-tanslated the sequences into DNA, codon optimized them for E.coli and human cells and reduced homologies between and within gene fragments (only the extention PCR binding sites were the same for every direpeat gene).<br />
After receiving the sequences that were synthesized as G-blocks by IDT, we performed 6 extention PCRs on every sequence to add 4 bp overlaps, BsmBI restriction sites and iGEM prefix and suffix to the parts. The 4 bp overlaps would later determine the position of the respective direpeat in the repeat array of the TALE.<br />
<br><br><br />
<br />
[[Image:Biobrickfreigem.png|500px|center|no frame|link=]]<br />
<br><br><br><br><br />
<br />
[[Image:Extension3.png|600px|center|no frame|link=]]<br />
<br />
<br><br />
One of the advantages of GGC is that you can insert complete plasmids containing the parts you want to assemble. So we decided to clone all 96 parts into the standard iGEM vector pSB1C3. We hypothesized that the BsmBI restriction site in the chloramphenicol gene would decrease GGC efficiency, so we performed a mutagenesis PCR to introduce the silent mutation (G434C) prior to cloning the 96 PCR products into it. When doing so many cloning experiments at a time, error rate needs to be minimal, so at first, we spent weeks optimizing every single step from the G-block to the Golden Gate standard compatible BioBrick (see [[Team:Freiburg/Project/Golden#GGC|protocol section]]). In the end, we are very happy that we have a full GATE assembly kit with [[Team:Freiburg/Parts|96 unique direpeats]] and 100% accurate sequencing results.<br />
Our first attempts to use the GATE assembly kit were actually very discouraging - no colonies were found on the agar plates after transforming the GGC product into DH10B cells for more than one week - at least, we knew that our ccdb kill cassette was working well (details about the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">expression vector</a></html>). After systematically testing all kinds of buffers and reaction additives, the results where quite overwhelming. We were even able to dramatically reduce GGC reaction time down to 2.5 hours - which is probably the fastest way anyone has ever built a custom tal effector.<br />
<br />
<br><br><br />
<br />
== References ==<br />
<br><br />
1. Huang, P. et al. Heritable gene targeting in zebrafish using customized TALENs. ''Nat Biotechnol'' 29, 699–700 (2011).<br><br />
2. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol 2''9, 697–698 (2011).<br><br />
3. Hoover, D. M. & Lubkowski, J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. ''Nucl Acids Res'' 30, e43–e43 (2002).<br><br />
4. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nat Biotechnol'' 29, 143–148 (2010).<br><br />
5. Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. Assembly of Custom TALE-Type DNA Binding Domains by Modular Cloning. ''Nucl Acids Res'' 39, 5790–5799 (2011).<br><br />
6. Weber, E., Gruetzner, R., Werner, S., Engler, C. & Marillonnet, S. Assembly of designer TAL effectors by golden gate cloning. ''PloS one'' 6, e19722 (2011).<br><br />
7. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nat Biotechnol'' 29, 149–153 (2011).<br><br />
8. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucl Acids Res'' 39, e82 (2011).<br><br />
9. Li, T. et al. Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes. ''Nucl Acids Res'' 39, 6315–6325 (2011).<br><br />
10. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br><br />
11. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nat Biotechnol'' 30, 460–465 (2012).<br />
<br />
<br />
<br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<!--- The Mission, Experiments ---></div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/OverviewTeam:Freiburg/Project/Overview2012-10-27T00:24:31Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= The GATE Assembly Kit =<br />
----<br />
<br><br />
<div align="justify">TALEs make sequence-specific genome modification much easier than before and therefore attract great interest in the synbio community and beyond. Interestingly, many of the researchers who hold the patents on TALEs also released open source toolkits for TALE assembly for academic research. However, most strategies of TALE gene assembly published thus far rely on a hierarchical procedure, that is very time consuming, laborious and not automatable.<br />
Therefore, we herein describe the Golden Gate cloning-based TAL Effector (GATE) Assembly platform, which enables literally everyone to produce low-cost, tailored TALEs within a few minutes of labwork and basic lab equipment. Moreover, we have automated this strategy and produced different TAL Effector Transcription Factors with 97 % success rate faster than any other method published before.<br />
<br><br />
<br />
<br />
== Review of existing TALE construction methods ==<br />
<br><br />
<div align="justify"><br />
Although TALE assembly is considerably easier than e.g. screening for novel zinc fingers, the highly repetitive structure of the TALE gene implies some challenges, because conventional PCR or homologous recombination-based gene assembly strategies cannot be applied.<br />
To our knowledge, the numerous approaches of TAL-Effector gene assembly, published so far, fall under the following three categories:<br />
<br />
<br />
1. Few groups have applied methods called unit assembly<sup>1</sup> or Restriction Enzyme And Ligation (REAL)<sup>2</sup>. In the first step, both strategies perform conventional restriction enzyme digestion in order to assemble two gene fragments of single repeats. The pairs of repeat gene fragments are subsequently assembled to form tetramers, and this highly hierarchical assembly strategy is continued until the desired number of repeats is assembled. These platforms obviously involve multiple laborious and time consuming rounds of digestion, ligation and isolation of the right ligation products. The recently published fast ligation-based automatable solid-phase high-throughput (FLASH) system circumvents major challenges of REAL by attaching the first repeat to streptavidin-coated magnetic beads and, successively, adding further repeats or oligorepeats from a 376-plasmid library. Although Reyon et al.<sup>11</sup> claim that FLASH can also be performed manually, this probably does not represent the most convenient and low-cost protocol for iGEM students.<br />
<br />
<br />
2. We call the second category of TALE production methods the synthesis optimization approach. The major challenge of TAL synthesis is the highly repetitive amino acid sequence of the DNA binding part. Since synthetic genes are typically produced from overlapping synthesized oligos, overlaps of different pairs of overlapping oligos need to be distinct. The synthesis optimization approach employs a sophisticated computer program that optimizes codon usage in order to reduce repetitiveness of the TAL gene and calculates optimal oligos for synthesis<sup>3,4</sup>. Although this approach might be the method of the future, it is currently too expensive for iGEM teams. <br />
<br />
<br />
3. The third category of TALE assembly protocols applies Golden Gate Cloning (GGC)<sup>5,6,7,8,9</sup> (for details on GGC, see the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard page]]). In all GGC-based TALE repeat assembly strategies, level 1 modules (i.e. single repeat gene fragments) are flanked by type IIs restriction sites adjacent to their first or last 4 nucleotides, respectively, that produce sticky ends after digestion with the type IIs restriction enzyme. Since each level 1 module codes for the same amino acid sequence (despite of the RVDs), the codon usage must be changed at these 4 external nucleotides for producing unique sticky ends that assemble in the predefined order after digestion. Consequently, the 4 bp overlaps of a level 1 module specify its future position within the TALE gene.<br />
So, in order to be able to target any sequence of DNA, a method that is using GGC requires N x K modules. N signifies the number of level 1 module positions (i.e. number of modules that the TALE should contain after GGC) and K signifies the number of different repeats that the user should be able to put into each of the N positions (in most kits K equals 4, one repeat for each DNA base, see figure 1).<br />
<br><br><br />
[[File:Conventionaltalconstruction kit<sup>6</sup>.jpg|600px|center|link=]]<br />
<p align="center">Figure 1: Conventional TAL construction</p><br />
<br><br />
Unfortunately, using GGC, only up to 10 modules <sup>5</sup> can be assembled with high accuracy. So in the GGC-based protocols, level 1 modules get assembled to form level 2 modules (oligorepeats). These level 2 modules need to be amplified and isolated before a second GGC reaction assembles them to form the complete repeat array. The bottleneck of the GGC-based methods is the need for amplification and isolation of level 2 modules, which costs a lot of time, requires some extra knowledge, additional enzymes and lab equipment (we actually tried one of the GGC-based open source kits, but, even after 2.5 weeks, were not able to assemble the whole TALE).<br><br><br />
<br />
<br />
<br />
== GATE Assembly Kit ==<br />
<br />
<br><br />
<div align="justify">Right from the beginning, we were very much intrigued by the efficiency of Golden Gate Cloning and hypothesized, that instant TAL assembly would be possible if we overcame the need for a second (or even third) round of GGC. Since we were sure we were not able to improve GGC reaction conditions so much that we could actually assemble all repeats at once, we came up with another solution: Why not use direpeats instead of single repeats as level 1 modules? This would cut the number of level 1 modules half and allow us to perform TAL assembly in one single reaction. Unfortunately, our idea would not only cut half N but would also quadruple M, and thus would double the toolkit size.<br />
<br><br />
<br />
[[Image:Synthese_3.png|200px|center|no frame|link=]]<br />
<br />
<br><br />
So we needed to further reduce N down to 6 to obtain a reasonable toolkit size of 96 level 1 modules. We actually liked the idea that our kit would perfectly fit on a 96 well plate.<br />
<br><br><br />
<br />
[[Image:Toolkit.png|700px|center|no frame|link=]]<br />
<br />
<br><br />
Next, we looked into the literature to check, if TALEs that recognize 14 bp (instead of around 18 bp) are actually functional. We were very fortunate to see that efficiency of TAL transcription factors (TAL-TFs)<sup>10 </sup> and TAL effector nucleases (TALENs)<sup>11 </sup> remains constant between for target sequences between 13 and 20 bp. Moreover, Zhang et al. published splendid results with 14 bp-binding TAL-TFs in a human cell line<sup>7</sup>. <br />
Since we wanted our TALEs to function in both bacteria and eukaryotic systems, while published TAL repeats were always designed for one particular organism, we decided to design the direpeat nucleotide sequences from scratch: We used the amino acid sequence of the hex3 gene of Xanthomonas oryzae to find out the amino acid sequences for the 16 direpeats. Next, we reverse-tanslated the sequences into DNA, codon optimized them for E.coli and human cells and reduced homologies between and within gene fragments (only the extention PCR binding sites were the same for every direpeat gene).<br />
After receiving the sequences that were synthesized as G-blocks by IDT, we performed 6 extention PCRs on every sequence to add 4 bp overlaps, BsmBI restriction sites and iGEM prefix and suffix to the parts. The 4 bp overlaps would later determine the position of the respective direpeat in the repeat array of the TALE.<br />
<br><br><br />
<br />
[[Image:Biobrickfreigem.png|500px|center|no frame|link=]]<br />
<br><br><br><br><br />
<br />
[[Image:Extension3.png|600px|center|no frame|link=]]<br />
<br />
<br><br />
One of the advantages of GGC is that you can insert complete plasmids containing the parts you want to assemble. So we decided to clone all 96 parts into the standard iGEM vector pSB1C3. We hypothesized that the BsmBI restriction site in the chloramphenicol gene would decrease GGC efficiency, so we performed a mutagenesis PCR to introduce the silent mutation (G434C) prior to cloning the 96 PCR products into it. When doing so many cloning experiments at a time, error rate needs to be minimal, so at first, we spent weeks optimizing every single step from the G-block to the Golden Gate standard compatible BioBrick (see [[Team:Freiburg/Project/Golden#GGC|protocol section]]). In the end, we are very happy that we have a full GATE assembly kit with [[Team:Freiburg/Parts|96 unique direpeats]] and 100% accurate sequencing results.<br />
Our first attempts to use the GATE assembly kit were actually very discouraging - no colonies were found on the agar plates after transforming the GGC product into DH10B cells for more than one week - at least, we knew that our ccdb kill cassette was working well (details about the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">expression vector</a></html>). After systematically testing all kinds of buffers and reaction additives, the results where quite overwhelming. We were even able to dramatically reduce GGC reaction time down to 2.5 hours - which is probably the fastest way anyone has ever built a custom tal effector.<br />
<br />
<br><br><br />
<br />
== References ==<br />
<br><br />
1. Huang, P. et al. Heritable gene targeting in zebrafish using customized TALENs. ''Nat Biotechnol'' 29, 699–700 (2011).<br><br />
2. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol 2''9, 697–698 (2011).<br><br />
3. Hoover, D. M. & Lubkowski, J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. ''Nucl Acids Res'' 30, e43–e43 (2002).<br><br />
4. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nat Biotechnol'' 29, 143–148 (2010).<br><br />
5. Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. Assembly of Custom TALE-Type DNA Binding Domains by Modular Cloning. ''Nucl Acids Res'' 39, 5790–5799 (2011).<br><br />
6. Weber, E., Gruetzner, R., Werner, S., Engler, C. & Marillonnet, S. Assembly of designer TAL effectors by golden gate cloning. ''PloS one'' 6, e19722 (2011).<br><br />
7. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nat Biotechnol'' 29, 149–153 (2011).<br><br />
8. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucl Acids Res'' 39, e82 (2011).<br><br />
9. Li, T. et al. Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes. ''Nucl Acids Res'' 39, 6315–6325 (2011).<br><br />
10. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br><br />
11. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nat Biotechnol'' 30, 460–465 (2012).<br />
<br />
<br />
<br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<!--- The Mission, Experiments ---></div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/TalTeam:Freiburg/Project/Tal2012-10-27T00:19:08Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Using the Toolkit =<br />
----<br />
<br><br />
<div align="justify">Here, we give you a manual on how to use our toolkit to design TAL proteins. We recommend reading through all of the manual prior to using the toolkit. Moreover, we included a short introductional video on how to use the toolkit.<br />
<br />
<html><br />
<br />
<br><br><br />
<iframe style="margin-left:200px; align:center;" src="http://player.vimeo.com/video/52254697" width="400" height="300" align="middle" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe><br />
<br><br><br><br><br />
</html><br />
= Step 1. Choosing effector and target sequence =<br />
----<br />
<br>First, you need to think about your experimental setup. When working with TAL proteins it's pretty clear you want to target a DNA sequence. To choose your sequence, you need to know some of the operational details of TAL proteins in order to pick it the right way. <br />
<br />
<br />
<b>1. Every TAL binding site starts and ends with a thymine</b><br />
<br />
These thymine binding modules are already inserted in our expression plasmids. So the protein won't bind to other sequences than those which start with a T and end with a T.<br />
<br />
<br />
<b>2. Your sequence must be twelve base pair long</b><br />
<br />
Our toolbox is optimized for sequences of twelve plus two (the thymine at upstream and downstream positions). This lenght guarantees a high specifity and a library size that's good to handle at the same time.<br />
<br />
<br />
You can check out the following online softwares for perfect TAL-TF or TALEN binding sites:<br><br><br />
https://boglab.plp.iastate.edu/node/add/talen (for TALENs)<br><br />
https://boglab.plp.iastate.edu/node/add/single-tale (for TAL-TFs)<br />
<br />
<br><br />
<br />
<br><br />
<br />
= Step 2. Building a TAL =<br />
----<br />
<br>Building your TAL starts with your selected sequence. In this manual, we use a fictive sequence that you can substitute with your own. <p>Our sequence will be as follows:</p><br />
<br />
<br />
[[Image:sequence1.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Because the two thymines are already in the cloning vector, they are of no interest for our TAL protein:<br />
<br />
[[Image:sequence2.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br>To build this sequence from our toolkit we need to split it up in pairs of two:<br />
<br />
<br />
[[Image:sequence3.png|350px|center|no frame|link=]]<br />
<br />
<br>Now we need to give our pairs position numbers inside the TAL protein:<br />
<br />
<br />
[[Image:sequence4.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Now we can start taking the parts out of the toolkit. A short look at the toolkit shows you that for every possible pair of bases, for example AA, we have 6 places. Every place stands for one of the six possible positions of the pair AA inside the TAL protein.<br />
<br />
<br />
[[Image:toolkit3.png|300px|center|no frame|link=]]<br />
<br />
<br />
<br>All you have to do now is pick the six direpeats consistent with the six pairs of your sequence. In our case, we would take the the first one of AA because the first pair of bases in our sequence is AA. Then we take the second one of TG the third of AG and so forth. The idea behind this is that every direpeat knows through his downstream and upstream part at which position of the final TAL protein it ought to be. You can find the exact mechanisms behind this in the [[Team:Freiburg/Project/Overview|'GATE Assembly Kit']] part of our project section. <br><br><br />
<br />
[[Image:sequence5.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
For lazy iGEM students, we have written a simple program. So you just have to type in your target DNA sequence and we give you a list of parts that you need to pipet into your Golden Gate reaction mix:<br><br><br />
<br />
<br />
<html><br />
<div align="center"><br />
<iframe src="http://omnibus.uni-freiburg.de/~lb125/index.html"; width=80%; frameborder="0"; scrolling="no"><br />
</iframe><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br><br />
<br />
= Step 3. Adding a Function =<br />
----<br />
<br><br />
Now that you have your TAL BioBricks, you are almost done. But targeting a sequence without doing anything is not really helpful, so you need a fusion protein that does something to your DNA. There are a couple of things you could do with your target sequence, and normally you have thought of this before you chose your sequence. With our toolkit you get a transcription factor to turn on or enhance the trancription of a gene and a restriction enzyme to make cuts wherever you want. Every one of these factors is already placed inside the final TAL vector and designed to fit the 3'-end of your TAL BioBricks. Conveniently, you just choose one and put it in your reaction tube along with the other BioBricks.<br />
<br />
<br />
<br />
[[Image:TALfunction.png|600px|center|no frame|link=]]<br />
<br />
<br />
<br />
With the six TAL BioBricks and the fusion enzyme in your reaction tube you now only need the type two restriction enzyme BsmB1 and a T7 Ligase to put all the parts together.<br><br><br />
<br />
[[Image:protocolggc.png|300px|left|no frame|link=]]<br />
<br />
<br><br />
<br />
[[Image:thermocycler.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
= Step 4. Transformation and Use =<br />
----<br />
<br><br />
Transform 5 μl of the GATE assembly product into 50 μl of transformation competent bacteria.<br> <br />
<br>'''Important note:''' Your cells need to be sensitive to the ccdB kill cassette in our TAL expression vectors! Otherwise also bacteria that have taken up plasmids without the six direpeats will form false positive colonies. We used the DH10B E.coli strain.<br><br />
In case you want to express your TALE in bacteria, you need to induce the promoter of our prokaryotic expression plasmid with IPTG. <br>For use in a eukaryotic system, such as HEK 239 cells, perform a midiprep and directly transfect the eukaryotic TAL expression plasmid (or its derivatives pTAL-TF, pTALEN etc.) according to your transfection protocol. <br />
<!--- The Mission, Experiments ---><br />
<br><br><br><br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/VektorTeam:Freiburg/Project/Vektor2012-10-27T00:17:32Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Creating the TAL Mammobrick vector =<br />
----<br />
<br />
<br />
<br />
== Introduction: ==<br />
<html><br />
<div align="justify">In nature, TALEs are injected into the host cells by plant pathogenic bacteria in order to modulate their gene expression. From the synthetic biologist’s point of view, this is very convenient because it implies that TALEs can be expressed in bacteria but also function in a eukaryotic system. We therefore provide plasmids for expression in either human cell lines or in bacteria.<br><br></html><br />
<br />
== Eukaryotic expression vector: ==<br />
<br />
<div align="justify">Since we wanted to express our TAL effectors in Human Embryonic Kidney (HEK) cells, we needed a eukaryotic expression vector. Unfortunately, the registry does not offer such a vector, so we decided to build one our own. In order to avoid intellectual property rights violations, we ordered the vector pTALEN (v2) NG (along with the Zhang Lab TALE Toolbox) from the open source plasmid repository [http://www.addgene.org/ Addgene]. The Zhang Lab at MIT has constructed this plasmid for TAL effector expression, so we decided that it would be a good template for our own vector. Converting pTALEN (v2) NG into a RFC10 compatible vector would have taken more mutagenesis PCRs than we would have been able to perform over the summer, so we chose the following two-step vector assembly strategy:</div><br><br><br />
<b>Step 1: Mammobrick</b><br />
<br><br><br />
In the first step, we wanted to built a universal mammalian expression vector (called MammoBrick), which would allows future iGEM students to express any gene in human cell lines simply by cloning the open reading frame into the MammoBrick using the BioBrick assembly protocol. We assembled the MammoBrick from the following four parts, essentially, using the protocol described [[Team:Freiburg/Project/Golden#GGC|here]]:<br><br><br />
:Part 1: '''BACKBONE''' <br>We have cut the backbone out of pTALEN (v2) NG with Ngo MIV and AfiII and purified the corresponding 2234bp band from a gel. Since both enzymes produce 5’ overhangs, they were compatible with overhangs produced by BsaI digestion. This backbone contains a SV 40 polyadenylation signal, an ampicillin resistance gene and an origin of replication.<br><br><br />
:Part2: '''CMV promoter'''<br>At first, we tried to use the CMV promotor that was included in the 2012 distribution kit. Part BBa_J52034 was submitted to the registry by Team Slovenia in 2006 and has been on the distribution kit since then (although sequencing was inconsistent every year). After numerous attempts to use this part, we sequenced it and found out that it was not a CMV promotor, but a part of the lacI gene. Reading the part’s review, we noticed that Team Munich 2010 had already pointed out that it was a lacI fragment. Interestingly, Team DTU Denmark was able to induce fluorescent protein expression with this bacterial gene fragment- magic. Since no other mammalian promoter was available on this year’s distribution kit, we designed the following primers and amplified the CMV promoter from the vector pPhi-Yellow-C:<br><br><br />
::::GTTACCGGTCTCGTTAAGAATTCGCGGCCGCTTCTAGAGATAGTAATCAATTACGGGGTC<br><br />
::::CTAGAGGTCTCGCTGCCTGCAGCGGCCGCTACTAGTAGATCTGACGGTTCACTAAAC<br><br><br />
:After amplifying the CMV promoter with these primers, the promoter is not only flanked by the iGEM prefix and suffix, but also by distal BsaI restriction sites. This way, we were able to directly assemble the PCR product with the other MammoBrick parts.<br><br><br />
:Part 3: '''PuroORF''' <br>We replaced the hygromycin resistance gene in pTALEN (v2) NG for two reasons: Firstly, it contained multiple iGEM restriction sites and secondly, selection via hygromycin takes much longer than selection with puromycin. Since we also didn’t find a puromycin ORF without illegal restriction sites, we decided to make silent mutations in the PuroORF to remove these sites and get it synthesized, flanked by BsaI restriction sites and appropriate overlaps for subsequent Golden Gate cloning.<br><br><br />
:Part 4: '''PostORF''' <br>We called the region between the stop codon of the TAL ORF and the start codon of the antibiotic resistance gene PostORF. We wanted to use this part in our vector because it contains the SV40 promoter and enhancer for expression of the antibiotic selection marker. So we used PCR to “excise the fragment and add BsaI sites and appropriate overlaps to it.<br><br><br />
:After every single part had been purified, we used Golden Gate cloning to assemble them in one step. After quite some testing, we came up with the following protocol:<br />
<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>pTALEN (v2) NG backbone (56 ng)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>CMV promoter (17 ng)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Post ORF (17,5 ng)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;11,5</td> <br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>BsaI (15 U)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>T4 Ligase buffer</td><td>&#160;2</td><br />
</tr><tr><br />
<td>Total</td><td>&#160;20</td> <br />
</tr></table></html><br />
<br />
<br />
<html><br />
<table align=right border=0 style="margin-right:150px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20 °C, 5 min</td><br />
</tr><tr><br />
<td>go to 1. 50 times</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
<br />
:So we assembled the whole MammoBrick vector in one single reaction:<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:150px"/></html><br />
<br />
<br><br><br />
<b>Step 2: Eukaryotic TALE expression vector:</b><br><br><br />
<br />
Once the MammoBrick was ready, we inserted the TAL open reading frame and thereby evaluated, how easy it would be for future iGEM students to expression any desired ORF in eukaryotic cells.<br><br><br />
<br />
:'''Designing the TAL open reading frame:'''<br><br />
:For this purpose, we designed a TAL ORF by adding the following modifications to the TAL open reading frame in pTALEN (v2) NG:<br><br><br />
:1. We removed all EcoRI, XbaI, SpeI, PstI, BsmBI, BbsI and PmeI restriction sites.<br><br />
:2. We replaced the BsaI restriction sites for inserting direpeats by BsmBI sites, because – according to the manufacturer - BsmBI is better suited for digest over one hour.<br><br />
:3. We added a consensus RBS in front of the ORF for expression in bacteria<br><br />
:4. We added a His-Tag to the n-terminal end to allow protein purification.<br><br />
:5. We flanked the whole sequence with the iGEM prefix and suffix.<br><br />
:6. Most importantly, we replaced the FokI nuclease at the C-terminal end of the protein by one of our inventions: The Plug and Play Effector Cassette.<br />
:This whole construct was synthesized by Genscript.<br><br><br />
:'''Plug and Play Effecor Cassette:''' Our project was designed to enable future iGEM teams to easily use the powerful TALE technology. On top of that, we wanted to built a TALE platform which allows iGEM students to develop their own TAL constructs. We therefore invented the easy-to-use '''P'''lug and '''P'''lay '''E'''ffector '''C'''assette ('''PPEC'''), which can be used to fuse BioBricks, that are in the [[Team:Freiburg/Project/Golden|Golden Gate standard]], to the c-terminus of the TAL protein. <br><br />
[[File:Figure7_2.png|center|500px|link=]]<br><br />
:The PPEC consists of two BbsI binding sites that point in opposite directions. Digestion with BbsI leads to removal of the PPEC and to the formation of sticky ends at which the upstream sticky end (GGCA) is the last 4 nucleotides of the TAL protein and the downstream sticky end (TAAA) contains the stop codon. When an equimolar amount of the effector containing plasmid (flanked also by BbsI sites and the same overlaps) is added to the GGC mix, the effector is cut out of the iGEM vector and ligated into the eukaryotic TAL expression vector in-frame and without a scar. We have optimized this reaction by systematically testing different reaction buffers and thermocycler programs and came up with the following protocol:<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;11,5</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts</td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20 °C, 5 min</td><br />
</tr><tr><br />
<td>go back to 1. 20 times</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 80°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br><br><br><br><br><br></html><br />
<br />
:But even Golden Gate cloning is not 100 % efficient. In order to remove those plasmids that did not take up a vector insert, we added the restriction site of the blunt end cutter PmeI (MssI) to the PPEC. We chose PmeI because it has a 8 bp binding site, which is very unlikely to occur in the gene of an effector that you would like to fuse with the TAL gene.<br />
:So after performing the Golden Gate reaction described above, we digested with MssI fast digest (fermentas) according to the following protocol:<br />
<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>GGC-Product</td><td>&#160;10</td><br />
</tr><tr><br />
<td>PmeI/MssI FastDigest</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Fast Digest Buffer (10x)</td><td>&#160;1,5</td> <br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;2,5</td><br />
</tr><tr><br />
<td>Total</td><td>&#160;15</td> <br />
</tr></table><br />
<br />
<br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 1h</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80 °C, 20 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br><br></html><br />
<br />
:This linearizes all vectors that do not contain the effector (at least, we do not see colonies on the negative control plate). To be sure, these linearized vectors do not religate, perform the following digest with T5 exonuclease, which specifically removes linearized DNA:<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Product of PmeI digest</td><td>&#160;7,5</td><br />
</tr><tr><br />
<td>T5 Exonuclease</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Total</td><td>&#160;8,5</td> <br />
</tr></table><br />
<br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 1h</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80 °C, 20 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br />
</html><br />
:The efficiency of our own little invention – the PPEC – actually surprised us a little bit, for details, see the [[#Team:Freiburg/Project/Experiments|results section]].<br><br><br />
<br />
:'''Insertion of the TAL ORF into the MammoBrick vector:'''<br><br><br />
:Since we wanted to put the TAL ORF under the control of the CMV promoter, we digested both the MammoBrick vector (with SpeI and PstI) and the TAL ORF (with XbaI and PstI), ligated them and transformed into a ccdB-cassette resistant E.coli strain. The resulting clones were verified by sequencing and contained the eukaryotic TAL expression vector:<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/3/3b/Figure8T.png" width="450px" style="margin-left:150px"/><br><br></html><br />
<br />
:'''Prokaryotic TAL expression vector:'''<br><br />
:Although for the most part, TAL effectors have been used in eukaryotic organisms, we wanted to enable future iGEM teams to also use this exciting technology in bacteria. So we used BioBrick assembly to construct the following protein generator using TAL ORF, Part:BBa_J04500 (IPTG inducible promoter with RBS) and BBa_B0015 (double terminator):<br />
<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/d/d6/Figure9T.png" width="450px" style="margin-left:150px"/></html><br />
<br />
<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/OverviewTeam:Freiburg/Project/Overview2012-10-27T00:12:34Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= The GATE Assembly Kit =<br />
----<br />
<br><br />
<div align="justify">TALEs make sequence-specific genome modification much easier than before and therefore attract great interest in the synbio community and beyond. Interestingly, many of the researchers who hold the patents on TALEs also released open source toolkits for TALE assembly for academic research. However, most strategies of TALE gene assembly published thus far rely on a hierarchical procedure, that is very time consuming, laborious and not automatable.<br />
Therefore, we herein describe the Golden Gate cloning-based TAL Effector (GATE) Assembly platform, which enables literally everyone to produce low-cost, tailored TALEs within a few minutes of labwork and basic lab equipment. Moreover, we have automated this strategy and produced different TAL Effector Transcription Factors with 97 % success rate faster than any other method published before.<br />
<br><br />
<br />
<br />
== Review of existing TALE construction methods ==<br />
<br><br />
<div align="justify"><br />
Although TALE assembly is considerably easier than e.g. screening for novel zinc fingers, the highly repetitive structure of the TALE gene implies some challenges, because conventional PCR or homologous recombination-based gene assembly strategies cannot be applied.<br />
To our knowledge, the numerous approaches of TAL-Effector gene assembly, published so far, fall under the following three categories:<br />
<br />
<br />
1. Few groups have applied methods called unit assembly<sup>1</sup> or Restriction Enzyme And Ligation (REAL)<sup>2</sup>. In the first step, both strategies perform conventional restriction enzyme digestion in order to assemble two gene fragments of single repeats. The pairs of repeat gene fragments are subsequently assembled to form tetramers, and this highly hierarchical assembly strategy is continued until the desired number of repeats is assembled. These platforms obviously involve multiple laborious and time consuming rounds of digestion, ligation and isolation of the right ligation products. The recently published fast ligation-based automatable solid-phase high-throughput (FLASH) system circumvents major challenges of REAL by attaching the first repeat to streptavidin-coated magnetic beads and, successively, adding further repeats or oligorepeats from a 376-plasmid library. Although Reyon et al.<sup>11</sup> claim that FLASH can also be performed manually, this probably does not represent the most convenient and low-cost protocol for iGEM students.<br />
<br />
<br />
2. We call the second category of TALE production methods the synthesis optimization approach. The major challenge of TAL synthesis is the highly repetitive amino acid sequence of the DNA binding part. Since synthetic genes are typically produced from overlapping synthesized oligos, overlaps of different pairs of overlapping oligos need to be distinct. The synthesis optimization approach employs a sophisticated computer program that optimizes codon usage in order to reduce repetitiveness of the TAL gene and calculates optimal oligos for synthesis<sup>3,4</sup>. Although this approach might be the method of the future, it is currently too expensive for iGEM teams. <br />
<br />
<br />
3. The third category of TALE assembly protocols applies Golden Gate Cloning (GGC)<sup>5,6,7,8,9</sup> (for details on GGC, see the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard page]]). In all GGC-based TALE repeat assembly strategies, level 1 modules (i.e. single repeat gene fragments) are flanked by type IIs restriction sites adjacent to their first or last 4 nucleotides, respectively, that produce sticky ends after digestion with the type IIs restriction enzyme. Since each level 1 module codes for the same amino acid sequence (despite of the RVDs), the codon usage must be changed at these 4 external nucleotides for producing unique sticky ends that assemble in the predefined order after digestion. Consequently, the 4 bp overlaps of a level 1 module specify its future position within the TALE gene.<br />
So, in order to be able to target any sequence of DNA, a method that is using GGC requires N x K modules. N signifies the number of level 1 module positions (i.e. number of modules that the TALE should contain after GGC) and K signifies the number of different repeats that the user should be able to put into each of the N positions (in most kits K equals 4, one repeat for each DNA base, see figure 1).<br />
Unfortunately, using GGC, only up to 10 modules <sup>5</sup> can be assembled with high accuracy. So in the GGC-based protocols, level 1 modules get assembled to form level 2 modules (oligorepeats). These level 2 modules need to be amplified and isolated before a second GGC reaction assembles them to form the complete repeat array. The bottleneck of the GGC-based methods is the need for amplification and isolation of level 2 modules, which costs a lot of time, requires some extra knowledge, additional enzymes and lab equipment (we actually tried one of the GGC-based open source kits, but, even after 2.5 weeks, were not able to assemble the whole TALE).<br><br><br />
<br />
<br />
<br />
== GATE Assembly Kit ==<br />
<br />
<br><br />
<div align="justify">Right from the beginning, we were very much intrigued by the efficiency of Golden Gate Cloning and hypothesized, that instant TAL assembly would be possible if we overcame the need for a second (or even third) round of GGC. Since we were sure we were not able to improve GGC reaction conditions so much that we could actually assemble all repeats at once, we came up with another solution: Why not use direpeats instead of single repeats as level 1 modules? This would cut the number of level 1 modules half and allow us to perform TAL assembly in one single reaction. Unfortunately, our idea would not only cut half N but would also quadruple M, and thus would double the toolkit size.<br />
<br><br />
<br />
[[Image:Synthese_3.png|200px|center|no frame|link=]]<br />
<br />
<br><br />
So we needed to further reduce N down to 6 to obtain a reasonable toolkit size of 96 level 1 modules. We actually liked the idea that our kit would perfectly fit on a 96 well plate.<br />
<br><br><br />
<br />
[[Image:Toolkit.png|700px|center|no frame|link=]]<br />
<br />
<br><br />
Next, we looked into the literature to check, if TALEs that recognize 14 bp (instead of around 18 bp) are actually functional. We were very fortunate to see that efficiency of TAL transcription factors (TAL-TFs)<sup>10 </sup> and TAL effector nucleases (TALENs)<sup>11 </sup> remains constant between for target sequences between 13 and 20 bp. Moreover, Zhang et al. published splendid results with 14 bp-binding TAL-TFs in a human cell line<sup>7</sup>. <br />
Since we wanted our TALEs to function in both bacteria and eukaryotic systems, while published TAL repeats were always designed for one particular organism, we decided to design the direpeat nucleotide sequences from scratch: We used the amino acid sequence of the hex3 gene of Xanthomonas oryzae to find out the amino acid sequences for the 16 direpeats. Next, we reverse-tanslated the sequences into DNA, codon optimized them for E.coli and human cells and reduced homologies between and within gene fragments (only the extention PCR binding sites were the same for every direpeat gene).<br />
After receiving the sequences that were synthesized as G-blocks by IDT, we performed 6 extention PCRs on every sequence to add 4 bp overlaps, BsmBI restriction sites and iGEM prefix and suffix to the parts. The 4 bp overlaps would later determine the position of the respective direpeat in the repeat array of the TALE.<br />
<br><br><br />
<br />
[[Image:Biobrickfreigem.png|500px|center|no frame|link=]]<br />
<br><br><br><br><br />
<br />
[[Image:Extension3.png|600px|center|no frame|link=]]<br />
<br />
<br><br />
One of the advantages of GGC is that you can insert complete plasmids containing the parts you want to assemble. So we decided to clone all 96 parts into the standard iGEM vector pSB1C3. We hypothesized that the BsmBI restriction site in the chloramphenicol gene would decrease GGC efficiency, so we performed a mutagenesis PCR to introduce the silent mutation (G434C) prior to cloning the 96 PCR products into it. When doing so many cloning experiments at a time, error rate needs to be minimal, so at first, we spent weeks optimizing every single step from the G-block to the Golden Gate standard compatible BioBrick (see [[Team:Freiburg/Project/Golden#GGC|protocol section]]). In the end, we are very happy that we have a full GATE assembly kit with [[Team:Freiburg/Parts|96 unique direpeats]] and 100% accurate sequencing results.<br />
Our first attempts to use the GATE assembly kit were actually very discouraging - no colonies were found on the agar plates after transforming the GGC product into DH10B cells for more than one week - at least, we knew that our ccdb kill cassette was working well (details about the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">expression vector</a></html>). After systematically testing all kinds of buffers and reaction additives, the results where quite overwhelming. We were even able to dramatically reduce GGC reaction time down to 2.5 hours - which is probably the fastest way anyone has ever built a custom tal effector.<br />
<br />
<br><br><br />
<br />
== References ==<br />
<br><br />
1. Huang, P. et al. Heritable gene targeting in zebrafish using customized TALENs. ''Nat Biotechnol'' 29, 699–700 (2011).<br><br />
2. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol 2''9, 697–698 (2011).<br><br />
3. Hoover, D. M. & Lubkowski, J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. ''Nucl Acids Res'' 30, e43–e43 (2002).<br><br />
4. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nat Biotechnol'' 29, 143–148 (2010).<br><br />
5. Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. Assembly of Custom TALE-Type DNA Binding Domains by Modular Cloning. ''Nucl Acids Res'' 39, 5790–5799 (2011).<br><br />
6. Weber, E., Gruetzner, R., Werner, S., Engler, C. & Marillonnet, S. Assembly of designer TAL effectors by golden gate cloning. ''PloS one'' 6, e19722 (2011).<br><br />
7. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nat Biotechnol'' 29, 149–153 (2011).<br><br />
8. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucl Acids Res'' 39, e82 (2011).<br><br />
9. Li, T. et al. Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes. ''Nucl Acids Res'' 39, 6315–6325 (2011).<br><br />
10. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br><br />
11. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nat Biotechnol'' 30, 460–465 (2012).<br />
<br />
<br />
<br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<!--- The Mission, Experiments ---></div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/OverviewTeam:Freiburg/Project/Overview2012-10-27T00:00:53Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= The GATE Assembly Kit =<br />
----<br />
<br><br />
<div align="justify">TALEs make sequence-specific genome modification much easier than before and therefore attract great interest in the synbio community and beyond. Interestingly, many of the researchers who hold the patents on TALEs also released open source toolkits for TALE assembly for academic research. However, most strategies of TALE gene assembly published thus far rely on a hierarchical procedure, that is very time consuming, laborious and not automatable.<br />
Therefore, we herein describe the Golden Gate cloning-based TAL Effector (GATE) Assembly platform, which enables literally everyone to produce low-cost, tailored TALEs within a few minutes of labwork and basic lab equipment. Moreover, we have automated this strategy and produced different TAL Effector Transcription Factors with 97 % success rate faster than any other method published before.<br />
<br><br />
<br />
<br />
== Review of existing TALE construction methods ==<br />
<br><br />
<div align="justify"><br />
Although TALE assembly is considerably easier than e.g. screening for novel zinc fingers, the highly repetitive structure of the TALE gene implies some challenges, because conventional PCR or homologous recombination-based gene assembly strategies cannot be applied.<br />
To our knowledge, the numerous approaches of TAL-Effector gene assembly, published so far, fall under the following three categories:<br />
<br />
<br />
1. Few groups have applied methods called unit assembly<sup>1</sup> or Restriction Enzyme And Ligation (REAL)<sup>2</sup>. In the first step, both strategies perform conventional restriction enzyme digestion in order to assemble two gene fragments of single repeats. The pairs of repeat gene fragments are subsequently assembled to form tetramers, and this highly hierarchical assembly strategy is continued until the desired number of repeats is assembled. These platforms obviously involve multiple laborious and time consuming rounds of digestion, ligation and isolation of the right ligation products. The recently published fast ligation-based automatable solid-phase high-throughput (FLASH) system circumvents major challenges of REAL by attaching the first repeat to streptavidin-coated magnetic beads and, successively, adding further repeats or oligorepeats from a 376-plasmid library. Although Reyon et al.<sup>11</sup> claim that FLASH can also be performed manually, this probably does not represent the most convenient and low-cost protocol for iGEM students.<br />
<br />
<br />
2. We call the second category of TALE production methods the synthesis optimization approach. The major challenge of TAL synthesis is the highly repetitive amino acid sequence of the DNA binding part. Since synthetic genes are typically produced from overlapping synthesized oligos, overlaps of different pairs of overlapping oligos need to be distinct. The synthesis optimization approach employs a sophisticated computer program that optimizes codon usage in order to reduce repetitiveness of the TAL gene and calculates optimal oligos for synthesis<sup>3,4</sup>. Although this approach might be the method of the future, it is currently too expensive for iGEM teams. <br />
<br />
<br />
3. The third category of TALE assembly protocols applies Golden Gate Cloning (GGC)<sup>5,6,7,8,9</sup> (for details on GGC, see the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard page]]). In all GGC-based TALE repeat assembly strategies, level 1 modules (i.e. single repeat gene fragments) are flanked by type IIs restriction sites adjacent to their first or last 4 nucleotides, respectively, that produce sticky ends after digestion with the type IIs restriction enzyme. Since each level 1 module codes for the same amino acid sequence (despite of the RVDs), the codon usage must be changed at these 4 external nucleotides for producing unique sticky ends that assemble in the predefined order after digestion. Consequently, the 4 bp overlaps of a level 1 module specify its future position within the TALE gene.<br />
So, in order to be able to target any sequence of DNA, a method that is using GGC requires N x K modules. N signifies the number of level 1 module positions (i.e. number of modules that the TALE should contain after GGC) and K signifies the number of different repeats that the user should be able to put into each of the N positions (in most kits K equals 4, one repeat for each DNA base, see figure 1).<br />
Unfortunately, using GGC, only up to 10 modules <sup>5</sup> can be assembled with high accuracy. So in the GGC-based protocols, level 1 modules get assembled to form level 2 modules (oligorepeats). These level 2 modules need to be amplified and isolated before a second GGC reaction assembles them to form the complete repeat array. The bottleneck of the GGC-based methods is the need for amplification and isolation of level 2 modules, which costs a lot of time, requires some extra knowledge, additional enzymes and lab equipment (we actually tried one of the GGC-based open source kits, but, even after 2.5 weeks, were not able to assemble the whole TALE).<br><br><br />
<br />
== GATE Assembly Kit ==<br />
----<br />
<br><br />
<div align="justify">Right from the beginning, we were very much intrigued by the efficiency of Golden Gate Cloning and hypothesized, that instant TAL assembly would be possible if we overcame the need for a second (or even third) round of GGC. Since we were sure we were not able to improve GGC reaction conditions so much that we could actually assemble all repeats at once, we came up with another solution: Why not use direpeats instead of single repeats as level 1 modules? This would cut the number of level 1 modules half and allow us to perform TAL assembly in one single reaction. Unfortunately, our idea would not only cut half N but would also quadruple M, and thus would double the toolkit size.<br />
<br><br />
<br />
[[Image:Synthese_3.png|200px|center|no frame|link=]]<br />
<br />
<br><br />
So we needed to further reduce N down to 6 to obtain a reasonable toolkit size of 96 level 1 modules. We actually liked the idea that our kit would perfectly fit on a 96 well plate.<br />
<br><br><br />
<br />
[[Image:Toolkit.png|700px|center|no frame|link=]]<br />
<br />
<br><br />
Next, we looked into the literature to check, if TALEs that recognize 14 bp (instead of around 18 bp) are actually functional. We were very fortunate to see that efficiency of TAL transcription factors (TAL-TFs) <sup>10 </sup> and TAL effector nucleases (TALENs)<sup>11 </sup> remains constant between for target sequences between 13 and 20 bp. Moreover, Zhang et al. published splendid results with 14 bp-binding TAL-TFs in a human cell line<sup>7</sup>. <br />
Since we wanted our TALEs to function in both bacteria and eukaryotic systems, while published TAL repeats were always designed for one particular organism, we decided to design the direpeat nucleotide sequences from scratch: We used the amino acid sequence of the hex3 gene of Xanthomonas oryzae to find out the amino acid sequences for the 16 direpeats. Next, we reverse-tanslated the sequences into DNA, codon optimized them for E.coli and human cells and reduced homologies between and within gene fragments (only the extention PCR binding sites were the same for every direpeat gene).<br />
After receiving the sequences that were synthesized as G-blocks by IDT, we performed 6 extention PCRs on every sequence to add 4 bp overlaps, BsmBI restriction sites and iGEM prefix and suffix to the parts. The 4 bp overlaps would later determine the position of the respective direpeat in the repeat array of the TALE.<br />
<br><br><br />
<br />
[[Image:Biobrickfreigem.png|500px|center|no frame|link=]]<br />
<br><br><br><br><br />
<br />
[[Image:Extension3.png|600px|center|no frame|link=]]<br />
<br />
<br><br />
One of the advantages of GGC is that you can insert complete plasmids containing the parts you want to assemble. So we decided to clone all 96 parts into the standard iGEM vector pSB1C3. We hypothesized that the BsmBI restriction site in the chloramphenicol gene would decrease GGC efficiency, so we performed a mutagenesis PCR to introduce the silent mutation (G434C) prior to cloning the 96 PCR products into it. When doing so many cloning experiments at a time, error rate needs to be minimal, so at first, we spent weeks optimizing every single step from the G-block to the Golden Gate standard compatible BioBrick (see [[Team:Freiburg/Project/Golden#GGC|protocol section]]). In the end, we are very happy that we have a full GATE assembly kit with [[Team:Freiburg/Parts|96 unique direpeats]] and 100% accurate sequencing results.<br />
Our first attempts to use the GATE assembly kit were actually very discouraging - no colonies were found on the agar plates after transforming the GGC product into DH10B cells for more than one week - at least, we knew that our ccdb kill cassette was working well (details about the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">expression vector</a></html>). After systematically testing all kinds of buffers and reaction additives, the results where quite overwhelming. We were even able to dramatically reduce GGC reaction time down to 2.5 hours - which is probably the fastest way anyone has ever built a custom tal effector.<br />
<br />
<br><br />
<br />
== References ==<br />
<br><br />
1. Huang, P. et al. Heritable gene targeting in zebrafish using customized TALENs. ''Nat Biotechnol'' 29, 699–700 (2011).<br><br />
2. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol 2''9, 697–698 (2011).<br><br />
3. Hoover, D. M. & Lubkowski, J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. ''Nucl Acids Res'' 30, e43–e43 (2002).<br><br />
4. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nat Biotechnol'' 29, 143–148 (2010).<br><br />
5. Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. Assembly of Custom TALE-Type DNA Binding Domains by Modular Cloning. ''Nucl Acids Res'' 39, 5790–5799 (2011).<br><br />
6. Weber, E., Gruetzner, R., Werner, S., Engler, C. & Marillonnet, S. Assembly of designer TAL effectors by golden gate cloning. ''PloS one'' 6, e19722 (2011).<br><br />
7. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nat Biotechnol'' 29, 149–153 (2011).<br><br />
8. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucl Acids Res'' 39, e82 (2011).<br><br />
9. Li, T. et al. Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes. ''Nucl Acids Res'' 39, 6315–6325 (2011).<br><br />
10. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br><br />
11. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nat Biotechnol'' 30, 460–465 (2012).<br><br />
<br />
<br />
<br />
<br />
<br><br><br><br><br />
[[#top|Back to top]]<br />
<!--- The Mission, Experiments ---></div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/OverviewTeam:Freiburg/Project/Overview2012-10-26T23:53:59Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= The GATE Assembly Kit =<br />
----<br />
<br><br />
<div align="justify">TALEs make sequence-specific genome modification much easier than before and therefore attract great interest in the synbio community and beyond. Interestingly, many of the researchers who hold the patents on TALEs also released open source toolkits for TALE assembly for academic research. However, most strategies of TALE gene assembly published thus far rely on a hierarchical procedure, that is very time consuming, laborious and not automatable.<br />
Therefore, we herein describe the Golden Gate cloning-based TAL Effector (GATE) Assembly platform, which enables literally everyone to produce low-cost, tailored TALEs within a few minutes of labwork and basic lab equipment. Moreover, we have automated this strategy and produced different TAL Effector Transcription Factors with 97 % success rate faster than any other method published before.<br />
<br><br />
<br />
<br />
== Review of existing TALE construction methods ==<br />
<br><br />
<div align="justify"><br />
Although TALE assembly is considerably easier than e.g. screening for novel zinc fingers, the highly repetitive structure of the TALE gene implies some challenges, because conventional PCR or homologous recombination-based gene assembly strategies cannot be applied.<br />
To our knowledge, the numerous approaches of TAL-Effector gene assembly, published so far, fall under the following three categories:<br />
<br />
<br />
1. Few groups have applied methods called unit assembly<sup>1</sup> or Restriction Enzyme And Ligation (REAL)<sup>2</sup>. In the first step, both strategies perform conventional restriction enzyme digestion in order to assemble two gene fragments of single repeats. The pairs of repeat gene fragments are subsequently assembled to form tetramers, and this highly hierarchical assembly strategy is continued until the desired number of repeats is assembled. These platforms obviously involve multiple laborious and time consuming rounds of digestion, ligation and isolation of the right ligation products. The recently published fast ligation-based automatable solid-phase high-throughput (FLASH) system circumvents major challenges of REAL by attaching the first repeat to streptavidin-coated magnetic beads and, successively, adding further repeats or oligorepeats from a 376-plasmid library. Although Reyon et al.<sup>11</sup> claim that FLASH can also be performed manually, this probably does not represent the most convenient and low-cost protocol for iGEM students.<br />
<br />
<br />
2. We call the second category of TALE production methods the synthesis optimization approach. The major challenge of TAL synthesis is the highly repetitive amino acid sequence of the DNA binding part. Since synthetic genes are typically produced from overlapping synthesized oligos, overlaps of different pairs of overlapping oligos need to be distinct. The synthesis optimization approach employs a sophisticated computer program that optimizes codon usage in order to reduce repetitiveness of the TAL gene and calculates optimal oligos for synthesis<sup>3,4</sup>. Although this approach might be the method of the future, it is currently too expensive for iGEM teams. <br />
<br />
<br />
3. The third category of TALE assembly protocols applies Golden Gate Cloning (GGC)<sup>5,6,7,8,9</sup> (for details on GGC, see the [[Team:Freiburg/Project/Golden#GGC|Golden Gate Standard page]]). In all GGC-based TALE repeat assembly strategies, level 1 modules (i.e. single repeat gene fragments) are flanked by type IIs restriction sites adjacent to their first or last 4 nucleotides, respectively, that produce sticky ends after digestion with the type IIs restriction enzyme. Since each level 1 module codes for the same amino acid sequence (despite of the RVDs), the codon usage must be changed at these 4 external nucleotides for producing unique sticky ends that assemble in the predefined order after digestion. Consequently, the 4 bp overlaps of a level 1 module specify its future position within the TALE gene.<br />
So, in order to be able to target any sequence of DNA, a method that is using GGC requires N x M modules. N signifies the number of level 1 module positions (i.e. number of modules that the TALE should contain after GGC) and M signifies the number of different repeats that the user should be able to put into each of the N positions (in most kits M equals 4, one repeat for each DNA base).<br />
Unfortunately, using GGC, only up to 10 modules <sup>5</sup> can be assembled with high accuracy. So in the GGC-based protocols, level 1 modules get assembled to form level 2 modules (oligorepeats). These level 2 modules need to be amplified and isolated before a second GGC reaction assembles them to form the complete repeat array. The bottleneck of the GGC-based methods is the need for amplification and isolation of level 2 modules, which costs a lot of time, requires some extra knowledge, additional enzymes and lab equipment (we actually tried one of the GGC-based open source kits, but, even after 2.5 weeks, were not able to assemble the whole TALE).<br><br><br />
<br />
== GATE Assembly Kit ==<br />
----<br />
<br><br />
<div align="justify">Right from the beginning, we were very much intrigued by the efficiency of Golden Gate Cloning and hypothesized, that instant TAL assembly would be possible if we overcame the need for a second (or even third) round of GGC. Since we were sure we were not able to improve GGC reaction conditions so much that we could actually assemble all repeats at once, we came up with another solution: Why not use direpeats instead of single repeats as level 1 modules? This would cut the number of level 1 modules half and allow us to perform TAL assembly in one single reaction. Unfortunately, our idea would not only cut half N but would also quadruple M, and thus would double the toolkit size.<br />
<br><br />
<br />
[[Image:Synthese_3.png|200px|center|no frame|link=]]<br />
<br />
<br><br />
So we needed to further reduce N down to 6 to obtain a reasonable toolkit size of 96 level 1 modules. We actually liked the idea that our kit would perfectly fit on a 96 well plate.<br />
<br><br><br />
<br />
[[Image:Toolkit.png|700px|center|no frame|link=]]<br />
<br />
<br><br />
Next, we looked into the literature to check, if TALEs that recognize 14 bp (instead of around 18 bp) are actually functional. We were very fortunate to see that efficiency of TAL transcription factors (TAL-TFs) <sup>10 </sup> and TAL effector nucleases (TALENs)<sup>11 </sup> remains constant between for target sequences between 13 and 20 bp. Moreover, Zhang et al. published splendid results with 14 bp-binding TAL-TFs in a human cell line<sup>7</sup>. <br />
Since we wanted our TALEs to function in both bacteria and eukaryotic systems, while published TAL repeats were always designed for one particular organism, we decided to design the direpeat nucleotide sequences from scratch: We used the amino acid sequence of the hex3 gene of Xanthomonas oryzae to find out the amino acid sequences for the 16 direpeats. Next, we reverse-tanslated the sequences into DNA, codon optimized them for E.coli and human cells and reduced homologies between and within gene fragments (only the extention PCR binding sites were the same for every direpeat gene).<br />
After receiving the sequences that were synthesized as G-blocks by IDT, we performed 6 extention PCRs on every sequence to add 4 bp overlaps, BsmBI restriction sites and iGEM prefix and suffix to the parts. The 4 bp overlaps would later determine the position of the respective direpeat in the repeat array of the TALE.<br />
<br><br><br />
<br />
[[Image:Biobrickfreigem.png|500px|center|no frame|link=]]<br />
<br><br><br><br><br />
<br />
[[Image:Extension3.png|600px|center|no frame|link=]]<br />
<br />
<br><br />
One of the advantages of GGC is that you can insert complete plasmids containing the parts you want to assemble. So we decided to clone all 96 parts into the standard iGEM vector pSB1C3. We hypothesized that the BsmBI restriction site in the chloramphenicol gene would decrease GGC efficiency, so we performed a mutagenesis PCR to introduce the silent mutation (G434C) prior to cloning the 96 PCR products into it. When doing so many cloning experiments at a time, error rate needs to be minimal, so at first, we spent weeks optimizing every single step from the G-block to the Golden Gate standard compatible BioBrick (see [[Team:Freiburg/Project/Golden#GGC|protocol section]]). In the end, we are very happy that we have a full GATE assembly kit with [[Team:Freiburg/Parts|96 unique direpeats]] and 100% accurate sequencing results.<br />
Our first attempts to use the GATE assembly kit were actually very discouraging - no colonies were found on the agar plates after transforming the GGC product into DH10B cells for more than one week - at least, we knew that our ccdb kill cassette was working well (details about the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">expression vector</a></html>). After systematically testing all kinds of buffers and reaction additives, the results where quite overwhelming. We were even able to dramatically reduce GGC reaction time down to 2.5 hours - which is probably the fastest way anyone has ever built a custom tal effector.<br />
<br />
<br><br />
<br />
== References ==<br />
<br><br />
1. Huang, P. et al. Heritable gene targeting in zebrafish using customized TALENs. ''Nat Biotechnol'' 29, 699–700 (2011).<br><br />
2. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol 2''9, 697–698 (2011).<br><br />
3. Hoover, D. M. & Lubkowski, J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. ''Nucl Acids Res'' 30, e43–e43 (2002).<br><br />
4. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nat Biotechnol'' 29, 143–148 (2010).<br><br />
5. Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. Assembly of Custom TALE-Type DNA Binding Domains by Modular Cloning. ''Nucl Acids Res'' 39, 5790–5799 (2011).<br><br />
6. Weber, E., Gruetzner, R., Werner, S., Engler, C. & Marillonnet, S. Assembly of designer TAL effectors by golden gate cloning. ''PloS one'' 6, e19722 (2011).<br><br />
7. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nat Biotechnol'' 29, 149–153 (2011).<br><br />
8. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucl Acids Res'' 39, e82 (2011).<br><br />
9. Li, T. et al. Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes. ''Nucl Acids Res'' 39, 6315–6325 (2011).<br><br />
10. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br><br />
11. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nat Biotechnol'' 30, 460–465 (2012).<br><br />
<br />
<br />
<br />
<br />
<br><br><br><br><br />
[[#top|Back to top]]<br />
<!--- The Mission, Experiments ---></div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/OverviewTeam:Freiburg/Project/Overview2012-10-26T23:49:46Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= The GATE Assembly Kit =<br />
----<br />
<br><br />
<div align="justify">TALEs make sequence-specific genome modification much easier than before and therefore attract great interest in the synbio community and beyond. Interestingly, many of the researchers who hold the patents on TALEs also released open source toolkits for TALE assembly for academic research. However, most strategies of TALE gene assembly published thus far rely on a hierarchical procedure, that is very time consuming, laborious and not automatable.<br />
Therefore, we herein describe the Golden Gate cloning-based TAL Effector (GATE) Assembly platform, which enables literally everyone to produce low-cost, tailored TALEs within a few minutes of labwork and basic lab equipment. Moreover, we have automated this strategy and produced different TAL Effector Transcription Factors with 97 % success rate faster than any other method published before.<br />
<br><br />
<br />
<br />
== Review of existing TALE construction methods ==<br />
<br><br />
<div align="justify"><br />
Although TALE assembly is considerably easier than e.g. screening for novel zinc fingers, the highly repetitive structure of the TALE gene implies some challenges, because conventional PCR or homologous recombination-based gene assembly strategies cannot be applied.<br />
To our knowledge, the numerous approaches of TAL-Effector gene assembly, published so far, fall under the following three categories:<br />
<br />
<br />
1. Few groups have applied methods called unit assembly<sup>1</sup> or Restriction Enzyme And Ligation (REAL)<sup>2</sup>. In the first step, both strategies perform conventional restriction enzyme digestion in order to assemble two gene fragments of single repeats. The pairs of repeat gene fragments are subsequently assembled to form tetramers, and this highly hierarchical assembly strategy is continued until the desired number of repeats is assembled. These platforms obviously involve multiple laborious and time consuming rounds of digestion, ligation and isolation of the right ligation products. The recently published fast ligation-based automatable solid-phase high-throughput (FLASH) system circumvents major challenges of REAL by attaching the first repeat to streptavidin-coated magnetic beads and, successively, adding further repeats or oligorepeats from a 376-plasmid library. Although Reyon et al.<sup>11</sup> claim that FLASH can also be performed manually, this probably does not represent the most convenient and low-cost protocol for iGEM students.<br />
<br />
<br />
2. We call the second category of TALE production methods the synthesis optimization approach. The major challenge of TAL synthesis is the highly repetitive amino acid sequence of the DNA binding part. Since synthetic genes are typically produced from overlapping synthesized oligos, overlaps of different pairs of overlapping oligos need to be distinct. The synthesis optimization approach employs a sophisticated computer program that optimizes codon usage in order to reduce repetitiveness of the TAL gene and calculates optimal oligos for synthesis<sup>3,4</sup>. Although this approach might be the method of the future, it is currently too expensive for iGEM teams. <br />
<br />
<br />
3. The third category of TALE assembly protocols applies Golden Gate Cloning (GGC)<sup>5,6,7,8,9</sup> (for details on GGC, see the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Golden"></a>Golden Gate standard page</html>). In all GGC-based TALE repeat assembly strategies, level 1 modules (i.e. single repeat gene fragments) are flanked by type IIs restriction sites adjacent to their first or last 4 nucleotides, respectively, that produce sticky ends after digestion with the type IIs restriction enzyme. Since each level 1 module codes for the same amino acid sequence (despite of the RVDs), the codon usage must be changed at these 4 external nucleotides for producing unique sticky ends that assemble in the predefined order after digestion. Consequently, the 4 bp overlaps of a level 1 module specify its future position within the TALE gene.<br />
So, in order to be able to target any sequence of DNA, a method that is using GGC requires N x M modules. N signifies the number of level 1 module positions (i.e. number of modules that the TALE should contain after GGC) and M signifies the number of different repeats that the user should be able to put into each of the N positions (in most kits M equals 4, one repeat for each DNA base).<br />
Unfortunately, using GGC, only up to 10 modules <sup>5</sup> can be assembled with high accuracy. So in the GGC-based protocols, level 1 modules get assembled to form level 2 modules (oligorepeats). These level 2 modules need to be amplified and isolated before a second GGC reaction assembles them to form the complete repeat array. The bottleneck of the GGC-based methods is the need for amplification and isolation of level 2 modules, which costs a lot of time, requires some extra knowledge, additional enzymes and lab equipment (we actually tried one of the GGC-based open source kits, but, even after 2.5 weeks, were not able to assemble the whole TALE).<br><br><br />
<br />
== GATE Assembly Kit ==<br />
----<br />
<br><br />
<div align="justify">Right from the beginning, we were very much intrigued by the efficiency of Golden Gate Cloning and hypothesized, that instant TAL assembly would be possible if we overcame the need for a second (or even third) round of GGC. Since we were sure we were not able to improve GGC reaction conditions so much that we could actually assemble all repeats at once, we came up with another solution: Why not use direpeats instead of single repeats as level 1 modules? This would cut the number of level 1 modules half and allow us to perform TAL assembly in one single reaction. Unfortunately, our idea would not only cut half N but would also quadruple M, and thus would double the toolkit size.<br />
<br><br />
<br />
[[Image:Synthese_3.png|200px|center|no frame|link=]]<br />
<br />
<br><br />
So we needed to further reduce N down to 6 to obtain a reasonable toolkit size of 96 level 1 modules. We actually liked the idea that our kit would perfectly fit on a 96 well plate.<br />
<br><br><br />
<br />
[[Image:Toolkit.png|700px|center|no frame|link=]]<br />
<br />
<br><br />
Next, we looked into the literature to check, if TALEs that recognize 14 bp (instead of around 18 bp) are actually functional. We were very fortunate to see that efficiency of TAL transcription factors (TAL-TFs) <sup>10 </sup> and TAL effector nucleases (TALENs)<sup>11 </sup> remains constant between for target sequences between 13 and 20 bp. Moreover, Zhang et al. published splendid results with 14 bp-binding TAL-TFs in a human cell line<sup>7</sup>. <br />
Since we wanted our TALEs to function in both bacteria and eukaryotic systems, while published TAL repeats were always designed for one particular organism, we decided to design the direpeat nucleotide sequences from scratch: We used the amino acid sequence of the hex3 gene of Xanthomonas oryzae to find out the amino acid sequences for the 16 direpeats. Next, we reverse-tanslated the sequences into DNA, codon optimized them for E.coli and human cells and reduced homologies between and within gene fragments (only the extention PCR binding sites were the same for every direpeat gene).<br />
After receiving the sequences that were synthesized as G-blocks by IDT, we performed 6 extention PCRs on every sequence to add 4 bp overlaps, BsmBI restriction sites and iGEM prefix and suffix to the parts. The 4 bp overlaps would later determine the position of the respective direpeat in the repeat array of the TALE.<br />
<br><br><br />
<br />
[[Image:Biobrickfreigem.png|500px|center|no frame|link=]]<br />
<br><br><br><br><br />
<br />
[[Image:Extension3.png|600px|center|no frame|link=]]<br />
<br />
<br><br />
One of the advantages of GGC is that you can insert complete plasmids containing the parts you want to assemble. So we decided to clone all 96 parts into the standard iGEM vector pSB1C3. We hypothesized that the BsmBI restriction site in the chloramphenicol gene would decrease GGC efficiency, so we performed a mutagenesis PCR to introduce the silent mutation (G434C) prior to cloning the 96 PCR products into it. When doing so many cloning experiments at a time, error rate needs to be minimal, so at first, we spent weeks optimizing every single step from the G-block to the Golden Gate standard compatible BioBrick (see [[Team:Freiburg/Project/Golden#GGC|protocol section]]). In the end, we are very happy that we have a full GATE assembly kit with [[Team:Freiburg/Parts|96 unique direpeats]] and 100% accurate sequencing results.<br />
Our first attempts to use the GATE assembly kit were actually very discouraging - no colonies were found on the agar plates after transforming the GGC product into DH10B cells for more than one week - at least, we knew that our ccdb kill cassette was working well (details about the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">expression vector</a></html>). After systematically testing all kinds of buffers and reaction additives, the results where quite overwhelming. We were even able to dramatically reduce GGC reaction time down to 2.5 hours - which is probably the fastest way anyone has ever built a custom tal effector.<br />
<br />
<br><br />
<br />
== References ==<br />
<br><br />
1. Huang, P. et al. Heritable gene targeting in zebrafish using customized TALENs. ''Nat Biotechnol'' 29, 699–700 (2011).<br><br />
2. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol 2''9, 697–698 (2011).<br><br />
3. Hoover, D. M. & Lubkowski, J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. ''Nucl Acids Res'' 30, e43–e43 (2002).<br><br />
4. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nat Biotechnol'' 29, 143–148 (2010).<br><br />
5. Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. Assembly of Custom TALE-Type DNA Binding Domains by Modular Cloning. ''Nucl Acids Res'' 39, 5790–5799 (2011).<br><br />
6. Weber, E., Gruetzner, R., Werner, S., Engler, C. & Marillonnet, S. Assembly of designer TAL effectors by golden gate cloning. ''PloS one'' 6, e19722 (2011).<br><br />
7. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nat Biotechnol'' 29, 149–153 (2011).<br><br />
8. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucl Acids Res'' 39, e82 (2011).<br><br />
9. Li, T. et al. Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes. ''Nucl Acids Res'' 39, 6315–6325 (2011).<br><br />
10. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br><br />
11. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nat Biotechnol'' 30, 460–465 (2012).<br><br />
<br />
<br />
<br />
<br />
<br><br><br><br><br />
[[#top|Back to top]]<br />
<!--- The Mission, Experiments ---></div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/OverviewTeam:Freiburg/Project/Overview2012-10-26T23:46:45Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= The GATE Assembly Kit =<br />
----<br />
<br><br />
<div align="justify">TALEs make sequence-specific genome modification much easier than before and therefore attract great interest in the synbio community and beyond. Interestingly, many of the researchers who hold the patents on TALEs also released open source toolkits for TALE assembly for academic research. However, most strategies of TALE gene assembly published thus far rely on a hierarchical procedure, that is very time consuming, laborious and not automatable.<br />
Therefore, we herein describe the Golden Gate cloning-based TAL Effector (GATE) Assembly platform, which enables literally everyone to produce low-cost, tailored TALEs within a few minutes of labwork and basic lab equipment. Moreover, we have automated this strategy and produced different TAL Effector Transcription Factors with 97 % success rate faster than any other method published before.<br />
<br><br />
<br />
<br />
== Review of existing TALE construction methods ==<br />
<br><br />
<div align="justify"><br />
Although TALE assembly is considerably easier than e.g. screening for novel zinc fingers, the highly repetitive structure of the TALE gene implies some challenges, because conventional PCR or homologous recombination-based gene assembly strategies cannot be applied.<br />
To our knowledge, the numerous approaches of TAL-Effector gene assembly, published so far, fall under the following three categories:<br />
<br />
<br />
1. Few groups have applied methods called unit assembly<sup>1</sup> or Restriction Enzyme And Ligation (REAL)<sup>2</sup>. In the first step, both strategies perform conventional restriction enzyme digestion in order to assemble two gene fragments of single repeats. The pairs of repeat gene fragments are subsequently assembled to form tetramers, and this highly hierarchical assembly strategy is continued until the desired number of repeats is assembled. These platforms obviously involve multiple laborious and time consuming rounds of digestion, ligation and isolation of the right ligation products. The recently published fast ligation-based automatable solid-phase high-throughput (FLASH) system circumvents major challenges of REAL by attaching the first repeat to streptavidin-coated magnetic beads and, successively, adding further repeats or oligorepeats from a 376-plasmid library. Although Reyon et al.<sup>11</sup> claim that FLASH can also be performed manually, this probably does not represent the most convenient and low-cost protocol for iGEM students.<br />
<br />
<br />
2. We call the second category of TALE production methods the synthesis optimization approach. The major challenge of TAL synthesis is the highly repetitive amino acid sequence of the DNA binding part. Since synthetic genes are typically produced from overlapping synthesized oligos, overlaps of different pairs of overlapping oligos need to be distinct. The synthesis optimization approach employs a sophisticated computer program that optimizes codon usage in order to reduce repetitiveness of the TAL gene and calculates optimal oligos for synthesis<sup>3,4</sup>. Although this approach might be the method of the future, it is currently too expensive for iGEM teams. <br />
<br />
<br />
3. The third category of TALE assembly protocols applies Golden Gate Cloning (GGC)<sup>5,6,7,8,9</sup> (for details on GGC, see the Golden Gate standard page). In all GGC-based TALE repeat assembly strategies, level 1 modules (i.e. single repeat gene fragments) are flanked by type IIs restriction sites adjacent to their first or last 4 nucleotides, respectively, that produce sticky ends after digestion with the type IIs restriction enzyme. Since each level 1 module codes for the same amino acid sequence (despite of the RVDs), the codon usage must be changed at these 4 external nucleotides for producing unique sticky ends that assemble in the predefined order after digestion. Consequently, the 4 bp overlaps of a level 1 module specify its future position within the TALE gene.<br />
So, in order to be able to target any sequence of DNA, a method that is using GGC requires N x M modules. N signifies the number of level 1 module positions (i.e. number of modules that the TALE should contain after GGC) and M signifies the number of different repeats that the user should be able to put into each of the N positions (in most kits M equals 4, one repeat for each DNA base).<br />
Unfortunately, using GGC, only up to 10 modules <sup>5</sup> can be assembled with high accuracy. So in the GGC-based protocols, level 1 modules get assembled to form level 2 modules (oligorepeats). These level 2 modules need to be amplified and isolated before a second GGC reaction assembles them to form the complete repeat array. The bottleneck of the GGC-based methods is the need for amplification and isolation of level 2 modules, which costs a lot of time, requires some extra knowledge, additional enzymes and lab equipment (we actually tried one of the GGC-based open source kits, but, even after 2.5 weeks, were not able to assemble the whole TALE).<br><br><br />
<br />
== GATE Assembly Kit ==<br />
----<br />
<br><br />
<div align="justify">Right from the beginning, we were very much intrigued by the efficiency of Golden Gate Cloning and hypothesized, that instant TAL assembly would be possible if we overcame the need for a second (or even third) round of GGC. Since we were sure we were not able to improve GGC reaction conditions so much that we could actually assemble all repeats at once, we came up with another solution: Why not use direpeats instead of single repeats as level 1 modules? This would cut the number of level 1 modules half and allow us to perform TAL assembly in one single reaction. Unfortunately, our idea would not only cut half N but would also quadruple M, and thus would double the toolkit size.<br />
<br><br />
<br />
[[Image:Synthese_3.png|200px|center|no frame|link=]]<br />
<br />
<br><br />
So we needed to further reduce N down to 6 to obtain a reasonable toolkit size of 96 level 1 modules. We actually liked the idea that our kit would perfectly fit on a 96 well plate.<br />
<br><br><br />
<br />
[[Image:Toolkit.png|700px|center|no frame|link=]]<br />
<br />
<br><br />
Next, we looked into the literature to check, if TALEs that recognize 14 bp (instead of around 18 bp) are actually functional. We were very fortunate to see that efficiency of TAL transcription factors (TAL-TFs) <sup>10 </sup> and TAL effector nucleases (TALENs)<sup>11 </sup> remains constant between for target sequences between 13 and 20 bp. Moreover, Zhang et al. published splendid results with 14 bp-binding TAL-TFs in a human cell line<sup>7</sup>. <br />
Since we wanted our TALEs to function in both bacteria and eukaryotic systems, while published TAL repeats were always designed for one particular organism, we decided to design the direpeat nucleotide sequences from scratch: We used the amino acid sequence of the hex3 gene of Xanthomonas oryzae to find out the amino acid sequences for the 16 direpeats. Next, we reverse-tanslated the sequences into DNA, codon optimized them for E.coli and human cells and reduced homologies between and within gene fragments (only the extention PCR binding sites were the same for every direpeat gene).<br />
After receiving the sequences that were synthesized as G-blocks by IDT, we performed 6 extention PCRs on every sequence to add 4 bp overlaps, BsmBI restriction sites and iGEM prefix and suffix to the parts. The 4 bp overlaps would later determine the position of the respective direpeat in the repeat array of the TALE.<br />
<br><br><br />
<br />
[[Image:Biobrickfreigem.png|500px|center|no frame|link=]]<br />
<br><br><br><br><br />
<br />
[[Image:Extension3.png|600px|center|no frame|link=]]<br />
<br />
<br><br />
One of the advantages of GGC is that you can insert complete plasmids containing the parts you want to assemble. So we decided to clone all 96 parts into the standard iGEM vector pSB1C3. We hypothesized that the BsmBI restriction site in the chloramphenicol gene would decrease GGC efficiency, so we performed a mutagenesis PCR to introduce the silent mutation (G434C) prior to cloning the 96 PCR products into it. When doing so many cloning experiments at a time, error rate needs to be minimal, so at first, we spent weeks optimizing every single step from the G-block to the Golden Gate standard compatible BioBrick (see [[Team:Freiburg/Project/Golden#GGC|protocol section]]). In the end, we are very happy that we have a full GATE assembly kit with [[Team:Freiburg/Parts|96 unique direpeats]] and 100% accurate sequencing results.<br />
Our first attempts to use the GATE assembly kit were actually very discouraging - no colonies were found on the agar plates after transforming the GGC product into DH10B cells for more than one week - at least, we knew that our ccdb kill cassette was working well (details about the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">expression vector</a></html>). After systematically testing all kinds of buffers and reaction additives, the results where quite overwhelming. We were even able to dramatically reduce GGC reaction time down to 2.5 hours - which is probably the fastest way anyone has ever built a custom tal effector.<br />
<br />
<br><br />
<br />
== References ==<br />
<br><br />
1. Huang, P. et al. Heritable gene targeting in zebrafish using customized TALENs. ''Nat Biotechnol'' 29, 699–700 (2011).<br><br />
2. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol 2''9, 697–698 (2011).<br><br />
3. Hoover, D. M. & Lubkowski, J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. ''Nucl Acids Res'' 30, e43–e43 (2002).<br><br />
4. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nat Biotechnol'' 29, 143–148 (2010).<br><br />
5. Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. Assembly of Custom TALE-Type DNA Binding Domains by Modular Cloning. ''Nucl Acids Res'' 39, 5790–5799 (2011).<br><br />
6. Weber, E., Gruetzner, R., Werner, S., Engler, C. & Marillonnet, S. Assembly of designer TAL effectors by golden gate cloning. ''PloS one'' 6, e19722 (2011).<br><br />
7. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nat Biotechnol'' 29, 149–153 (2011).<br><br />
8. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucl Acids Res'' 39, e82 (2011).<br><br />
9. Li, T. et al. Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes. ''Nucl Acids Res'' 39, 6315–6325 (2011).<br><br />
10. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br><br />
11. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nat Biotechnol'' 30, 460–465 (2012).<br><br />
<br />
<br />
<br />
<br />
<br><br><br><br><br />
[[#top|Back to top]]<br />
<!--- The Mission, Experiments ---></div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/VektorTeam:Freiburg/Project/Vektor2012-10-26T23:37:04Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Creating the TAL Mammobrick vector =<br />
----<br />
<br />
<br />
<br />
== Introduction: ==<br />
<html><br />
<div align="justify">In nature, TALEs are injected into the host cells by plant pathogenic bacteria in order to modulate their gene expression. From the synthetic biologist’s point of view, this is very convenient because it implies that TALEs can be expressed in bacteria but also function in a eukaryotic system. We therefore provide plasmids for expression in either human cell lines or in bacteria.<br><br></html><br />
<br />
== Eukaryotic expression vector: ==<br />
----<br />
<br><br />
<br />
<div align="justify">Since we wanted to express our TAL effectors in Human Embryonic Kidney (HEK) cells, we needed a eukaryotic expression vector. Unfortunately, the registry does not offer such a vector, so we decided to build one our own. In order to avoid intellectual property rights violations, we ordered the vector pTALEN (v2) NG (along with the Zhang Lab TALE Toolbox) from the open source plasmid repository [http://www.addgene.org/ Addgene]. The Zhang Lab at MIT has constructed this plasmid for TAL effector expression, so we decided that it would be a good template for our own vector. Converting pTALEN (v2) NG into a RFC10 compatible vector would have taken more mutagenesis PCRs than we would have been able to perform over the summer, so we chose the following two-step vector assembly strategy:</div><br><br><br />
<b>Step 1: Mammobrick</b><br />
<br><br><br />
In the first step, we wanted to built a universal mammalian expression vector (called MammoBrick), which would allows future iGEM students to express any gene in human cell lines simply by cloning the open reading frame into the MammoBrick using the BioBrick assembly protocol. We assembled the MammoBrick from the following four parts, essentially, using the protocol described [[Team:Freiburg/Project/Golden#GGC|here]]:<br><br><br />
:Part 1: '''BACKBONE''' <br>We have cut the backbone out of pTALEN (v2) NG with Ngo MIV and AfiII and purified the corresponding 2234bp band from a gel. Since both enzymes produce 5’ overhangs, they were compatible with overhangs produced by BsaI digestion. This backbone contains a SV 40 polyadenylation signal, an ampicillin resistance gene and an origin of replication.<br><br><br />
:Part2: '''CMV promoter'''<br>At first, we tried to use the CMV promotor that was included in the 2012 distribution kit. Part BBa_J52034 was submitted to the registry by Team Slovenia in 2006 and has been on the distribution kit since then (although sequencing was inconsistent every year). After numerous attempts to use this part, we sequenced it and found out that it was not a CMV promotor, but a part of the lacI gene. Reading the part’s review, we noticed that Team Munich 2010 had already pointed out that it was a lacI fragment. Interestingly, Team DTU Denmark was able to induce fluorescent protein expression with this bacterial gene fragment- magic. Since no other mammalian promoter was available on this year’s distribution kit, we designed the following primers and amplified the CMV promoter from the vector pPhi-Yellow-C:<br><br><br />
::::GTTACCGGTCTCGTTAAGAATTCGCGGCCGCTTCTAGAGATAGTAATCAATTACGGGGTC<br><br />
::::CTAGAGGTCTCGCTGCCTGCAGCGGCCGCTACTAGTAGATCTGACGGTTCACTAAAC<br><br><br />
:After amplifying the CMV promoter with these primers, the promoter is not only flanked by the iGEM prefix and suffix, but also by distal BsaI restriction sites. This way, we were able to directly assemble the PCR product with the other MammoBrick parts.<br><br><br />
:Part 3: '''PuroORF''' <br>We replaced the hygromycin resistance gene in pTALEN (v2) NG for two reasons: Firstly, it contained multiple iGEM restriction sites and secondly, selection via hygromycin takes much longer than selection with puromycin. Since we also didn’t find a puromycin ORF without illegal restriction sites, we decided to make silent mutations in the PuroORF to remove these sites and get it synthesized, flanked by BsaI restriction sites and appropriate overlaps for subsequent Golden Gate cloning.<br><br><br />
:Part 4: '''PostORF''' <br>We called the region between the stop codon of the TAL ORF and the start codon of the antibiotic resistance gene PostORF. We wanted to use this part in our vector because it contains the SV40 promoter and enhancer for expression of the antibiotic selection marker. So we used PCR to “excise the fragment and add BsaI sites and appropriate overlaps to it.<br><br><br />
:After every single part had been purified, we used Golden Gate cloning to assemble them in one step. After quite some testing, we came up with the following protocol:<br />
<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>pTALEN (v2) NG backbone (56 ng)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>CMV promoter (17 ng)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Post ORF (17,5 ng)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;11,5</td> <br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>BsaI (15 U)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>T4 Ligase buffer</td><td>&#160;2</td><br />
</tr><tr><br />
<td>Total</td><td>&#160;20</td> <br />
</tr></table></html><br />
<br />
<br />
<html><br />
<table align=right border=0 style="margin-right:150px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20 °C, 5 min</td><br />
</tr><tr><br />
<td>go to 1. 50 times</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
<br />
:So we assembled the whole MammoBrick vector in one single reaction:<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:150px"/></html><br />
<br />
<br><br><br />
<b>Step 2: Eukaryotic TALE expression vector:</b><br><br><br />
<br />
Once the MammoBrick was ready, we inserted the TAL open reading frame and thereby evaluated, how easy it would be for future iGEM students to expression any desired ORF in eukaryotic cells.<br><br><br />
<br />
:'''Designing the TAL open reading frame:'''<br><br />
:For this purpose, we designed a TAL ORF by adding the following modifications to the TAL open reading frame in pTALEN (v2) NG:<br><br><br />
:1. We removed all EcoRI, XbaI, SpeI, PstI, BsmBI, BbsI and PmeI restriction sites.<br><br />
:2. We replaced the BsaI restriction sites for inserting direpeats by BsmBI sites, because – according to the manufacturer - BsmBI is better suited for digest over one hour.<br><br />
:3. We added a consensus RBS in front of the ORF for expression in bacteria<br><br />
:4. We added a His-Tag to the n-terminal end to allow protein purification.<br><br />
:5. We flanked the whole sequence with the iGEM prefix and suffix.<br><br />
:6. Most importantly, we replaced the FokI nuclease at the C-terminal end of the protein by one of our inventions: The Plug and Play Effector Cassette.<br />
:This whole construct was synthesized by IDT.<br><br />
:'''Plug and Play Effecor Cassette:''' Our project was designed to enable future iGEM teams to easily use the powerful TALE technology. On top of that, we wanted to built a TALE platform which allows iGEM students to develop their own TAL constructs. We therefore invented the easy-to-use '''P'''lug and '''P'''lay '''E'''ffector '''C'''assette ('''PPEC'''), which can be used to fuse BioBricks, that are in the [[Team:Freiburg/Project/Golden|Golden Gate standard]], to the c-terminus of the TAL protein. <br><br />
[[File:Figure7_2.png|center|500px|link=]]<br><br />
:The PPEC consists of two BbsI binding sites that point in opposite directions. Digestion with BbsI leads to removal of the PPEC and to the formation of sticky ends at which the upstream sticky end (GGCA) is the last 4 nucleotides of the TAL protein and the downstream sticky end (TAAA) contains the stop codon. When an equimolar amount of the effector containing plasmid (flanked also by BbsI sites and the same overlaps) is added to the GGC mix, the effector is cut out of the iGEM vector and ligated into the eukaryotic TAL expression vector in-frame and without a scar. We have optimized this reaction by systematically testing different reaction buffers and thermocycler programs and came up with the following protocol:<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;11,5</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts</td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20 °C, 5 min</td><br />
</tr><tr><br />
<td>go back to 1. 20 times</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 80°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br><br><br><br><br><br></html><br />
<br />
:But even Golden Gate cloning is not 100 % efficient. In order to remove those plasmids that did not take up a vector insert, we added the restriction site of the blunt end cutter PmeI (MssI) to the PPEC. We chose PmeI because it has a 8 bp binding site, which is very unlikely to occur in the gene of an effector that you would like to fuse with the TAL gene.<br />
:So after performing the Golden Gate reaction described above, we digested with MssI fast digest (fermentas) according to the following protocol:<br />
<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>GGC-Product</td><td>&#160;10</td><br />
</tr><tr><br />
<td>PmeI/MssI FastDigest</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Fast Digest Buffer (10x)</td><td>&#160;1,5</td> <br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;2,5</td><br />
</tr><tr><br />
<td>Total</td><td>&#160;15</td> <br />
</tr></table><br />
<br />
<br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 1h</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80 °C, 20 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br><br></html><br />
<br />
:This linearizes all vectors that do not contain the effector (at least, we do not see colonies on the negative control plate). To be sure, these linearized vectors do not religate, perform the following digest with T5 exonuclease, which specifically removes linearized DNA:<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Product of PmeI digest</td><td>&#160;7,5</td><br />
</tr><tr><br />
<td>T5 Exonuclease</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Total</td><td>&#160;8,5</td> <br />
</tr></table><br />
<br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 1h</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80 °C, 20 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br />
</html><br />
:The efficiency of our own little invention – the PPEC – actually surprised us a little bit, for details, see the [[#Team:Freiburg/Project/Experiments|results section]].<br><br><br />
<br />
:'''Insertion of the TAL ORF into the MammoBrick vector:'''<br><br><br />
:Since we wanted to put the TAL ORF under the control of the CMV promoter, we digested both the MammoBrick vector (with SpeI and PstI) and the TAL ORF (with XbaI and PstI), ligated them and transformed into a ccdB-cassette resistant E.coli strain. The resulting clones were verified by sequencing and contained the eukaryotic TAL expression vector:<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/3/3b/Figure8T.png" width="450px" style="margin-left:150px"/><br><br></html><br />
<br />
:'''Prokaryotic TAL expression vector:'''<br><br />
:Although for the most part, TAL effectors have been used in eukaryotic organisms, we wanted to enable future iGEM teams to also use this exciting technology in bacteria. So we used BioBrick assembly to construct the following protein generator using TAL ORF, Part:BBa_J04500 (IPTG inducible promoter with RBS) and BBa_B0015 (double terminator):<br />
<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/d/d6/Figure9T.png" width="450px" style="margin-left:150px"/></html><br />
<br />
<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/VektorTeam:Freiburg/Project/Vektor2012-10-26T23:35:53Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Creating the TAL Mammobrick vector =<br />
----<br />
<br />
<br />
<br />
== Introduction: ==<br />
<html><br />
<div align="justify">In nature, TALEs are injected into the host cells by plant pathogenic bacteria in order to modulate their gene expression. From the synthetic biologist’s point of view, this is very convenient because it implies that TALEs can be expressed in bacteria but also function in a eukaryotic system. We therefore provide plasmids for expression in either human cell lines or in bacteria.<br><br></html><br />
<br />
== Eukaryotic expression vector: ==<br />
----<br />
<br><br />
<br />
<div align="justify">Since we wanted to express our TAL effectors in Human Embryonic Kidney (HEK) cells, we needed a eukaryotic expression vector. Unfortunately, the registry does not offer such a vector, so we decided to build one our own. In order to avoid intellectual property rights violations, we ordered the vector pTALEN (v2) NG (along with the Zhang Lab TALE Toolbox) from the open source plasmid repository [http://www.addgene.org/ Addgene]. The Zhang Lab at MIT has constructed this plasmid for TAL effector expression, so we decided that it would be a good template for our own vector. Converting pTALEN (v2) NG into a RFC10 compatible vector would have taken more mutagenesis PCRs than we would have been able to perform over the summer, so we chose the following two-step vector assembly strategy:</div><br><br><br />
<b>Step 1: Mammobrick</b><br />
<br><br><br />
In the first step, we wanted to built a universal mammalian expression vector (called MammoBrick), which would allows future iGEM students to express any gene in human cell lines simply by cloning the open reading frame into the MammoBrick using the BioBrick assembly protocol. We assembled the MammoBrick from the following four parts, essentially, using the protocol described [[Team:Freiburg/Project/Golden#GGC|here]]:<br><br><br />
:Part 1: '''BACKBONE''' <br>We have cut the backbone out of pTALEN (v2) NG with Ngo MIV and AfiII and purified the corresponding 2234bp band from a gel. Since both enzymes produce 5’ overhangs, they were compatible with overhangs produced by BsaI digestion. This backbone contains a SV 40 polyadenylation signal, an ampicillin resistance gene and an origin of replication.<br><br><br />
:Part2: '''CMV promoter'''<br>At first, we tried to use the CMV promotor that was included in the 2012 distribution kit. Part BBa_J52034 was submitted to the registry by Team Slovenia in 2006 and has been on the distribution kit since then (although sequencing was inconsistent every year). After numerous attempts to use this part, we sequenced it and found out that it was not a CMV promotor, but a part of the lacI gene. Reading the part’s review, we noticed that Team Munich 2010 had already pointed out that it was a lacI fragment. Interestingly, Team DTU Denmark was able to induce fluorescent protein expression with this bacterial gene fragment- magic. Since no other mammalian promoter was available on this year’s distribution kit, we designed the following primers and amplified the CMV promoter from the vector pPhi-Yellow-C:<br><br><br />
::::GTTACCGGTCTCGTTAAGAATTCGCGGCCGCTTCTAGAGATAGTAATCAATTACGGGGTC<br><br />
::::CTAGAGGTCTCGCTGCCTGCAGCGGCCGCTACTAGTAGATCTGACGGTTCACTAAAC<br><br><br />
:After amplifying the CMV promoter with these primers, the promoter is not only flanked by the iGEM prefix and suffix, but also by distal BsaI restriction sites. This way, we were able to directly assemble the PCR product with the other MammoBrick parts.<br><br><br />
:Part 3: '''PuroORF''' <br>We replaced the hygromycin resistance gene in pTALEN (v2) NG for two reasons: Firstly, it contained multiple iGEM restriction sites and secondly, selection via hygromycin takes much longer than selection with puromycin. Since we also didn’t find a puromycin ORF without illegal restriction sites, we decided to make silent mutations in the PuroORF to remove these sites and get it synthesized, flanked by BsaI restriction sites and appropriate overlaps for subsequent Golden Gate cloning.<br><br><br />
:Part 4: '''PostORF''' <br>We called the region between the stop codon of the TAL ORF and the start codon of the antibiotic resistance gene PostORF. We wanted to use this part in our vector because it contains the SV40 promoter and enhancer for expression of the antibiotic selection marker. So we used PCR to “excise the fragment and add BsaI sites and appropriate overlaps to it.<br><br><br />
:After every single part had been purified, we used Golden Gate cloning to assemble them in one step. After quite some testing, we came up with the following protocol:<br />
<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>pTALEN (v2) NG backbone (56 ng)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>CMV promoter (17 ng)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Post ORF (17,5 ng)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;11,5</td> <br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>BsaI (15 U)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>T4 Ligase buffer</td><td>&#160;2</td><br />
</tr><tr><br />
<td>Total</td><td>&#160;20</td> <br />
</tr></table></html><br />
<br />
<br />
<html><br />
<table align=right border=0 style="margin-right:150px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20 °C, 5 min</td><br />
</tr><tr><br />
<td>go to 1. 50 times</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
<br />
:So we assembled the whole MammoBrick vector in one single reaction:<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:150px"/></html><br />
<br />
<br><br><br />
<b>Step 2: Eukaryotic TALE expression vector:</b><br><br><br />
<br />
Once the MammoBrick was ready, we inserted the TAL open reading frame and thereby evaluated, how easy it would be for future iGEM students to expression any desired ORF in eukaryotic cells.<br><br><br />
<br />
:'''Designing the TAL open reading frame:'''<br><br />
:For this purpose, we designed a TAL ORF by adding the following modifications to the TAL open reading frame in pTALEN (v2) NG:<br><br><br />
:1. We removed all EcoRI, XbaI, SpeI, PstI, BsmBI, BbsI and PmeI restriction sites.<br><br />
:2. We replaced the BsaI restriction sites for inserting direpeats by BsmBI sites, because – according to the manufacturer - BsmBI is better suited for digest over one hour.<br><br />
:3. We added a consensus RBS in front of the ORF for expression in bacteria<br><br />
:4. We added a His-Tag to the n-terminal end to allow protein purification.<br><br />
:5. We flanked the whole sequence with the iGEM prefix and suffix.<br><br />
:6. Most importantly, we replaced the FokI nuclease at the C-terminal end of the protein by one of our inventions: The Plug and Play Effector Cassette.<br />
:This whole construct was synthesized by IDT.<br><br />
:'''Plug and Play Effecor Cassette:''' Our project was designed to enable future iGEM teams to easily use the powerful TALE technology. On top of that, we wanted to built a TALE platform which allows iGEM students to develop their own TAL constructs. We therefore invented the easy-to-use '''P'''lug and '''P'''lay '''E'''ffector '''C'''assette ('''PPEC'''), which can be used to fuse BioBricks, that are in the [[Team:Freiburg/Project/Golden|Golden Gate standard]], to the c-terminus of the TAL protein. The PPEC <br><br><br />
[[File:Figure7_2.png|center|500px|link=]]<br><br><br />
:consists of two BbsI binding sites that point in opposite directions. Digestion with BbsI leads to removal of the PPEC and to the formation of sticky ends at which the upstream sticky end (GGCA) is the last 4 nucleotides of the TAL protein and the downstream sticky end (TAAA) contains the stop codon. When an equimolar amount of the effector containing plasmid (flanked also by BbsI sites and the same overlaps) is added to the GGC mix, the effector is cut out of the iGEM vector and ligated into the eukaryotic TAL expression vector in-frame and without a scar. We have optimized this reaction by systematically testing different reaction buffers and thermocycler programs and came up with the following protocol:<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;11,5</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts</td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20 °C, 5 min</td><br />
</tr><tr><br />
<td>go back to 1. 20 times</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 80°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br><br><br><br><br><br></html><br />
<br />
:But even Golden Gate cloning is not 100 % efficient. In order to remove those plasmids that did not take up a vector insert, we added the restriction site of the blunt end cutter PmeI (MssI) to the PPEC. We chose PmeI because it has a 8 bp binding site, which is very unlikely to occur in the gene of an effector that you would like to fuse with the TAL gene.<br />
:So after performing the Golden Gate reaction described above, we digested with MssI fast digest (fermentas) according to the following protocol:<br />
<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>GGC-Product</td><td>&#160;10</td><br />
</tr><tr><br />
<td>PmeI/MssI FastDigest</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Fast Digest Buffer (10x)</td><td>&#160;1,5</td> <br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;2,5</td><br />
</tr><tr><br />
<td>Total</td><td>&#160;15</td> <br />
</tr></table><br />
<br />
<br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 1h</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80 °C, 20 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br><br></html><br />
<br />
:This linearizes all vectors that do not contain the effector (at least, we do not see colonies on the negative control plate). To be sure, these linearized vectors do not religate, perform the following digest with T5 exonuclease, which specifically removes linearized DNA:<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Product of PmeI digest</td><td>&#160;7,5</td><br />
</tr><tr><br />
<td>T5 Exonuclease</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Total</td><td>&#160;8,5</td> <br />
</tr></table><br />
<br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 1h</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80 °C, 20 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br />
</html><br />
:The efficiency of our own little invention – the PPEC – actually surprised us a little bit, for details, see the [[#Team:Freiburg/Project/Experiments|results section]].<br><br><br />
<br />
:'''Insertion of the TAL ORF into the MammoBrick vector:'''<br><br><br />
:Since we wanted to put the TAL ORF under the control of the CMV promoter, we digested both the MammoBrick vector (with SpeI and PstI) and the TAL ORF (with XbaI and PstI), ligated them and transformed into a ccdB-cassette resistant E.coli strain. The resulting clones were verified by sequencing and contained the eukaryotic TAL expression vector:<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/3/3b/Figure8T.png" width="450px" style="margin-left:150px"/><br><br></html><br />
<br />
:'''Prokaryotic TAL expression vector:'''<br><br />
:Although for the most part, TAL effectors have been used in eukaryotic organisms, we wanted to enable future iGEM teams to also use this exciting technology in bacteria. So we used BioBrick assembly to construct the following protein generator using TAL ORF, Part:BBa_J04500 (IPTG inducible promoter with RBS) and BBa_B0015 (double terminator):<br />
<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/d/d6/Figure9T.png" width="450px" style="margin-left:150px"/></html><br />
<br />
<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-26T23:25:23Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with existing standards. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized and simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless they are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning<sup>1</sup> (or its derivatives MoClo<sup>2</sup> and GoldenBraid<sup>3</sup>). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction. Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
In conventional cloning, restriction enzymes bind to and cut at the exact same spot. Consequently, one conventional restriction enzyme only produces one type of sticky ends. That is the reason why in conventional cloning, only two DNA parts can be assembled in one step. Golden Gate Cloning overcomes this restriction by exploiting the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Thus, these enzymes are capable of producing multiple sticky ends at different DNA fragments in one reaction. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effector expression vectors from six different parts – all in one reaction.<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
<div font-size:15xp>'''Strategy 1'''</div><br><br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC10 standard restriction sites. We actually built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and successfully applied both RFC10 or "Golden Gate standard".<br />
We therefore propose the following Protocol:<br><br><br />
<br />
<br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector. We usually had no colonies on our negative control plate after ligation with T4 ligase and transformation into DH10B cells.<br><br />
<br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 50 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2'''<br><br><br />
The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:'''Step 2:''' Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
::In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
:::1. Use the first 4 bp of the downstream part as overlap.<br><br />
:::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
::Usually, you should be able to define your overlaps now.<br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX + first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG + reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described in strategy 1.<br><br><br />
<br />
We used this approach to built the BioBricks for assembling multiple protein domains of our TAL proteins in one single reaction without forming scars. <br><br><br><br />
<br />
== References ==<br />
----<br />
<br><html><br />
1. Engler, C., Gruetzner, R., Kandzia, R. & Marillonnet, S. Golden Gate Shuffling: A One-Pot DNA Shuffling Method Based on Type IIs Restriction Enzymes. PLoS ONE 4, e5553 (2009).<br><br />
2. Werner, S., Engler, C., Weber, E., Gruetzner, R. & Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs 3, 38–43 (2012).<br><br />
3. Sarrion-Perdigones, A. et al. GoldenBraid: An Iterative Cloning System for Standardized Assembly of Reusable Genetic Modules. PLoS ONE 6, e21622 (2011).<br />
</html><br><br />
<br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/VektorTeam:Freiburg/Project/Vektor2012-10-26T23:21:32Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Creating the TAL Mammobrick vector =<br />
----<br />
<br />
<br />
<br />
== Introduction: ==<br />
<html><br />
<div align="justify">In nature, TALEs are injected into the host cells by plant pathogenic bacteria in order to modulate their gene expression. From the synthetic biologist’s point of view, this is very convenient because it implies that TALEs can be expressed in bacteria but also function in a eukaryotic system. We therefore provide plasmids for expression in either human cell lines or in bacteria.<br><br></html><br />
<br />
== Eukaryotic expression vector: ==<br />
----<br />
<br><br />
<br />
<div align="justify">Since we wanted to express our TAL effectors in Human Embryonic Kidney (HEK) cells, we needed a eukaryotic expression vector. Unfortunately, the registry does not offer such a vector, so we decided to build one our own. In order to avoid intellectual property rights violations, we ordered the vector pTALEN (v2) NG (along with the Zhang Lab TALE Toolbox) from the open source plasmid repository [http://www.addgene.org/ Addgene]. The Zhang Lab at MIT has constructed this plasmid for TAL effector expression, so we decided that it would be a good template for our own vector. Converting pTALEN (v2) NG into a RFC10 compatible vector would have taken more mutagenesis PCRs than we would have been able to perform over the summer, so we chose the following two-step vector assembly strategy:</div><br><br><br />
<b>Step 1: Mammobrick</b><br />
<br><br><br />
In the first step, we wanted to built a universal mammalian expression vector (called MammoBrick), which would allows future iGEM students to express any gene in human cell lines simply by cloning the open reading frame into the MammoBrick using the BioBrick assembly protocol. We assembled the MammoBrick from the following four parts, essentially, using the protocol described [[Team:Freiburg/Project/Golden#GGC|here]]:<br><br><br />
:Part 1: '''BACKBONE''' <br>We have cut the backbone out of pTALEN (v2) NG with Ngo MIV and AfiII and purified the corresponding 2234bp band from a gel. Since both enzymes produce 5’ overhangs, they were compatible with overhangs produced by BsaI digestion. This backbone contains a SV 40 polyadenylation signal, an ampicillin resistance gene and an origin of replication.<br><br><br />
:Part2: '''CMV promoter'''<br>At first, we tried to use the CMV promotor that was included in the 2012 distribution kit. Part BBa_J52034 was submitted to the registry by Team Slovenia in 2006 and has been on the distribution kit since then (although sequencing was inconsistent every year). After numerous attempts to use this part, we sequenced it and found out that it was not a CMV promotor, but a part of the lacI gene. Reading the part’s review, we noticed that Team Munich 2010 had already pointed out that it was a lacI fragment. Interestingly, Team DTU Denmark was able to induce fluorescent protein expression with this bacterial gene fragment- magic. Since no other mammalian promoter was available on this year’s distribution kit, we designed the following primers and amplified the CMV promoter from the vector pPhi-Yellow-C:<br><br><br />
::::GTTACCGGTCTCGTTAAGAATTCGCGGCCGCTTCTAGAGATAGTAATCAATTACGGGGTC<br><br />
::::CTAGAGGTCTCGCTGCCTGCAGCGGCCGCTACTAGTAGATCTGACGGTTCACTAAAC<br><br><br />
:After amplifying the CMV promoter with these primers, the promoter is not only flanked by the iGEM prefix and suffix, but also by distal BsaI restriction sites. This way, we were able to directly assemble the PCR product with the other MammoBrick parts.<br><br><br />
:Part 3: '''PuroORF''' <br>We replaced the hygromycin resistance gene in pTALEN (v2) NG for two reasons: Firstly, it contained multiple iGEM restriction sites and secondly, selection via hygromycin takes much longer than selection with puromycin. Since we also didn’t find a puromycin ORF without illegal restriction sites, we decided to make silent mutations in the PuroORF to remove these sites and get it synthesized, flanked by BsaI restriction sites and appropriate overlaps for subsequent Golden Gate cloning.<br><br><br />
:Part 4: '''PostORF''' <br>We called the region between the stop codon of the TAL ORF and the start codon of the antibiotic resistance gene PostORF. We wanted to use this part in our vector because it contains the SV40 promoter and enhancer for expression of the antibiotic selection marker. So we used PCR to “excise the fragment and add BsaI sites and appropriate overlaps to it.<br><br><br />
:After every single part had been purified, we used Golden Gate cloning to assemble them in one step. After quite some testing, we came up with the following protocol:<br />
<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>pTALEN (v2) NG backbone (56 ng)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>CMV promoter (17 ng)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Post ORF (17,5 ng)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;11,5</td> <br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>BsaI (15 U)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>T4 Ligase buffer</td><td>&#160;2</td><br />
</tr><tr><br />
<td>Total</td><td>&#160;20</td> <br />
</tr></table></html><br />
<br />
<br />
<html><br />
<table align=right border=0 style="margin-right:150px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20 °C, 5 min</td><br />
</tr><tr><br />
<td>go to 1. 50 times</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
<br />
:So we assembled the whole MammoBrick vector in one single reaction:<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:150px"/></html><br />
<br />
<br><br><br />
<b>Step 2: Eukaryotic TALE expression vector:</b><br><br><br />
<br />
Once the MammoBrick was ready, we inserted the TAL open reading frame and thereby evaluated, how easy it would be for future iGEM students to expression any desired ORF in eukaryotic cells.<br><br><br />
<br />
:'''Designing the TAL open reading frame:'''<br><br />
:For this purpose, we designed a TAL ORF by adding the following modifications to the TAL open reading frame in pTALEN (v2) NG:<br><br><br />
:1. We removed all EcoRI, XbaI, SpeI, PstI, BsmBI, BbsI and PmeI restriction sites.<br><br />
:2. We replaced the BsaI restriction sites for inserting direpeats by BsmBI sites, because – according to the manufacturer - BsmBI is better suited for digest over one hour.<br><br />
:3. We added a consensus RBS in front of the ORF for expression in bacteria<br><br />
:4. We added a His-Tag to the n-terminal end to allow protein purification.<br><br />
:5. We flanked the whole sequence with the iGEM prefix and suffix.<br><br />
:6. Most importantly, we replaced the FokI nuclease at the C-terminal end of the protein by one of our inventions: The Plug and Play Effector Cassette.<br />
:This whole construct was synthesized by IDT.<br><br><br />
<br />
<br />
:'''Plug and Play Effecor Cassette:''' Our project was designed to enable future iGEM teams to easily use the powerful TALE technology. On top of that, we wanted to built a TALE platform which allows iGEM students to freely develop their own TAL constructs. We therefore invented the easy-to-use '''P'''lug and '''P'''lay '''E'''ffector '''C'''assette ('''PPEC'''), which can be used to fuse BioBricks, that are in the [[Team:Freiburg/Project/Golden|Golden Gate standard]], to the c-terminus of the TAL protein. The PPEC <br><br><br />
[[File:Figure7_2.png|center|500px|link=]]<br><br><br />
:consists of two BbsI binding sites that point in opposite directions. Digestion with BbsI leads to removal of the PPEC and to the formation of sticky ends at which the upstream sticky end (GGCA) are the last 4 nucleotides of the tal protein and the downstream sticky end (TAAA) contains the stop codon. When an equimolar amount of the effector containing plasmid (flanked also by BbsI sites and the same overlaps) is added to the GGC mix, the effector is cut out of the iGEM vector and ligated into the eukaryotic TAL expression vector in-frame and without a scar. We have optimized this reaction by systematically testing different reaction buffers and thermocycler programs and came up with the following protocol:<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;11,5</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts</td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20 °C, 5 min</td><br />
</tr><tr><br />
<td>go back to 1. 20 times</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 80°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br><br><br><br><br><br></html><br />
<br />
:But even Golden Gate cloning is not 100 % efficient. In order to remove those plasmids that did not take up a vector insert, we added the restriction site of the blunt end cutter PmeI (MssI) to the PPEC. We chose PmeI because it has a 8 bp binding site, which is very unlikely to occur in the gene of an effector that you would like to fuse with the TAL gene.<br />
:So after performing the Golden Gate reaction described above, we digested with MssI fast digest (fermentas) according to the following protocol:<br />
<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>GGC-Product</td><td>&#160;10</td><br />
</tr><tr><br />
<td>PmeI/MssI FastDigest</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Fast Digest Buffer (10x)</td><td>&#160;1,5</td> <br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;2,5</td><br />
</tr><tr><br />
<td>Total</td><td>&#160;15</td> <br />
</tr></table><br />
<br />
<br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 1h</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80 °C, 20 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br><br></html><br />
<br />
:This linearizes all vectors that do not contain the effector (at least, we do not see colonies on the negative control plate). To be sure, these linearized vectors do not religate, perform the following digest with T5 exonuclease, which specifically removes linearized DNA:<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Product of PmeI digest</td><td>&#160;7,5</td><br />
</tr><tr><br />
<td>T5 Exonuclease</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Total</td><td>&#160;8,5</td> <br />
</tr></table><br />
<br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 1h</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80 °C, 20 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br />
</html><br />
:The efficiency of our own little invention – the PPEC – actually surprised us a little bit, for details, see the [[#Team:Freiburg/Project/Experiments|results section]].<br><br><br />
<br />
:'''Insertion of the TAL ORF into the MammoBrick vector:'''<br><br><br />
:Since we wanted to put the TAL ORF under the control of the CMV promoter, we digested both the MammoBrick vector (with SpeI and PstI) and the TAL ORF (with XbaI and PstI), ligated them and transformed into a ccdB-cassette resistant E.coli strain. The resulting clones were verified by sequencing and contained the eukaryotic TAL expression vector:<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/3/3b/Figure8T.png" width="450px" style="margin-left:150px"/><br><br></html><br />
<br />
:'''Prokaryotic TAL expression vector:'''<br><br />
:Although for the most part, TAL effectors have been used in eukaryotic organisms, we wanted to enable future iGEM teams to also use this exciting technology in bacteria. So we used BioBrick assembly to construct the following protein generator using TAL ORF, Part:BBa_J04500 (IPTG inducible promoter with RBS) and BBa_B0015 (double terminator):<br />
<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/d/d6/Figure9T.png" width="450px" style="margin-left:150px"/></html><br />
<br />
<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/VektorTeam:Freiburg/Project/Vektor2012-10-26T23:19:08Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Creating the TAL Mammobrick vector =<br />
----<br />
<br />
<br />
<br />
== Introduction: ==<br />
<html><br />
<div align="justify">In nature, TALEs are injected into the host cells by plant pathogenic bacteria in order to modulate their gene expression. From the synthetic biologist’s point of view, this is very convenient because it implies that TALEs can be expressed in bacteria but also function in a eukaryotic system. We therefore provide plasmids for expression in either human cell lines or in bacteria.<br><br></html><br />
<br />
== Eukaryotic expression vector: ==<br />
----<br />
<br><br />
<br />
<div align="justify">Since we wanted to express our TAL effectors in Human Embryonic Kidney (HEK) cells, we needed a eukaryotic expression vector. Unfortunately, the registry does not offer such a vector, so we decided to build one our own. In order to avoid intellectual property rights violations, we ordered the vector pTALEN (v2) NG (along with the Zhang Lab TALE Toolbox) from the open source plasmid repository [http://www.addgene.org/ Addgene]. The Zhang Lab at MIT has constructed this plasmid for TAL effector expression, so we decided that it would be a good template for our own vector. Converting pTALEN (v2) NG into a RFC10 compatible vector would have taken more mutagenesis PCRs than we would have been able to perform over the summer, so we chose the following two-step vector assembly strategy:</div><br><br><br />
<b>Step 1: Mammobrick</b><br />
<br><br><br />
In the first step, we wanted to built a universal mammalian expression vector (called MammoBrick), which would allows future iGEM students to express any gene in human cell lines simply by cloning the open reading frame into the MammoBrick using the BioBrick assembly protocol. We assembled the MammoBrick from the following four parts, essentially, using the protocol described [[Team:Freiburg/Project/Golden#GGC|here]]:<br><br><br />
:Part 1: '''BACKBONE''' <br>We have cut the backbone out of pTALEN (v2) NG with Ngo MIV and AfiII and purified the corresponding 2234bp band from a gel. Since both enzymes produce 5’ overhangs, they were compatible with overhangs produced by BsaI digestion. This backbone contains a SV 40 polyadenylation signal, an ampicillin resistance gene and an origin of replication.<br><br><br />
:Part2: '''CMV promoter'''<br>At first, we tried to use the CMV promotor that was included in the 2012 distribution kit. Part BBa_J52034 was submitted to the registry by Team Slovenia in 2006 and has been on the distribution kit since then (although sequencing was inconsistent every year). After numerous attempts to use this part, we sequenced it and found out that it was not a CMV promotor, but a part of the lacI gene. Reading the part’s review, we noticed that Team Munich 2010 had already pointed out that it was a lacI fragment. Interestingly, Team DTU Denmark was able to induce fluorescent protein expression with this bacterial gene fragment- magic. Since no other mammalian promoter was available on this year’s distribution kit, we designed the following primers and amplified the CMV promoter from the vector pPhi-Yellow-C:<br><br><br />
::::GTTACCGGTCTCGTTAAGAATTCGCGGCCGCTTCTAGAGATAGTAATCAATTACGGGGTC<br><br />
::::CTAGAGGTCTCGCTGCCTGCAGCGGCCGCTACTAGTAGATCTGACGGTTCACTAAAC<br><br><br />
:After amplifying the CMV promoter with these primers, the promoter is not only flanked by the iGEM prefix and suffix, but also by distal BsaI restriction sites. This way, we were able to directly assemble the PCR product with the other MammoBrick parts.<br><br><br />
:Part 3: '''PuroORF''' <br>We replaced the hygromycin resistance gene in pTALEN (v2) NG for two reasons: Firstly, it contained multiple iGEM restriction sites and secondly, selection via hygromycin takes much longer than selection with puromycin. Since we also didn’t find a puromycin ORF without illegal restriction sites, we decided to make silent mutations in the PuroORF to remove these sites and get it synthesized, flanked by BsaI restriction sites and appropriate overlaps for subsequent golden gate cloning.<br><br><br />
:Part 4: '''PostORF''' <br>We called the region between the stop codon of the TAL ORF and the start codon of the antibiotic resistance gene PostORF. We wanted to use this part in our vector because it contains the SV40 promoter and enhancer for expression of the antibiotic selection marker. So we used PCR to “excise the fragment and add BsaI sites and appropriate overlaps to it.<br><br><br />
:After every single part had been purified, we used Golden Gate cloning to assemble them in one step. After quite some testing, we came up with the following protocol:<br />
<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>pTALEN (v2) NG backbone (56 ng)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>CMV promoter (17 ng)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Post ORF (17,5 ng)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;11,5</td> <br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>BsaI (15 U)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>T4 Ligase buffer</td><td>&#160;2</td><br />
</tr><tr><br />
<td>Total</td><td>&#160;20</td> <br />
</tr></table></html><br />
<br />
<br />
<html><br />
<table align=right border=0 style="margin-right:150px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20 °C, 5 min</td><br />
</tr><tr><br />
<td>go to 1. 50 times</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
<br />
:So we assembled the whole MammoBrick vector in one single reaction:<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:150px"/></html><br />
<br />
<br><br><br />
<b>Step 2: Eukaryotic TALE expression vector:</b><br><br><br />
<br />
Once the MammoBrick was ready, we inserted the TAL open reading frame and thereby evaluated, how easy it would be for future iGEM students to expression any desired ORF in eukaryotic cells.<br><br><br />
<br />
:'''Designing the TAL open reading frame:'''<br><br />
:For this purpose, we designed a TAL ORF by adding the following modifications to the TAL open reading frame in pTALEN (v2) NG:<br><br><br />
:1. We removed all EcoRI, XbaI, SpeI, PstI, BsmBI, BbsI and PmeI restriction sites.<br><br />
:2. We replaced the BsaI restriction sites for inserting direpeats by BsmBI sites, because – according to the manufacturer - BsmBI is better suited for digest over one hour.<br><br />
:3. We added a consensus RBS in front of the ORF for expression in bacteria<br><br />
:4. We added a His-Tag to the n-terminal end to allow protein purification.<br><br />
:5. We flanked the whole sequence with the iGEM prefix and suffix.<br><br />
:6. Most importantly, we replaced the FokI nuclease at the C-terminal end of the protein by one of our inventions: The Plug and Play Effector Cassette.<br />
:This whole construct was synthesized by IDT.<br><br><br />
<br />
<br />
:'''Plug and Play Effecor Cassette:''' Our project was designed to enable future iGEM teams to easily use the powerful TALE technology. On top of that, we wanted to built a TALE platform which allows iGEM students to freely develop their own TAL constructs. We therefore invented the easy-to-use '''P'''lug and '''P'''lay '''E'''ffector '''C'''assette ('''PPEC'''), which can be used to fuse BioBricks, that are in the [[Team:Freiburg/Project/Golden|Golden Gate standard]], to the c-terminus of the TAL protein. The PPEC <br><br><br />
[[File:Figure7_2.png|center|500px|link=]]<br><br><br />
:consists of two BbsI binding sites that point in opposite directions. Digestion with BbsI leads to removal of the PPEC and to the formation of sticky ends at which the upstream sticky end (GGCA) are the last 4 nucleotides of the tal protein and the downstream sticky end (TAAA) contains the stop codon. When an equimolar amount of the effector containing plasmid (flanked also by BbsI sites and the same overlaps) is added to the GGC mix, the effector is cut out of the iGEM vector and ligated into the eukaryotic TAL expression vector in-frame and without a scar. We have optimized this reaction by systematically testing different reaction buffers and thermocycler programs and came up with the following protocol:<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;11,5</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts</td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20 °C, 5 min</td><br />
</tr><tr><br />
<td>go back to 1. 20 times</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 80°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br><br><br><br><br><br></html><br />
<br />
:But even Golden Gate cloning is not 100 % efficient. In order to remove those plasmids that did not take up a vector insert, we added the restriction site of the blunt end cutter PmeI (MssI) to the PPEC. We chose PmeI because it has a 8 bp binding site, which is very unlikely to occur in the gene of an effector that you would like to fuse with the TAL gene.<br />
:So after performing the Golden Gate reaction described above, we digested with MssI fast digest (fermentas) according to the following protocol:<br />
<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>GGC-Product</td><td>&#160;10</td><br />
</tr><tr><br />
<td>PmeI/MssI FastDigest</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Fast Digest Buffer (10x)</td><td>&#160;1,5</td> <br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;2,5</td><br />
</tr><tr><br />
<td>Total</td><td>&#160;15</td> <br />
</tr></table><br />
<br />
<br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 1h</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80 °C, 20 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br><br></html><br />
<br />
:This linearizes all vectors that do not contain the effector (at least, we do not see colonies on the negative control plate). To be sure, these linearized vectors do not religate, perform the following digest with T5 exonuclease, which specifically removes linearized DNA:<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Product of PmeI digest</td><td>&#160;7,5</td><br />
</tr><tr><br />
<td>T5 Exonuclease</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Total</td><td>&#160;8,5</td> <br />
</tr></table><br />
<br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 1h</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80 °C, 20 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br />
</html><br />
:The efficiency of our own little invention – the PPEC – actually surprised us a little bit, for details, see the [[#Team:Freiburg/Project/Experiments|results section]].<br><br><br />
<br />
:'''Insertion of the TAL ORF into the MammoBrick vector:'''<br><br><br />
:Since we wanted to put the TAL ORF under the control of the CMV promoter, we digested both the MammoBrick vector (with SpeI and PstI) and the TAL ORF (with XbaI and PstI), ligated them and transformed into a ccdB-cassette resistant E.coli strain. The resulting clones were verified by sequencing and contained the eukaryotic TAL expression vector:<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/3/3b/Figure8T.png" width="450px" style="margin-left:150px"/><br><br></html><br />
<br />
:'''Prokaryotic TAL expression vector:'''<br><br />
:Although for the most part, TAL effectors have been used in eukaryotic organisms, we wanted to enable future iGEM teams to also use this exciting technology in bacteria. So we used BioBrick assembly to construct the following protein generator using TAL ORF, Part:BBa_J04500 (IPTG inducible promoter with RBS) and BBa_B0015 (double terminator):<br />
<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/d/d6/Figure9T.png" width="450px" style="margin-left:150px"/></html><br />
<br />
<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherdhttp://2012.igem.org/Team:Freiburg/Project/VektorTeam:Freiburg/Project/Vektor2012-10-26T23:18:46Z<p>Shepherd: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Creating the TAL Mammobrick vector =<br />
----<br />
<br />
<br />
<br />
== Introduction: ==<br />
<html><br />
<div align="justify">In nature, TALEs are injected into the host cells by plant pathogenic bacteria in order to modulate their gene expression. From the synthetic biologist’s point of view, this is very convenient because it implies that TALEs can be expressed in bacteria but also function in a eukaryotic system. We therefore provide plasmids for expression in either human cell lines or in bacteria.<br><br></html><br />
<br />
== Eukaryotic expression vector: ==<br />
----<br />
<br><br />
<br />
<div align="justify">Since we wanted to express our TAL effectors in Human Embryonic Kidney (HEK) cells, we needed a eukaryotic expression vector. Unfortunately, the registry does not offer such a vector, so we decided to build one our own. In order to avoid intellectual property rights violations, we ordered the vector pTALEN (v2) NG (along with the Zhang Lab TALE Toolbox) from the open source plasmid repository [http://www.addgene.org/ Addgene]. The Zhang Lab at MIT has constructed this plasmid for TAL effector expression, so we decided that it would be a good template for our own vector. Converting pTALEN (v2) NG into a RFC 10 compatible vector would have taken more mutagenesis PCRs than we would have been able to perform over the summer, so we chose the following two-step vector assembly strategy:</div><br><br><br />
<b>Step 1: Mammobrick</b><br />
<br><br><br />
In the first step, we wanted to built a universal mammalian expression vector (called MammoBrick), which would allows future iGEM students to express any gene in human cell lines simply by cloning the open reading frame into the MammoBrick using the BioBrick assembly protocol. We assembled the MammoBrick from the following four parts, essentially, using the protocol described [[Team:Freiburg/Project/Golden#GGC|here]]:<br><br><br />
:Part 1: '''BACKBONE''' <br>We have cut the backbone out of pTALEN (v2) NG with Ngo MIV and AfiII and purified the corresponding 2234bp band from a gel. Since both enzymes produce 5’ overhangs, they were compatible with overhangs produced by BsaI digestion. This backbone contains a SV 40 polyadenylation signal, an ampicillin resistance gene and an origin of replication.<br><br><br />
:Part2: '''CMV promoter'''<br>At first, we tried to use the CMV promotor that was included in the 2012 distribution kit. Part BBa_J52034 was submitted to the registry by Team Slovenia in 2006 and has been on the distribution kit since then (although sequencing was inconsistent every year). After numerous attempts to use this part, we sequenced it and found out that it was not a CMV promotor, but a part of the lacI gene. Reading the part’s review, we noticed that Team Munich 2010 had already pointed out that it was a lacI fragment. Interestingly, Team DTU Denmark was able to induce fluorescent protein expression with this bacterial gene fragment- magic. Since no other mammalian promoter was available on this year’s distribution kit, we designed the following primers and amplified the CMV promoter from the vector pPhi-Yellow-C:<br><br><br />
::::GTTACCGGTCTCGTTAAGAATTCGCGGCCGCTTCTAGAGATAGTAATCAATTACGGGGTC<br><br />
::::CTAGAGGTCTCGCTGCCTGCAGCGGCCGCTACTAGTAGATCTGACGGTTCACTAAAC<br><br><br />
:After amplifying the CMV promoter with these primers, the promoter is not only flanked by the iGEM prefix and suffix, but also by distal BsaI restriction sites. This way, we were able to directly assemble the PCR product with the other MammoBrick parts.<br><br><br />
:Part 3: '''PuroORF''' <br>We replaced the hygromycin resistance gene in pTALEN (v2) NG for two reasons: Firstly, it contained multiple iGEM restriction sites and secondly, selection via hygromycin takes much longer than selection with puromycin. Since we also didn’t find a puromycin ORF without illegal restriction sites, we decided to make silent mutations in the PuroORF to remove these sites and get it synthesized, flanked by BsaI restriction sites and appropriate overlaps for subsequent golden gate cloning.<br><br><br />
:Part 4: '''PostORF''' <br>We called the region between the stop codon of the TAL ORF and the start codon of the antibiotic resistance gene PostORF. We wanted to use this part in our vector because it contains the SV40 promoter and enhancer for expression of the antibiotic selection marker. So we used PCR to “excise the fragment and add BsaI sites and appropriate overlaps to it.<br><br><br />
:After every single part had been purified, we used Golden Gate cloning to assemble them in one step. After quite some testing, we came up with the following protocol:<br />
<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>pTALEN (v2) NG backbone (56 ng)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>CMV promoter (17 ng)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Post ORF (17,5 ng)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;11,5</td> <br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>BsaI (15 U)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>T4 Ligase buffer</td><td>&#160;2</td><br />
</tr><tr><br />
<td>Total</td><td>&#160;20</td> <br />
</tr></table></html><br />
<br />
<br />
<html><br />
<table align=right border=0 style="margin-right:150px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20 °C, 5 min</td><br />
</tr><tr><br />
<td>go to 1. 50 times</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
<br />
:So we assembled the whole MammoBrick vector in one single reaction:<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:150px"/></html><br />
<br />
<br><br><br />
<b>Step 2: Eukaryotic TALE expression vector:</b><br><br><br />
<br />
Once the MammoBrick was ready, we inserted the TAL open reading frame and thereby evaluated, how easy it would be for future iGEM students to expression any desired ORF in eukaryotic cells.<br><br><br />
<br />
:'''Designing the TAL open reading frame:'''<br><br />
:For this purpose, we designed a TAL ORF by adding the following modifications to the TAL open reading frame in pTALEN (v2) NG:<br><br><br />
:1. We removed all EcoRI, XbaI, SpeI, PstI, BsmBI, BbsI and PmeI restriction sites.<br><br />
:2. We replaced the BsaI restriction sites for inserting direpeats by BsmBI sites, because – according to the manufacturer - BsmBI is better suited for digest over one hour.<br><br />
:3. We added a consensus RBS in front of the ORF for expression in bacteria<br><br />
:4. We added a His-Tag to the n-terminal end to allow protein purification.<br><br />
:5. We flanked the whole sequence with the iGEM prefix and suffix.<br><br />
:6. Most importantly, we replaced the FokI nuclease at the C-terminal end of the protein by one of our inventions: The Plug and Play Effector Cassette.<br />
:This whole construct was synthesized by IDT.<br><br><br />
<br />
<br />
:'''Plug and Play Effecor Cassette:''' Our project was designed to enable future iGEM teams to easily use the powerful TALE technology. On top of that, we wanted to built a TALE platform which allows iGEM students to freely develop their own TAL constructs. We therefore invented the easy-to-use '''P'''lug and '''P'''lay '''E'''ffector '''C'''assette ('''PPEC'''), which can be used to fuse BioBricks, that are in the [[Team:Freiburg/Project/Golden|Golden Gate standard]], to the c-terminus of the TAL protein. The PPEC <br><br><br />
[[File:Figure7_2.png|center|500px|link=]]<br><br><br />
:consists of two BbsI binding sites that point in opposite directions. Digestion with BbsI leads to removal of the PPEC and to the formation of sticky ends at which the upstream sticky end (GGCA) are the last 4 nucleotides of the tal protein and the downstream sticky end (TAAA) contains the stop codon. When an equimolar amount of the effector containing plasmid (flanked also by BbsI sites and the same overlaps) is added to the GGC mix, the effector is cut out of the iGEM vector and ligated into the eukaryotic TAL expression vector in-frame and without a scar. We have optimized this reaction by systematically testing different reaction buffers and thermocycler programs and came up with the following protocol:<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;11,5</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts</td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20 °C, 5 min</td><br />
</tr><tr><br />
<td>go back to 1. 20 times</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 80°C, 10 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br><br><br><br><br><br></html><br />
<br />
:But even Golden Gate cloning is not 100 % efficient. In order to remove those plasmids that did not take up a vector insert, we added the restriction site of the blunt end cutter PmeI (MssI) to the PPEC. We chose PmeI because it has a 8 bp binding site, which is very unlikely to occur in the gene of an effector that you would like to fuse with the TAL gene.<br />
:So after performing the Golden Gate reaction described above, we digested with MssI fast digest (fermentas) according to the following protocol:<br />
<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>GGC-Product</td><td>&#160;10</td><br />
</tr><tr><br />
<td>PmeI/MssI FastDigest</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Fast Digest Buffer (10x)</td><td>&#160;1,5</td> <br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;2,5</td><br />
</tr><tr><br />
<td>Total</td><td>&#160;15</td> <br />
</tr></table><br />
<br />
<br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 1h</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80 °C, 20 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br><br></html><br />
<br />
:This linearizes all vectors that do not contain the effector (at least, we do not see colonies on the negative control plate). To be sure, these linearized vectors do not religate, perform the following digest with T5 exonuclease, which specifically removes linearized DNA:<br><br><br />
<br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Product of PmeI digest</td><td>&#160;7,5</td><br />
</tr><tr><br />
<td>T5 Exonuclease</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>Total</td><td>&#160;8,5</td> <br />
</tr></table><br />
<br />
<table align=right border=0 style="margin-right:100px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 1h</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80 °C, 20 min</td><br />
</tr><tr><br />
<td>5. &#160; &#160; 4°C, ∞</td><br />
</tr></table><br><br><br><br><br><br><br />
</html><br />
:The efficiency of our own little invention – the PPEC – actually surprised us a little bit, for details, see the [[#Team:Freiburg/Project/Experiments|results section]].<br><br><br />
<br />
:'''Insertion of the TAL ORF into the MammoBrick vector:'''<br><br><br />
:Since we wanted to put the TAL ORF under the control of the CMV promoter, we digested both the MammoBrick vector (with SpeI and PstI) and the TAL ORF (with XbaI and PstI), ligated them and transformed into a ccdB-cassette resistant E.coli strain. The resulting clones were verified by sequencing and contained the eukaryotic TAL expression vector:<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/3/3b/Figure8T.png" width="450px" style="margin-left:150px"/><br><br></html><br />
<br />
:'''Prokaryotic TAL expression vector:'''<br><br />
:Although for the most part, TAL effectors have been used in eukaryotic organisms, we wanted to enable future iGEM teams to also use this exciting technology in bacteria. So we used BioBrick assembly to construct the following protein generator using TAL ORF, Part:BBa_J04500 (IPTG inducible promoter with RBS) and BBa_B0015 (double terminator):<br />
<br><br><br />
<html><img src="https://static.igem.org/mediawiki/2012/d/d6/Figure9T.png" width="450px" style="margin-left:150px"/></html><br />
<br />
<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Shepherd