http://2012.igem.org/wiki/index.php?title=Special:Contributions/Sararobertson&feed=atom&limit=50&target=Sararobertson&year=&month=
2012.igem.org - User contributions [en]
2024-03-28T17:27:11Z
From 2012.igem.org
MediaWiki 1.16.0
http://2012.igem.org/Team:NYU_Gallatin/Templates/Footer
Team:NYU Gallatin/Templates/Footer
2012-10-04T03:57:28Z
<p>Sararobertson: </p>
<hr />
<div><html><br />
<nowiki><br />
<script type="text/javascript" src="http://igem.melodramatic.com/jquery-1.7.2.min.js"></script><br />
<link rel="stylesheet" href="http://igem.melodramatic.com/lightbox.css" type="text/css" media="screen" /><br />
<script type="text/javascript" src="http://igem.melodramatic.com/lightbox.js"></script><br />
<script type="text/javascript" src="https://static.igem.org/mediawiki/2012/3/33/Aseatobacter-Javascript_Cellulose.txt"></script><br />
<br />
<script type="text/javascript"><br />
<br />
var _gaq = _gaq || [];<br />
_gaq.push(['_setAccount', 'UA-759233-10']);<br />
_gaq.push(['_trackPageview']);<br />
<br />
(function() {<br />
var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true;<br />
ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js';<br />
var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s);<br />
})();<br />
<br />
</script><br />
<br />
</nowiki><br />
</html></div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Parts
Team:NYU Gallatin/Parts
2012-10-04T03:32:09Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-4 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308 active-trail active"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry." class="active-trail active">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Parts}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-parts-menu" class="block block-menu"><br />
<br />
<h2>Pick a Part</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last leaf active-trail"><a href="/Team:NYU_Gallatin/Parts" title="" class="active-trail active">Parts</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Parts</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-4" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8180/8045870937_7a040e1618_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p>Here are the parts we contributed to the Bio Bricks library this year.</p><br />
<table cellspacing="0" cellpadding="3" border="0"><tr><th></th><br />
<th></th><br />
<th>part number</th><br />
<th>description</th><br />
<th>type</th><br />
<th>designer</th><br />
</tr><tr><td style="color: red">♥</td><br />
<td></td><br />
<td><a href="http://partsregistry.org/Part:BBa_K850000" target="_new">Bba_K850000</a></td><br />
<td>AGM1 gene from candida albicans</td><br />
<td>coding</td><br />
<td>Min-Gyu Kim</td><br />
</tr><tr><td style="color: red">♥</td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K850001" target="_new">Bba_K850001</a></td><br />
<td>NAG1 gene from candida albicans</td><br />
<td>coding</td><br />
<td>Min-Gyu Kim</td><br />
</tr><tr><td style="color: red">♥</td><br />
<td></td><br />
<td><a href="http://partsregistry.org/Part:BBa_K850002" target="_new">Bba_K850002</a></td><br />
<td>UAP1 gene from candida albicans</td><br />
<td>coding</td><br />
<td>Min-Gyu Kim</td><br />
</tr><tr><td style="color: red"></td><br />
<td></td><br />
<td><a href="http://partsregistry.org/Part:BBa_K850004" target="_new">Bba_K850004</a></td><br />
<td>NAG5 gene from candida albicans</td><br />
<td>coding</td><br />
<td>Will Long</td><br />
</tr></table></div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Parts
Team:NYU Gallatin/Parts
2012-10-04T03:31:33Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-4 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308 active-trail active"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry." class="active-trail active">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&amp;team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Parts}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-parts-menu" class="block block-menu"><br />
<br />
<h2>Pick a Part</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last leaf active-trail"><a href="/Team:NYU_Gallatin/Parts" title="" class="active-trail active">Parts</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Parts</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-4" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8180/8045870937_7a040e1618_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p>Here are the parts we contributed to the Bio Bricks library this year.</p><br />
<table cellspacing="0" cellpadding="3" border="0"><tr><th></th><br />
<th></th><br />
<th>part number</th><br />
<th>description</th><br />
<th>type</th><br />
<th>designer</th><br />
</tr><tr><td style="color: red">�</td><br />
<td></td><br />
<td><a href="http://partsregistry.org/Part:BBa_K850000" target="_new">Bba_K850000</a></td><br />
<td>AGM1 gene from candida albicans</td><br />
<td>coding</td><br />
<td>Min-Gyu Kim</td><br />
</tr><tr><td style="color: red">�</td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K850001" target="_new">Bba_K850001</a></td><br />
<td>NAG1 gene from candida albicans</td><br />
<td>coding</td><br />
<td>Min-Gyu Kim</td><br />
</tr><tr><td style="color: red">�</td><br />
<td></td><br />
<td><a href="http://partsregistry.org/Part:BBa_K850002" target="_new">Bba_K850002</a></td><br />
<td>UAP1 gene from candida albicans</td><br />
<td>coding</td><br />
<td>Min-Gyu Kim</td><br />
</tr><tr><td style="color: red"></td><br />
<td></td><br />
<td><a href="http://partsregistry.org/Part:BBa_K850004" target="_new">Bba_K850004</a></td><br />
<td>NAG5 gene from candida albicans</td><br />
<td>coding</td><br />
<td>Will Long</td><br />
</tr></table></div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project/Transforming
Team:NYU Gallatin/Project/Transforming
2012-10-04T03:29:59Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-35 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&amp;team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail">Project</a><ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Project/Cloning" title="">Cloning</a></li><br />
<li class="leaf active-trail"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff." class="active-trail active">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Characterization" title="">Characterizing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Designing" title="">Designing</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Project/Socializing" title="">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Transformation</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-35" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8311/8052386481_6e29d9d7c0_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p><img src="http://farm9.staticflickr.com/8452/8052046690_74e9f03b01_n.jpg" class="border" style="float: left; margin-right: 20px; margin-bottom: 15px;" />With regard to transformation, electroporation is well-known for its higher cell wall penetration rate and its efficiency on higher-organism cells, mammalian cells in particular. We used electroporation on E. Coli cells, adapting and improving available electroporation protocols to optimize transformed colony yield. <img src="http://farm9.staticflickr.com/8454/8052039349_973bb2a2b1_m.jpg" class="border" style="float: right; margin-left: 20px; margin-bottom: 15px; margin-top: 20px;" /> We hypothesized that corrected voltage and cell preparation procedures would allow us to successfully transform. Acetobacter Xylinum through electroporation. Tests included E.Coli and Acetobacter Xylinum transformation for RFP and GFP expression. Pure Acetobacter Xylinum cultures were also grown in media for several weeks and a chart has been prepared to describe and detail growth patterns. Using a spectrophotometer, light absorbency readings were taken regularly to allow for the collection of daily data. Through this measurement technique, we also determined optimal growth phases for the preparation of Acetobacter Xylinum as an electro-competent cell. </p><br />
<p><img src="http://farm9.staticflickr.com/8317/8052051236_7e6f368694_n.jpg" class="border" style="clear: left" /> Â <img src="http://farm9.staticflickr.com/8182/8052044117_7b58cb9ea3_n.jpg" class="border" /></p><br />
<p></p><center><img src="http://farm9.staticflickr.com/8450/8052524036_2d2900d98a_z.jpg" class="border" /></center><br />
<h1>Protocols</h1><br />
<h2>Modified E. Coli and Acetobacter Electroporation Protocol</h2><br />
<p>Protocol Adapted From Following Paper:<br /><a href="https://docs.google.com/a/brown.edu/folder/d/0B52k0YOxsn7EQk9kc2VxdlI0NTQ/edit?docId=0B9bdNJ3ouX7GSlFlQ0N5S2hBZW8">https://docs.google.com/a/brown.edu/folder/d/0B52k0YOxsn7EQk9kc2VxdlI0NTQ/edit?docId=0B9bdNJ3ouX7GSlFlQ0N5S2hBZW8</a></p><br />
<h3>Materials Needed:</h3><br />
<ul><li>Ice Cold sterile H20</li><br />
<li>Ice Cold 10% Glycerine</li><br />
<li>Plasmid</li><br />
<li>Bacterial Strain</li><br />
<li>Sterile LB Broth</li><br />
<li>Sterile SOC Broth</li><br />
<li>For Acetobacter: Sterile Acetobacter media. </li><br />
</ul><h3>Materials we used:</h3><br />
<ul><li>MM194 and JM109 E. Coli strains</li><br />
<li>PBR332 plasmid at 5ng/mL concentration</li><br />
</ul><h3>Equipment Used</h3><br />
<ul><li>Bio-Rad Gene-Pulser Electroporation Machine, Resistor, and Capacitance Extender</li><br />
<li>Refrigerated Centrifuge</li><br />
<li>Spectrophotometer</li><br />
</ul><h3>Electro-competent Cell Preparation (for 50 transformations)</h3><br />
<ol><li>Inoculate 5ml liquid LB culture for overnight incubation at 37 degrees with agitation at 225rpm. Use Acetobacter media for Acetobacter cultures instead of LB.</li><br />
<li>Next day, pour 27mL liquid LB into 4 separate 50mL tubes and pre-heat to 37degrees.</li><br />
<li>To each tube, add 1.25mL of overnight culture.</li><br />
<li>Incubate the 50mL tubes with agitation (225rpm 37degrees)</li><br />
<li>Incubate until an A600 absorbance reading of approximately 0.4 is reached, this should take approximately one hour. Acetobacter cultures, which have a much slower growth rate, may be incubated overnight if absorbance readings are not reached. </li><br />
<li>Once bacterial cultures reach desired density, take them out of incubation and put them in an ice bath for 30 minutes.</li><br />
<li>After cooling, spin the tubes in a refrigerated (4degC) centrifuge for 12min at 4100rpm.</li><br />
<li>Pour off supernatant, taking care not to disturb the pellet and re-suspend bacteria pellet in 25mL ice-cold sterile water. Use pipette to accomplish this; do not use a vortex machine.</li><br />
<li>Centrifuge again for 12 minutes at 4100 rpm and 4 degrees C temp</li><br />
<li>Pour off supernatant again, re-suspend pellet in 4mL ice-cold sterile water and transfer suspended mixture to 15mL tube.</li><br />
<li>Centrifuge again for 12 minutes at 4100 rpm and 4 degrees C</li><br />
<li>Pour off water and re-suspend pellet in 2mL ice cold 10% glycerin</li><br />
<li>Centrifuge for 12 Minutes at 4100 rpm and 4 degrees C</li><br />
<li>Aspirate as much supernatant as possible using a micro-pipette and re-suspend pellet in 2mL ice cold 10% glycerin.</li><br />
<li>Store samples on ice for immediate use or freeze down 40ul aliquots at -80degC.</li><br />
</ol><p>Note: Centrifuging has been tried at an extra 100rpm speed for 13 minutes successfully, supernatant was easier to discard. </p><br />
<h3>Electroporation Protocol</h3><br />
<ol><li>Use 40mL aliquots of the suspended bacteria for each transformation.</li><br />
<li>Add 2mL of plasmid (we used PBR322 at 5ng/mL) to 40mL of bacteria suspension and mix</li><br />
<li>Transfer sample to ice cold 1mm gap electroporation cuvette</li><br />
<li>Remove all moisture from outside of cuvette with kimwipe, this is important to prevent electrical arcing. Note: If an arc is observed, then your sample most likely did not successfully transform!</li><br />
<li>Set electroporation machine to 2.5kV current with 200W resistance and 25mF capacitance</li><br />
<li>Using Bio-Rad Gene Pulser: Insert cuvette into cuvette holder, making sure electrodes on the cuvette are touching those in the holder. Make sure cuvette holder is behind a Plexiglas safety shield.</li><br />
<li>Hold down the two red buttons on the gene pulser until you hear a beep, then release, this should indicate that a successful charge was dispersed</li><br />
<li>Using warm SOC media, quickly transfer contents of cuvette and place them into a sterile 15mL tubes, containing 1mL of warm SOC media.</li><br />
<li>Incubate the culture for 1 hour at 37 degrees with gentle agitation</li><br />
<li>After incubation, take 200mL of the sample and plate onto appropriate agar, use beads to spread the sample around the plate</li><br />
</ol><p></p><center><img src="http://farm8.staticflickr.com/7121/7864390690_87fb603e4b_n.jpg" class="border" /> Â <img src="http://farm9.staticflickr.com/8431/7864392046_b300d7dd16_n.jpg" class="border" /></center><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
<div id="block-views-lab-notes-block-1" class="block block-views"><br />
<br />
<h2>Transformation Lab Notes</h2><br />
<br />
<div class="content"><br />
<div class="view view-lab-notes view-id-lab_notes view-display-id-block_1 view-dom-id-9de508c34e717c3d6470fe6c38708487"><br />
<br />
<br />
<br />
<div class="view-content"><br />
<table class="views-table cols-3" ><br />
<thead><br />
<tr><br />
<th class="views-field views-field-field-sub-team" ><br />
Team </th><br />
<th class="views-field views-field-created" ><br />
Date </th><br />
<th class="views-field views-field-body" ><br />
Note </th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr class="odd views-row-first"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/10/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8174/8048768673_d51ef329a3.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/07/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8313/8048773304_9ce0f49fd2.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/04/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8451/8048765553_1ffd507e36.jpg" /><br /><img src="http://farm9.staticflickr.com/8172/8048770556_2604c4a9b2.jpg" /><br /><img src="http://farm9.staticflickr.com/8316/8048765169_52ca13cda9_n.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/03/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8450/8048766095_c94a54efd5.jpg" /><br /><img src="http://farm9.staticflickr.com/8313/8048765937_f6fd019924.jpg" /><br /><img src="http://farm9.staticflickr.com/8180/8048770890_12ba62d1a7.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/02/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8318/8048766337_a5795fb13d.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/01/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8182/8048766707_9cb88da4d7.jpg" /><br /><img src="http://farm9.staticflickr.com/8171/8048771682_17e08a6f17.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/30/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8179/8048766867_8c6cc28dd4.jpg" /><br /><img src="http://farm9.staticflickr.com/8174/8048767007_9a47831e22.jpg" /><br /><img src="http://farm9.staticflickr.com/8455/8048772414_005410d2f1.jpg" /><br /><img src="http://farm9.staticflickr.com/8169/8048767529_8993906e3d.jpg" /><br /><img src="http://farm9.staticflickr.com/8318/8048767697_95e77a28af.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even views-row-last"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/20/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8033/8048772282_58fab176aa.jpg" /></p><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
</div> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project/Socializing
Team:NYU Gallatin/Project/Socializing
2012-10-04T03:22:26Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-25 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&amp;team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail">Project</a><ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Project/Cloning" title="">Cloning</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff.">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Characterization" title="">Characterizing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Designing" title="">Designing</a></li><br />
<li class="last leaf active-trail"><a href="/Team:NYU_Gallatin/Project/Socializing" title="" class="active-trail active">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Our Human Practices</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-25" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8178/8048894791_5ebc0b2651_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><!--Load the AJAX API--><script type="text/javascript" src="https://www.google.com/jsapi"></script><script type="text/javascript"><br />
<!--//--><![CDATA[// ><!--<br />
<br />
<br />
// Load the Visualization API and the piechart package.<br />
google.load('visualization', '1.0', {'packages':['corechart']});<br />
<br />
// Set a callback to run when the Google Visualization API is loaded.<br />
google.setOnLoadCallback(drawChart);<br />
<br />
// Callback that creates and populates a data table,<br />
// instantiates the pie chart, passes in the data and<br />
// draws it.<br />
function drawChart() {<br />
<br />
// Create the GENDER data table.<br />
var data = new google.visualization.DataTable();<br />
data.addColumn('string', 'Gender');<br />
data.addColumn('number', 'Surveyed');<br />
data.addRows([ ['Female', 49.4], ['Male', 50.6], ]);<br />
var options = {'width':200, 'height':200, 'legend':'bottom', chartArea:{left:5,top:5,width:"90%",height:"90%"} };<br />
var chart = new google.visualization.PieChart(document.getElementById('chart_gender'));<br />
chart.draw(data, options);<br />
<br />
// Create the AGE data table.<br />
var data = new google.visualization.DataTable();<br />
data.addColumn('string', 'Age');<br />
data.addColumn('number', 'Age');<br />
data.addRows([ ['17 or younger', 3], ['18 to 34', 23.8], ['35 to 49', 28.6], ['50 to 64', 34.5], ['65 or older', 10.1], ]);<br />
var options = { 'width':200, 'height':200, 'legend':'bottom', chartArea:{left:5,top:5,width:"90%",height:"90%"} };<br />
var chart = new google.visualization.PieChart(document.getElementById('chart_age'));<br />
chart.draw(data, options);<br />
<br />
// Create the EDUCATION data table.<br />
var data = new google.visualization.DataTable();<br />
data.addColumn('string', 'Education');<br />
data.addColumn('number', 'Percent');<br />
data.addRows([ ['Some High School', 1.8], ['High School Diploma', 10.7], ['Some College', 19.0], ['College Degree', 33.9], ['Graduate Degree', 34.5], ]);<br />
var options = {'width':200, 'height':200, 'legend':'bottom', chartArea:{left:5,top:5,width:"90%",height:"90%"} };<br />
var chart = new google.visualization.PieChart(document.getElementById('chart_edu'));<br />
chart.draw(data, options);<br />
<br />
<br />
// Create and populate the APPROVAL BY TYPE data table.<br />
var data = google.visualization.arrayToDataTable([<br />
['Type', 'Approve', 'Disapprove', 'No Opinion'], <br />
['Food', 35.1, 53.6, 11.3], ['Clothes', 56.5, 29.2, 14.3], ['Fuels', 70.2, 14.9, 14.9], ['Medicine', 70.2, 19, 10.7],<br />
]);<br />
new google.visualization.ColumnChart(document.getElementById('chart_type')).<br />
draw(data, {width:660, height:400, legend:{position: 'bottom'}, chartArea:{left:25,top:25,width:"95%",height:"80%"}} );<br />
<br />
// Create and populate the APPROVAL BY GENDER data table.<br />
var data = google.visualization.arrayToDataTable([<br />
['Type', 'Men', 'Women'], <br />
['Food', 48.2, 21.7], ['Clothes', 74.1, 38.6], ['Fuels', 84.7, 55.4], ['Medicine', 83.5, 56.6], ['GM is Safe', 67.1, 37.3],<br />
]);<br />
new google.visualization.ColumnChart(document.getElementById('chart_type_gender')).<br />
draw(data, {width:660, height:400, legend:{position: 'bottom'}, chartArea:{left:25,top:25,width:"95%",height:"80%"}} );<br />
<br />
// Create and populate the APPROVAL BY AWARENESS data table.<br />
var data = google.visualization.arrayToDataTable([<br />
['Type', 'Food', 'Clothes', 'Fuels', 'Medicine', 'GM is Safe'], <br />
['Unaware', 22.9, 45.8, 50, 62.5, 43.8], ['Some Awareness', 41, 63.9, 78.7, 77, 62.3], ['Aware', 39, 57.6, 78, 69.5, 49.2],<br />
]);<br />
new google.visualization.ColumnChart(document.getElementById('chart_type_aware')).<br />
draw(data, {width:660, height:400, legend:{position: 'bottom'}, chartArea:{left:25,top:25,width:"95%",height:"80%"}} );<br />
}<br />
<br />
<br />
//--><!]]><br />
</script><h1>Exploring Consumer Reactions</h1><br />
<p>The biological portion of our project altered the cellulose produced by <i>acetobacter xylinum</i> for use as a fabrication material in consumer products. Accordingly, the human practices portion of our project focused on the consumer market for genetically modified (GM) products and sought to identify the primary demographic and psychographic predictors of approval for those products. We used both quantitative and qualitative measures to research this question.</p><br />
<p>The quantitative measure was in the form of a ten item survey administered to a national sample via the world wide web. The survey asked respondents whether they were aware that GM food and cotton were already sold in stores, whether they approved of GM food, clothes, fuels, and medicine, how safe they perceived GM products to be, and basic demographic information including their age, gender, and highest level of education completed. A 37 percent response rate yielded 168 usable responses, and results are reported with 95 percent confidence and a confidence interval of 7.5 percent. We found that product type, gender, and awareness of existing GM products were all predictors of approval for GM products. We also found that women were significantly less likely to approve of GM products (p<br />
</p><p>As a qualitative measure of opinion concerning GM products, we created an artificial store selling GM products at a widely attended street festival in Brooklyn, NY and interviewed visitors concerning their perceptions of actual and hypothetical GM products on display at the store. We interviewed women in particular and found that the perception of GM products as unsafe or untrustworthy is a likely cause of disapproval for GM products.</p><br />
<h1>The Survey</h1><br />
<p><a href="/Team:NYU_Gallatin/Project/Socializing/Survey"><img src="http://farm9.staticflickr.com/8452/8048903468_10fa09f84d_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" /></a>Our human practices portion consists of a study concerning relationships among awareness, education, and approval of different genetically modified products. e.g. Do people care whether cotton is genetically engineered as much as food? The survey results were collected online as well as our shoppe at Atlantic Antic from volunteers off the street. </p><br />
<p><a href="/Team:NYU_Gallatin/Project/Socializing/Survey">Take the survey yourself!</a></p><br />
<h2 style="clear: both">Methodology</h2><br />
<ul><li>10 item web survey regarding genetically modified (GM) products:<br />
<ul><li>Awareness that GM food and cotton are sold (2 items).</li><br />
<li>Approval for GM food, clothes, fuel and medicine (4 items).</li><br />
<li>Perceived safety of GM products (1 item).</li><br />
<li>Age, gender and education (3 items). </li><br />
</ul></li><br />
<li>Respondents were recruited by a survey research firm using email and online advertising, and through social networks.</li><br />
<li>Most respondents received $0.50 to a charity or the chance to win $100 in an online sweepstakes. </li><br />
<li>Survey administered the week of 9/21/12.</li><br />
</ul><h2>Sample Overview</h2><br />
<ul><li>National sample, including more than 50 U.S. metro areas.</li><br />
<li>37 percent response rate, 168 usable responses.</li><br />
</ul><!--Div that will hold the pie chart--><div style="background: white; padding: 15px; text-align: center; -moz-border-radius: 15px; border-radius: 15px;"><br />
<div id="chart_gender" style="display: inline-block"></div><br />
<div id="chart_age" style="display: inline-block"></div><br />
<div id="chart_edu" style="display: inline-block; clear: right"></div><br />
<div id="chart_gender_title" style="display: inline-block; width: 200px; background: white; color: black; text-align: center;">Gender</div><br />
<div id="chart_gender_title" style="display: inline-block; width: 200px; background: white; color: black; text-align: center;">Age</div><br />
<div id="chart_gender_title" style="display: inline-block; width: 200px; background: white; color: black; text-align: center;">Education</div><br />
</div><br />
<h2>Results</h2><br />
<p>The results of our survey showed some interesting insights into the way different types of people view GM products.</p><br />
<h3>Approval Varies by Type</h3><br />
<div style="background: white; padding: 15px; text-align: center; -moz-border-radius: 15px; border-radius: 15px;"><br />
<div id="chart_type" style="display: inline-block"></div><br />
</div><br />
<h3>Approval Varies by Gender</h3><br />
<p>Women seem to approve of GM products much less than men.</p><br />
<div style="background: white; padding: 15px; text-align: center; -moz-border-radius: 15px; border-radius: 15px;"><br />
<div id="chart_type_gender" style="display: inline-block"></div><br />
</div><br />
<h3>Effect of Awareness on Approval</h3><br />
<p>GM Awareness has a limited effect on approval.</p><br />
<div style="background: white; padding: 15px; text-align: center; -moz-border-radius: 15px; border-radius: 15px;"><br />
<div id="chart_type_aware" style="display: inline-block"></div><br />
</div><br />
<h2>Summary</h2><br />
<p></p><ul><li>Product type, gender, awareness all affect approval for GM products.</li><br />
<li>Increasing GM awareness primarily influences undecideds. </li><br />
<li>Age and education showed no significant effect. </li><br />
<li>Results are 95 percent confidence +/- 7.5 percent. </li><br />
<li>Further research needed to examine the mechanism affecting approval. We believe perceived risk versus reward and emotions of disgust and fear are likely drivers. </li><br />
</ul><h1>The Shop</h1><br />
<p>To showcase the wonder and power of genetically modified products to the public, we setup a one-day-only popup shop in Brooklyn, NY on the day of the biggest street fair in New York City -- The Atlantic Antic! With tons of street traffic and several film crews documenting the day and interviewing visitors, the store was a huge success. Check out some of the "products" we were selling that day.</p><br />
<h2>GMO based consumer products: Present and Future</h2><br />
<h3>Living Watch</h3><br />
<p><img src="http://farm9.staticflickr.com/8172/8052323830_97938ac8b7_n.jpg" class="border" /> Â <img src="http://farm9.staticflickr.com/8321/8052326135_e8fa43ac12_n.jpg" /></p><br />
<p>This biologically based oscillator is attuned not only to lunar and solar cycles, but to biological circadian rhythms as well. Housed in an organic scaffold and bezel setting, the time is digitally indicated by truly organic light emitting diodes; cells that have been genetically modified to bio-luminesce in response to oscillating genetic circuits. With a housing and strap made from laboratory grown keratinocytes and chondrocytes (a.k.a. Victimless Leather), it ensures complete biodegradability when time runs out. </p><br />
<p><i>Availability: Near Future</i></p><br />
<h3>BioCrete</h3><br />
<p><img src="http://farm9.staticflickr.com/8042/8052317291_0bf8cd8cc3_n.jpg" class="border" /> Â <img src="http://farm9.staticflickr.com/8320/8052332604_63b1440577_n.jpg" class="border" /></p><br />
<p>Did you know that the production of cement is a very energy intensive process and is a source of 5% of industrial CO2 emissions? Build your foundation instead using BioCrete. A genetically engineered strain of a naturally occurring bacterium, Sporosarcina pasteurii, has been designed to secrete both calcium carbonate and spider silk proteins to generate a very durable cement to produce concrete with optimum tensile strength. The strain has also been engineered to be salt tolerant and photosynthetic. Mix with some soil and water, add the freez-dried bacteria, expose to moderate sunlight and grow your dream house!</p><br />
<p><i>Availability: Near to Far Future</i></p><br />
<h3>Microbial Fuel Cell / Engineered ProBiotics</h3><br />
<p>Always feel as if you�re flushing money down the drain? With the Microbial Fuel Cell, you can generate enough power to light up your home. Attaches easily to existing waste water pipes and harnesses bacteria to generate a steady and reliable output of �Bac-tricity.� Naturally occurring E. coli colonize high-surface area carbon nanotube anodes and contribute electrons from their membrane surface. With our genetically modified probiotic supplement, you can �turbo-charge� your gut microbes with probiotic strains over-expressing proteins that optimize the external transfer of electrons. These will yield up to 10 times the current flow as natural strains, ensuring that your roll-on OLED display and Xbox Holodeck doesn�t run out of power. Don�t forget to ask your pharmacist about the �Do Your Duty� Federal Tax Credit available upon purchase.<br /><br />
Availability: Far Future</p><br />
<h3>MicroAlgae BioDiesel</h3><br />
<p><img src="http://farm9.staticflickr.com/8450/8052312163_c33467fdc5_z.jpg" class="border" /></p><br />
<p>Everyone is going green these days, including the U.S. Navy! The grown photosynthetic algae harvests CO2 directly from the atmosphere and uses sunlight to biosynthesize energy packed hydrocarbons. Since the CO2 that is subsequently released from the burning of this fuel has been taken up from the atmosphere, the result is a net carbon-neutral load on the environment. New strains are being genetically engineered to produce higher yields of hydrocarbons which can be used to power everything from F-18 Hornets to the family sedan. </p><br />
<p><i>Availability: Near Future</i></p><br />
<h3>Enzyme based Cleaners</h3><br />
<p>The addition of genetically modified enzymes that degrade proteins (proteases), carbohydrates (amylases) and greases (lipases) to cleaning compounds such as detergents, surface cleaners, contact lens solutions, etc. ensures the speedy removal of accumulated dirt. In addition, enzymes function at lower temperatures, thereby reducing the need for hot water during cleaning. A sample, by no means complete, of some products that contain enzymes for cleaning purposes is on display here.</p><br />
<p><i>Availability: Now</i></p><br />
<h3>GloFish: Genetically Modified Pets</h3><br />
<p>Originally engineered at the National University of Singapore to act as a biosensor to detect pollutants in rivers, these genetically modified zebra fish have proven to be a hit at pet stores nationwide. </p><br />
<p>From <a href="http://www.glofish.com:">www.glofish.com:</a><br /><br />
�GloFish® are brilliantly wonderful fish that add color and excitement to any aquarium, whether at home or the office, or in classrooms. GloFish are similar to other fish, except they have a much brighter disposition. GloFish fluorescent fish are available for purchase in five stunningly beautiful colors: Starfire Red®, Electric Green®, Sunburst Orange®, Cosmic Blue® and Galactic Purple®. Each new GloFish fluorescent fish inherits its unique color directly from its parents, maintains the color throughout its life, and passes the color along to its offspring.�</p><br />
<p><i>Availability: Now</i></p><br />
<h3>The Harvard iGARDEN</h3><br />
<p><img src="http://farm9.staticflickr.com/8314/8052349869_e465b14405_z.jpg" class="border" /></p><br />
<p>Designed as an �open source tool-kit for plant engineering�, the iGARDEN kit was created by Harvard University students during the 2010 International Genetic Engineering competition.<br /><br />
From the Harvard Team IGEM 2010 website:<br /><br />
�The Harvard iGarden is a venture into plant engineering. Our aim is to create a toolkit for the cultivation of a personalized garden containing features introduced through synthetic biology. In addition to a "genetic fence" designed to prevent the spread of introduced genetic material, we have developed three independent features to be included in this toolkit - inclusion of novel flavors, knockdown of plant allergens, and modification of petal color. We envision the iGarden as a medium through which the non-scientist can see the power and potential of synthetic biology and apply it to everyday life.�</p><br />
<p><i>Availability: Near Future</i></p><br />
<h3>Gen2Seat (Generation 2, Seat)</h3><br />
<p><img src="http://farm9.staticflickr.com/8462/8052319709_4ccaecde9b_z.jpg" class="border" /></p><br />
<p>Furniture that is grown using biopolymers derived from genetically modified Acetobacter strains, isolated from Kombucha, that secrete chitin, a durable material also found in insect exoskeletons. What will they think of next! Draped over an interior cushioning derived from fungal mycelia, this chair is light, sturdy and eventually compostable. This consumer item is designed to be produced using a minimum of energy expenditure and is currently being developed by the NYU-Gallatin IGEM team, along with members of Terreform One and Genspace.</p><br />
<p><i>Availability: Very Near Future</i></p><br />
<h3>BioProgrammable Paint</h3><br />
<p><img src="http://farm9.staticflickr.com/8320/8052327397_0d13a808e1_z.jpg" class="border" /></p><br />
<p>Not sure what color to paint your walls? Decide later with programmable paint! Contains micro-encapsulated strains of genetically engineered B. subtilis bacteria. Each bacterium contains a series of genes cloned from various plant biosynthetic pathways that synthesize pigment molecules, such as red lycopene found in tomatoes and orange beta-carotene found in carrots. When freshly applied, the oxygen activated microbes get to work, producing a slowly changing spectrum of synchronized color on applied surfaces for up to a week, with previous pigments being degraded. When your favorite color comes into view, simply wave the enclosed UV emitting wand in the direction of the surface to disable the bacteria and lock in the color. Improved varieties of programmable paint are being worked on that will also absorb allergens and toxins such as carbon monoxide and mold spores.</p><br />
<p><i>Availability: Far Future</i></p><br />
<h3>Genetically Modified Foods</h3><br />
<p>Currently at the center of various controversies, genetically modified crops come in a range of varieties. Crops that have been developed today include varieties of maize, soy and alfalfa, that express genes from the naturally occurring soil bacterium B. thuringiensis. The expressed protein is fatal to insect larvae when they ingest the crops. Most current crops are engineered to be either pest or herbicide resistant. Future varieties of food crop plants are being engineered to have enhanced production of nutrients. Golden rice varieties have been engineered that produce beta-carotene (Viatmin A). Currently 80% of papayas grown in Hawaii are derived from a variety that has been genetically engineered to contain a gene making it resistant to papaya ringspot virus, a natural pest of the papaya plant.</p><br />
<p><i>Availability: Now</i></p><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project/Cloning
Team:NYU Gallatin/Project/Cloning
2012-10-04T03:15:07Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-21 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&amp;team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail">Project</a><ul class="menu clearfix"><li class="first leaf active-trail"><a href="/Team:NYU_Gallatin/Project/Cloning" title="" class="active-trail active">Cloning</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff.">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Characterization" title="">Characterizing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Designing" title="">Designing</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Project/Socializing" title="">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Cloning</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-21" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8038/8044401408_5ac681d0f7_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><h1>Project</h1><br />
<p><img src="http://farm9.staticflickr.com/8310/8046195496_184143ce61_m.jpg" style="float: right; margin-bottom: 10px; margin-left: 10px; border: solid black 1px;" />Designer Suzanne Lee showed that bacterial cellulose could be used in novel ways, including to make clothing using a more eco-friendly process. Our team set out to demonstrate that new characteristics could be added to the cellulose produced by Acetobacter xylinum using synthetic biology methods. Altering physical characteristics such as strength, color, odor, etc. would result in exciting new materials to create with. </p><br />
<p>Cellulose is a polymer made up of long β-1,4 glucan chains. In Acetobacter, the enzyme cellulose synthase catalyzes the biosynthesis of cellulose from UDP-glucose. We hypothesized that mixed polymers containing different sugars would have unique physical properties. Cellulose synthase has been reported to utilize UDP-N-acetylglucosamine (NAG) molecules (components of chitin) as well, resulting in a polymer containing both glucose and NAG units- a cellulose-chitin hybrid. We wanted to test the properties of this new material, so we set out to engineer Acetobacter to produce this hybrid polymer.</p><br />
<h1>Strategy</h1><br />
<p>The yeast Candida albicans produces chitin and uses it in spore formation. To incorporate NAG into Acetobacter cellulose, we focused on three yeast genes (the pathway consisting of NAG5 (GlcNac kinase) catalyzes the conversion to GlcNac-6P, AGM1 (Phosphoacetyl-glucosamine mutase) which converts GlcNac-6-P to GlcNac-1-P, and UAP1 (UDP-GlcNac pyrophosphorylase) which adds UDP. </p><br />
<p><img src="http://farm9.staticflickr.com/8322/8046206114_ea3482c939_m.jpg" style="float: left; margin-bottom: 10px; margin-right: 10px; border: solid black 1px;" />The most efficient method was to use Gibson assembly to piece together each gene from small, ovelapping fragments of between 300 and 500bp ("G-blocks") and clone it into pSB1C3 separately. We could not construct the entire pathway with G-blocks because it was too large, and there is a limit of six fragments for efficient Gibson assembly. The coding sequences were modified to reflect codon usage in Acetobacter, and an Acetobacter RBS was added in front of each gene. The G-blocks that we had synthesized for each gene are shown below:</p><br />
<ul><li><a onclick="javascript:$('#g-agm1').toggle();">G-blocks for AGM1</a><br /><div id="g-agm1" style="display: none"><br />
<p>GAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTGAGGAGGATGAACGACGCATGTCAATTGAACAAACATTATCACAATATTTACCATCACATCCAAAACCACAAGGTGTGACATTTACTTATGGGACAGCAGGATTCCGTATGAAAGCTGATAAATTAGATTATGTCACTTTTACCGTTGGGATCATTGCTTCATTAAGATCGAAATATTTACAAGGGAAAACCGTTGGTGTTATGATTACTGCTTCTCATAATCCCCCGGAAGATAATGGGGTTAAAGTTGTTGATCCATTAGGTAGTATGTTGGAAAGTTCATGGGAAAAATATGCTACTGATTTAGCCAATGCTTCTCCTTCTCCTTCTA 402</p><br />
<p>TATGCTACTGATTTAGCCAATGCTTCTCCTTCTCCTTCTAACGATTCAGAAGGGGAAAAAAATCTGTTGGTGGAAGTTATTAAAAATTTGGTTTCTGATTTGAAAATTGATTTATCTATTCCTGCTAATGTTGTTATTGCTAGGGATTCAAGAGAATCTAGTCCAGCATTATCAATGGCAACTATTGATGGATTTCAAAGTGTTCCCAACACTAAATATCAAGATTTTGGATTATTTACTACCCCAGAATTACATTATGTTACTAGAACATTAAACGATCCCGATTTTGGTAAACCAACTGAAGATGGTTATTATTCTAAATTAGCAAAATCTTTCCAAGAAATTTATACCATTTGTGAATCTAATAATGAAAAAATCGATATAACTATTGATGCTGCTAATGGTGTTGGAGCCCCCAAA 420</p><br />
<p>TATAACTATTGATGCTGCTAATGGTGTTGGAGCCCCCAAAATTCAAGAATTATTAGAAAAATATTTACATAAAGAAATCAGTTTTACCGTGGTTAACGGTGATTATAAACAACCAAATTTATTAAATTTTGATTGTGGAGCTGATTATGTCAAGACTAATCAAAAATTACCTAAAAATGTCAAACCAGTAAATAATAAATTATATGCTTCATTTGATGGCGATGCGGATAGATTAATATGTTATTATCAAAACAATGATAATAAATTCAAATTATTAGATGGTGATAAATTATCGACGTTATTTGCGTTATTTTTACAACAATTATTTAAACAAATTGACCCCACTAAGATTTCATTGAATATTGGTGTGGTTCAAACTGC 381</p><br />
<p>CCCACTAAGATTTCATTGAATATTGGTGTGGTTCAAACTGCTTATGCTAATGGATCTTCAACAAAATATGTTGAAGATGTTTTGAAAATTCCTGTTCGTTGTACTCCTACTGGTGTTAAACATTTACATCATGAAGCTGAAAATTTCGATATTGGTGTATATTTTGAAGCTAATGGGCATGGTACAGTTATTTTCAATCCTGAAGCCGAAAAGAAAATTTTCAATTATAAACCAAATAATGATAATGAAGCTAAAGCTATTAAAGTTTTACAAAATTTTAGTCAATTAATTAATCAAACTGTGGGTGATGCAATTTCCGATTTATTGGCCGTGTTAATTGTCGTTCATTATTTGAAATTATCACCAAGTGATTGGGATAATGAATATACTGA 392</p><br />
<p>TTGAAATTATCACCAAGTGATTGGGATAATGAATATACTGATTTACCTAATAAATTGGTTAAAGTGATTGTTCCTGATAGATCTATATTCAAAACTACAAATGCTGAAAGAACTTTGGTTGAACCTAAAGGTATGCAAGATGAAATTGATAAATTAGTTGCCCAATATCCAAATGGAAGATCTTTTGTAAGAGCTTCTGGTACTGAAGATGCTGTTAGAGTTTATGCTGAAGCTGATACGCAAAATAACGTTGAAGAATTATCTAAAGCAGTATCTGAATTAGTTAAATAGTACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCC 348</p><br />
</div><br />
</li><br />
<li><a onclick="javascript:$('#g-nag5').toggle();">G-blocks for NAG5</a><br /><div id="g-nag5" style="display: none"><br />
<p>GAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTGAGGAGGATGAACGACGCATGACTGAGA CTAGCATTAG TGGGTTGCGT GGCCCCAAGT CCATGTATTT TATGGAGATTGTTGATGTGT CGTCGCAAGA ATCCAGTGTG TTGTCGAGTA TTGTTGAATC GTTTACGTCTGCGGTATCTG CATCGAACTT GGGGGTATAC TCTGATGAAG TGCTTTGTGA TATCAAACTGTCGTTGAAAG AGAAATCCCC AATTACTATG TTACCTAACT ATAATGTCTC CCCTACAGGCGACGAGCATG GACAGTATTT GGTTATTGAT TTAGGAGGGT</p><br />
<p>CCCTACAGGCGACGAGCATG GACAGTATTT GGTTATTGAT TTAGGAGGGT CGACATTGAG AATAGCAGTGGTAGACATTT CCAAGCCACA CCCAAATTTG TCGAGAAGTG AGAGGATAAC TATAGTTGTGGAAAAGAGTT GGATTATTGG CAACGACTTT AAGAGGATTG ATGGTGAGTT TTTCAAGTATATTGGGTCCA AGATTAACGA GATATTGATG GGACAGAATG TTATTGATGT AAAGTCGGTT ATCAATACTG GTATAACCTG GTCGTTCCCG TTGGAAACAA CCGACTACAA TAGAGGCAAGATCAAGCATG TTTCCAAAGG GTATACTGTG GGAGAGG</p><br />
<p>CAA TAGAGGCAAGATCAAGCATG TTTCCAAAGG GTATACTGTG GGAGAGGATA TTTACGACAA GGATTTAAAGATGGTTTTGG AAGACACGTT GAGACAAGAG TACGGGTTGA CACTTGACGT GCAGTCTATATTGAACGACT CGTTGGCGGT GTATTCTGCT GGGTGCTTTA TTGATTCGAA GATGAAGTTGGCCATGGTGT TGGGGACAGG GATTAACATG TGCTGTTCCC TAAAAAGGTC AAGTGATATCCACCCCTCCA AGATGTTGGC TGATGCTACG TTGTTTAATT GTGAGCTCTC GTTGTTTGGCCAGAATCTAT GTAAAGACTT TGCTACGAAA TATGATATCA TTATAGACAA</p><br />
<p> CAGAATCTAT GTAAAGACTT TGCTACGAAA TATGATATCA TTATAGACAA GAGGTTTGCTGGTTTGCTGC ACCACTTTAA GACGTTTATG GAGCCTGACC CTATTACAAA AACGCTTTTCCAGCCGCACG AGTTGATGAC CAGTGGGAGG TACTTGCCAG AATTGACGAG TTGGTGGTGGTAGATTTGA TTGAGGCTGG CGAGATTTTT CAAAATGTTG ACCACCAACA GATGTACCAAGAGTATGGTG GGTTTAGTGG GGAGTTGATT TGTTTTGTGC ATGAGAATGA CGATTATGATGATATACATG ACAAGTTGTG CAAGGCCTAC GGCTGGACGA CGGTTGGGTTGAGTGACATTGTCTGCTTGA AAGAAGTTGT ATCGTGCATT ATCAAGCGGG </p><br />
<p>GAGTGACATTGTCTGCTTGA AAGAAGTTGT ATCGTGCATT ATCAAGCGGG CGGCGTTTAT TGTTGCCAATGCGATTATTG CGTTTTTCAA ATTGTTGGGC AGTGACGAGT TGGGTGGTGA TGTGACGATTGGGTATGTGG GGTCGGTCTT GAACTACTTT CACAAGTATA GACGGTTGAT TGTTGAGTATGTGAATAGCG CAGAGGAGGC CAAGGGGATA AAGGTTGACT TGAAGTTGAT TGAAAATAGCTCGATTATAG GTGCTGCCAT AGGTGCTGCC TATCATAAG TAGTACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACC</p><br />
</div><br />
</li><br />
<li><a onclick="javascript:$('#g-uap1').toggle();">G-blocks for UAP1</a><br /><div id="g-uap1" style="display: none"><br />
<p>GAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTGAGGAGGATGAACGACGCATGACAGTTAAATCACAACAACAAATTATTGATTCATTCAAACAAGCTAATCAAGATCAACTTTTCCAATATTATGATTCATTGACAATAAATCAACAACAAGAATTTATAGATCAATTGTCAACTATTGAAGAACCAGCTAAATTGATTTCTACTGTAGAACAAGCGATTCAATTTTCTCAAACCAATTCTACATCAAGAAATTTCACTCAATTACCTAATGAACAAACAGCATCAACTTTAGATTTATCAAAAGACATTTTACAAAATTGGACCGAATTAGGTTTAAAAGCCATTGGTAATGGAGAAGTTGCCGTTTTATTGATGGCAGGAGGTCAAGGAAC 433</p><br />
<p>GAGAAGTTGCCGTTTTATTGATGGCAGGAGGTCAAGGAACTAGATTAGGTTCAAGTGCTCCCAAAGGTTGTTTTAATATTGAATTACCATCACAAAAATCATTATTTCAAATTCAAGCTGAAAAAATTTTGAAAATTGAACAATTAGCTCAACAATATTTGAAATCGACTGAAAAACCAATTATTAATTGGTATATTATGACCAGTGGTCCTACTAGAAATGCTACTGAATCATTTTTCATTGAAAATAATTATTTTGGTTTAAATTCTCATCAAGTGATTTTTTTCAATCAAGGAACGTTGCCATGTTTTAATTTACAAGGCAATAAAATCTTATTAGAACTGAAAAATTCAATTTGTCAATCACCCGATGGTAATGGTGGATTATATAAGGC 384</p><br />
<p>TTTGTCAATCACCCGATGGTAATGGTGGATTATATAAGGCATTAAAAGATAATGGAATACTAGATGATTTCAATTCTAAGGGCATCAAACATATTCATATGTATTGTGTTGATAATTGTTTAGTTAAAGTTGCTGATCCAATTTTCATTGGATTTGCCATTGCCAAAAAATTTGATTTGGCAACAAAAGTGGTTAGAAAAAGAGACGCTAATGAAAGTGTTGGATTAATTGTTTTAGATCAAGATAATCAAAAACCTTGTGTTATTGAATATAGTGAAATTTCTCAAGAATTGGCTAACAAAAAAGACCCTCAAGATTCTTCTAAATTATTTTTAAGAGCTGCTAATATTGTTAATCATTATTATTCAGTGGAATTTTTAAATAAAATGATTCCTAAATGGATTTCATCTCAAAAATATTTACCATTCC 429</p><br />
<p>ATTCCTAAATGATTTCATCTCAAAAATATTTACCATTCCATATAGCTAAAAAGAAAATCCCAAGTTTGAATTTAGAAAATGGAGAATTTTATAAACCAACTGAACCAAATGGTATTAAATTAGAACAATTCATTTTCGATGTTTTCCCATCAGTCGAATTAAATAAATTTGGTTGTTTAGAAGTCGATCGTTTAGATGAATTTTCTCCATTGAAAAACGCCGATGGTGCTAAAAATGATACTCCAACAACTTGTAGAAATCATTACCTTGAAAGAAGTTCCAAATGGGTTATTCAAAATGGTGGAGTTATTGATAATCAAGGATTAGTTGAAGTTGATAGTAAAACCAGTTATGGTGGTGAAGGTTTAGAATTTGTTAATGGTAAACATTTCAAAAATGGCGATATTATTTAATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCC 470</p><br />
</div><br />
</li><br />
</ul><p>This worked very well, and resulted in the submission of three new parts to the BioBrick Library (Bba_K850000, Bba_K850001, Bba_K850002). We then set out to fuse these three genes into a single pSB1C3-based plasmid. PCR primers were synthesized to bracket each of the three genes and also add sequernce that would facilitate Gibson assembly of the entire pathway. Our reasoning was that we could then use Gibson assembly to piece together the three genes in the pathway together into pSB1C3. The sequences of these primers is shown below. We included two forward primers dfor the AGM1 gene- one that included the T7 promoter (known to work in Acetobacter, whose own promoters are not clearly understood yet), and one that did not.</p><br />
<p></p><center><img src="http://farm9.staticflickr.com/8035/8049080716_3bef9f0a16_n.jpg" class="border" /> Â <img src="http://farm9.staticflickr.com/8319/8049081732_b72fe60544_n.jpg" /></center><br />
<h1>Primers</h1><br />
<ul><li><a onclick="javascript:$('#f-agm1').toggle();">Forward AGM1 (biobrick plasmid + promoter</a><br /><div id="f-agm1" style="display: none"><br />
<p>CAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTAATACGACTCACTATAGGGAATACAAGCTACTTGTTCTTTTTGCATGAGGAGGATGAACGACGCATG</p><br />
</div><br />
</li><li><a onclick="javascript:$('#r-agm1').toggle();">Reverse AGM1</a><br /><div id="r-agm1" style="display: none"><br />
<p>GCAGTATCTGAATTAGTTAAATAGTGAGGAGGATGAACGACGCATGAGACAAGCTATATTTTCCAACCCTAACGATGCTGCGCAGCATCGTTAGGGTTGGAAAATATAGCTTGTCTCATGCGTCGTTCATCCTCCTCACTATTTAACTAATTCAGATACTGC</p><br />
</div><br />
</li><br />
<li><a onclick="javascript:$('#f-nag5').toggle();">Forward NAG5</a><br /><div id="f-nag5" style="display: none"><br />
<p>CGTTGAAGAATTATCTAAAGCAGTATCTGAATTAGTTAAATAGTGAGGAGGATGAACGACGCATGAGACAAGCTATATTTTCCAACCC</p><br />
</div><br />
</li><br />
<li><a onclick="javascript:$('#r-nag5').toggle();">Reverse NAG5</a><br /><div id="r-nag5" style="display: none"><br />
<p>GCTGGATTAAAGTCAAAGTTGTAGTGAGGAGGATGAACGACGCATGACAGTTAAATCACAACAACAAATTATTGATTCATTCATGAATGAATCAATAATTTGTTGTTGTGATTTAACTGTCATGCGTCGTTCATCCTCCTCACTACAACTTTGACTTTAATCCAGC</p><br />
</div><br />
</li><br />
<li><a onclick="javascript:$('#f-uap1').toggle();">Forward UAP1</a><br /><div id="f-uap1" style="display: none"><br />
<p>GTTTGCGATAACGCTGCCGCTGGATTAAAGTCAAAGTTGTAGTGAGGAGGATGAACGACGCATGACAGTTAAATCACAAC</p><br />
</div><br />
</li><br />
<li><a onclick="javascript:$('#r-uap1').toggle();">Reverse UAP1 (biobrick plasmid)</a><br /><div id="r-uap1" style="display: none"><br />
<p>CAAAAATGGCGATATTATTTAATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTATTAAATAATATCGCCATTTTTG</p><br />
</div><br />
</li><br />
</ul><p>The primers for the NAG5 and UAP1 genes worked well, resulting in PCR products of the expected size. However, the AGM1 primers did not result in a PCR product even when used under a variety of conditions. We then altered our cloning strategy and attempeted to use traditional BioBrick assembly. The plasmid containing AGM1 (Bba_K850000) was digested with Spe1 and Pst1, and the product gel-purified and treated with Antarctic phosphatase. The NAG5 gene was cut out of the Bba_K850001 plasmid using Xba1 and Pst1 and gel-purified. These two pieces of DNA were ligated together to produce a plasmid containing the AGM1 and Xba1 parts of the pathway in a BioBrick format. This construct was then cut with Spe1 and Pst1, and the process repeated with the UDP1 gene cut from the Bba_K850002 BioBrick plasmid with Xba1 and Pst1.</p><br />
<p>This resulted in a plasmid containing the entire pathway (AGM1, NAG5 and UDP1) but no promoter. To test the pathway in Acetobacter, we cut it out of the BioBrick vector using EcoR1 and Pst1 and cloned it into the MCS of pUC18 which has a T7 promoter.</p><br />
<p><a href="/Team:NYU_Gallatin/Project/Cloning/Primers">Learn how to design primers</a> from Julie Wolf.</p><br />
<h1>Protocols</h1><br />
<p>Here are some protocols we used in our cloning process.</p><br />
<ul><li><a href="/Team:NYU_Gallatin/Project/Cloning/Protocols/Transformation">Transformation Protocol</a></li><br />
</ul><h1>Gibson Assembly</h1><br />
<p></p><center><br /><img src="http://farm9.staticflickr.com/8041/8048773499_8b8e3875bc_z.jpg" /><br /><img src="http://farm9.staticflickr.com/8458/8048773043_b64baa80e9_z.jpg" /><br /><img src="http://farm9.staticflickr.com/8315/8048773361_603f32760b_z.jpg" /><br /><img src="http://farm9.staticflickr.com/8310/8048773201_2bbaec290f_z.jpg" /><br /></center><br />
<h1>Chitin Synthase Mutagenesis</h1><br />
<p><b>Amplification of CSH3 gene encoding chitin synthase from S. cerevisiae</b></p><br />
<p>We are also setting out to clone the chitin synthase of S. cereivisiae that was originally submitted as a part but is currently not BioBrick compatible (Part:BBa_K418007).</p><br />
<p>PCR primers were designed for amplifying CSH3 from colonies of S. cerevisiae. Primers had BioBrick prefix and suffix ends. The suffix end also had a terminal XhoI site for cloning into the pET28-b+ expression vector for His tagged.</p><br />
<p><b>Forward-CSH3 (BioBrick Prefix)</b><br /><br />
GTT TCT TCG AAT TCG CGG CCG CTT CTA GAT GAC CGG CTT GAA TGG AG</p><br />
<p><b>Reverse-CSH3 (BioBrick Suffix)</b><br /><br />
GTT TCT TCC TCG AGC TGC AGC GGC CGC TAC TAG TAT TAC TAT GCA ACG AAG GAG TCA C</p><br />
<p>As this gene has 2 illegal Xba1 sites and and illegal Pst1 site, 3 sets of primers will be designed to introduce point mutations in order to remove them, to ensure BioBrick compatibility. For this strategy we will use a PCR based mutagenesis system.</p><br />
<p>Illegal XbaI sites and PstI site in CSH3 as determined using NEBcutter:</p><br />
<pre><br />
Cut pos. MS Enzyme Recognition sequence<br />
-------- -- -------------------- --------------------<br />
1117 XbaI T^CTAG_A<br />
1674 XbaI T^CTAG_A<br />
2322 PstI C_TGCA^G<br />
</pre></div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Modeling
Team:NYU Gallatin/Modeling
2012-10-04T03:09:40Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-5 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310 active-trail active"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together." class="active-trail active">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&amp;team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Modeling}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-modeling-menu" class="block block-menu"><br />
<br />
<h2>Model It</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last leaf active-trail"><a href="/Team:NYU_Gallatin/Modeling" title="" class="active-trail active">Modeling</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Modeling</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-5" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><h1>Bio Synthetic Pathways</h1><br />
<p></p><center><img src="http://farm9.staticflickr.com/8175/8052145533_c321d3ac67_z.jpg" /></center><br />
<h1>Codonizer</h1><br />
<p>To ensure that our modeling worked, we ran our sequences through a custom developed codon optimizer. Try it our yourself below! Drop in a chunk of DNA data and click "Optimize Codons" to have your sequence optimized for the acetobacter preferred codons.</p><br />
<p><textarea name="codons" id="old-codons" rows="10" cols="80"></textarea><input type="button" id="optimize-codons" value="Optimize Codons" /></p><br />
<div id="new-codons"></div><br />
<p>Upon completion of the iGEM competition we would like to expand our Codonizer software to support other strains. A mockup of what this tools will look like is provided below.</p><br />
<p></p><center><img src="http://farm9.staticflickr.com/8460/8052465891_a67ab6b567.jpg" /></center><br />
<script type="text/javascript" src="https://static.igem.org/mediawiki/2012/2/2e/Aseatobacter-Javascript_Codonizer.txt"></script></div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Modeling
Team:NYU Gallatin/Modeling
2012-10-04T03:08:12Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-5 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310 active-trail active"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together." class="active-trail active">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&amp;team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Modeling}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-modeling-menu" class="block block-menu"><br />
<br />
<h2>Model It</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last leaf active-trail"><a href="/Team:NYU_Gallatin/Modeling" title="" class="active-trail active">Modeling</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Modeling</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-5" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><h1>Bio Synthetic Pathways</h1><br />
<p></p><center><img src="http://farm9.staticflickr.com/8175/8052145533_c321d3ac67_z.jpg" /></center><br />
<h1>Codonizer</h1><br />
<p>To ensure that our modeling worked, we ran our sequences through a custom developed codon optimizer. Try it our yourself below! Drop in a chunk of DNA data and click "Optimize Codons" to have your sequence optimized for the acetobacter preferred codons.</p><br />
<p><textarea name="codons" id="old-codons" rows="10" cols="80"></textarea><input type="button" id="optimize-codons" value="Optimize Codons" /></p><br />
<div id="new-codons"></div><br />
<p>Upon completion of the iGEM competition we would like to expand our Codonizer software to support other strains. A mockup of what this tools will look like is provided below.</p><br />
<p></p><center><img src="http://farm9.staticflickr.com/8460/8052465891_a67ab6b567.jpg" /></center><br />
<script type="text\javascript" src="https://static.igem.org/mediawiki/2012/2/2e/Aseatobacter-Javascript_Codonizer.txt"></script></div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/File:Aseatobacter-Javascript_Codonizer.txt
File:Aseatobacter-Javascript Codonizer.txt
2012-10-04T03:06:56Z
<p>Sararobertson: </p>
<hr />
<div></div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Modeling
Team:NYU Gallatin/Modeling
2012-10-04T03:01:20Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-5 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310 active-trail active"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together." class="active-trail active">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&amp;team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Modeling}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-modeling-menu" class="block block-menu"><br />
<br />
<h2>Model It</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last leaf active-trail"><a href="/Team:NYU_Gallatin/Modeling" title="" class="active-trail active">Modeling</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Modeling</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-5" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><h1>Bio Synthetic Pathways</h1><br />
<p></p><center><img src="http://farm9.staticflickr.com/8175/8052145533_c321d3ac67_z.jpg" /></center><br />
<h1>Codonizer</h1><br />
<p>To ensure that our modeling worked, we ran our sequences through a custom developed codon optimizer. Try it our yourself below! Drop in a chunk of DNA data and click "Optimize Codons" to have your sequence optimized for the acetobacter preferred codons.</p><br />
<p><textarea name="codons" id="old-codons" rows="10" cols="80"></textarea><input type="button" id="optimize-codons" value="Optimize Codons" /></p><br />
<div id="new-codons"></div><br />
<p>Upon completion of the iGEM competition we would like to expand our Codonizer software to support other strains. A mockup of what this tools will look like is provided below.</p><br />
<p></p><center><img src="http://farm9.staticflickr.com/8460/8052465891_a67ab6b567.jpg" /></center><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Modeling
Team:NYU Gallatin/Modeling
2012-10-04T03:00:03Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-5 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310 active-trail active"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together." class="active-trail active">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Modeling}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-modeling-menu" class="block block-menu"><br />
<br />
<h2>Model It</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last leaf active-trail"><a href="/Team:NYU_Gallatin/Modeling" title="" class="active-trail active">Modeling</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Modeling</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-5" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><h1>Bio Synthetic Pathways</h1><br />
<p></p><center><img src="http://farm9.staticflickr.com/8175/8052145533_c321d3ac67_z.jpg" /></center><br />
<h1>Codonizer</h1><br />
<p>To ensure that our modeling worked, we ran our sequences through a custom developed codon optimizer. Try it our yourself below! Drop in a chunk of DNA data and click "Optimize Codons" to have your sequence optimized for the acetobacter preferred codons.</p><br />
<p><textarea name="codons" id="old-codons" rows="10" cols="80"></div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Notebook
Team:NYU Gallatin/Notebook
2012-10-04T02:53:36Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-notebook" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584 active-trail active"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos." class="active-trail active">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Notebook}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-notebook" class="block block-menu"><br />
<br />
<h2>Take Notes</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first leaf active-trail"><a href="/Team:NYU_Gallatin/Notebook" title="" class="active-trail active">Notebook</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Notebook/Photos" title="">Photos</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Lab Notes</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div class="view view-lab-notes view-id-lab_notes view-display-id-page view-dom-id-206bbb2a90ff685221176e80136bdc32"><br />
<br />
<br />
<br />
<div class="view-content"><br />
<table class="views-table cols-3" ><br />
<thead><br />
<tr><br />
<th class="views-field views-field-field-sub-team" ><br />
Team </th><br />
<th class="views-field views-field-created" ><br />
Date </th><br />
<th class="views-field views-field-body" ><br />
Note </th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr class="odd views-row-first"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/26/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Biobrick cloning:</p><br />
<p>I used the purified DNA pieces from 8.22.12 that Steven and Min purified (they’ve been at -20C so they should be okay). </p><br />
<p>Alkaline phosphatase the A-backbone:</p><br />
<p>10 uL DNA<br /><br />
4 uL sterile H2O<br /><br />
4 uL 10x buffer<br /><br />
2 ul alk phos enzyme<br /><br />
20 ul total</p><br />
<p>3’ overhangs require 15 min incubation at 37C (5’ overhangs require 60 min). SpeI leaves 3’ overhangs. Incubate 15 min at 37C...actually 45 min because the water bath isn’t up to inactivation temp.<br /><br />
Heat inactivate the enzyme 5 min at 65C.</p><br />
<p>Ligate: </p><br />
<p>2 uL A-pSC1C3<br /><br />
4 uL N<br /><br />
2 uL H2O<br /><br />
1 uL 10X ligase buffer<br /><br />
1 uL ligase<br /><br />
10 uL total</p><br />
<p>Also set up one ligation without insert (no N). Make up the volume with water so total is still 10 uL.</p><br />
<p>Incubate 1 h at RT. </p><br />
<p>Transform by heat shock transformation protocol into commercially competent DH5alpha cells. 2 transformation: one with 2 ul ligation, one with 8 ul ligation. Plate on LB-chlor plates. Incubate at 37C overnight.</p><br />
<p>During this time, we purified the DNA digested yesterday. We will ligate tomorrow using this DNA if today’s transformation is unsuccessful.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/25/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The following PCR conditions did not work:</p><br />
<p>Reducing the primer:template ratio 10x<br /><br />
Increasing the primer:template ratio 10x<br /><br />
Setting the annealing temp to 57C or 60C<br /><br />
Lowering the annealing temp to 45C for 2 cycles and 50C for the remaining 30 cycles.<br /><br />
The primers are probably not good. </p><br />
<p>More NAG1 and UAP1 DNA inserts were liberated with SpeI and PstI. Plasmid containing A was linearized with SpeI. </p><br />
<p><img src="http://farm9.staticflickr.com/8033/8049412231_f44c508082_n.jpg" /></p><br />
<p>The correct pieces of DNA (circled) were cut out and put in the freezer, to be purified later</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/19/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>We filled 2 more molds, 10R and unknown. Our biggest problem so far is cracks and holes; its unknown the best way to do it, as the tape might be the reason for contamination. Temp: 29.5</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/19/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Restriction Enzyme Digest #2 (re-run):<br /><br />
Increasing amount of DNA from 10ul to 15ul</p><br />
<p>15ul DNA<br /><br />
2ul NEBuffer 2<br /><br />
1ul BSA<br /><br />
1ul EcoRI<br /><br />
1ul PstI<br /><br />
20ul Total</p><br />
<p>Reaction ran for 30+ minutes.</p><br />
<p>Gel Electrophoresis:<br /><br />
For loading dye, using only bromophenol blue (runs at 500bp)<br /><br />
Running on 7% gel: 1.05g agarose for 150ml volume TAE</p><br />
<p>2ul of 10x Bromophenol Blue loading dye<br /><br />
20ul of DNA<br /><br />
mix, total in each lane = 20ul<br /><br />
Set to run for 30 minutes.</p><br />
<p>Same results as yesterday.</p><br />
<p>Made 4ml cultures of new colonies: clones #16-22 are in the incubator at 11:40pm along with a neg. growth control tube..</p><br />
<p>PCR with A gene is running.</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/18/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>No growth in colonies 3, 4, 7, and negative control for growth.<br /><br />
Ellen did plasmid minipreps of colonies 1, 2, 5, 6, 8 - 15.</p><br />
<p>Restriction Digest (12 plasmid preps total) with EcoR1 and Pst1 was run at 37*C at 9:45pm for 30 minutes.</p><br />
<p>Master Cocktail (13):<br /><br />
52ul H2O<br /><br />
13ul PstI<br /><br />
13ul EcoRI-HF<br /><br />
26ul 10x NEBuffer 2<br /><br />
26ul 10x BSA<br /><br />
TOTAL = 130ul</p><br />
<p>10ul of cocktail mix and 10ul of DNA were combined.</p><br />
<p>RE digest products were run on a 1% gel for 40 minutes to see if an insert of 4kb comes out of the 2kb pSB1C3:</p><br />
<p>20ul DNA digest product<br /><br />
2ul of 10x bromophenol blue + xylene cyanol dye.<br /><br />
Mixed and loaded 20ul in each lane.</p><br />
<p>Lane 1: 10ul 1kb PLUS ladder<br /><br />
Lane 2: 20ul of colony 1<br /><br />
Lane 3: 20ul of colony 2<br /><br />
Lane 4: 20ul of colony 5<br /><br />
Lane 5: 20ul of colony 6<br /><br />
Lane 6: 20ul of colony 8<br /><br />
Lane 7: 20ul of colony 9<br /><br />
Lane 8: 20ul of colony 10<br /><br />
Lane 9: 20ul of colony 11<br /><br />
Lane 10: 20ul of colony 12<br /><br />
Lane 11: 20ul of colony 13<br /><br />
Lane 12: 20ul of colony 14<br /><br />
Lane 13: 20ul of colony 15</p><br />
<p>Results:</p><br />
<p><img src="http://farm9.staticflickr.com/8176/8049402211_63b5a9d244_m.jpg" /></p><br />
<p>Cannot see 4kb insert in any lanes, and can see 2kb backbone in lanes 13, 14, 15.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/17/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Two more molds were contaminated, but there are solid growths on both the tubes and most molds. We filled four but unfortunately, we ran out of substrates and the autoclave was malfunctioning. Temp in incubator lowered to 29C</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/17/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Both plates showed colony growth, with Gibson Construct plate #1 (higher dilution) showing more growth than Gibson Construct plate #2 (lower dilution).<br /><br />
Negative control (E. coli no plasmid) showed no growth.</p><br />
<p>Made Chlor LB broth media:<br /><br />
250ml LB<br /><br />
184ul stock Chloramphenicol per 50ml</p><br />
<p>Picked 15 colonies and grew overnight in 4ml culture tubes<br /><br />
Used older LB broth in fridge. Poured one negative control for growth.<br /><br />
All in incubator at 37*C overnight.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/16/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Transformed E. coli with Gibson construct were plated onto two plates (see Ellen re: dilution)</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/15/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>PCR Purification (A, N, U)<br /><br />
(Invitrogen)</p><br />
<p>· Add 4 volumes of PureLink Binding Buffer (B2) with isopropanol to 1 volume of the PCR product (50–100 μL). Mix well.<br /><br />
· Add the sample with the appropriate Binding Buffer (from step 1 of this procedure) to the PureLink Spin Column.<br /><br />
· Centrifuge the column at room temperature at 10,000 × g for 1 minute. (Discard the flow through)<br /><br />
· Add 650 μL of Wash Buffer with ethanol to the column.<br /><br />
· Centrifuge the column at room temperature at 10,000 × g for 1 minute. Discard the flow through from the collection tube and place the column into the tube.<br /><br />
· Centrifuge the column at maximum speed at room temperature for 2–3 minutes to remove any residual Wash Buffer. Discard the collection tube.<br /><br />
· Place the spin column in a clean 1.7-mL PureLink Elution Tube supplied with the kit.<br /><br />
· Add 50 μL of Elution Buffer<br /><br />
· Incubate the column at room temperature for 1 minute.<br /><br />
· Centrifuge the column at maximum speed for 2 minutes.<br /><br />
· The elution tube contains the purified PCR product. Remove and discard the column. The recovered elution volume is ~48 μL.</p><br />
<p>Made 1% Gel</p><br />
<p>· Ran in a gel for ~15-20 min<br /><img src="http://farm9.staticflickr.com/8458/8049392368_8984aff729_m.jpg" /><br /><br />
N U A(in plasmid) MWM</p><br />
<p>Cutting the gel and purifying</p><br />
<p>· Equilibrate a water bath 50 C<br /><br />
· Cut the gel<br /><br />
· 3 volumes (288ul)<br /><br />
· Place it in water bath for 10min<br /><br />
· Additional 5min</p><br />
<p>Purification procedure using centrifugation</p><br />
<p>· Load the dissolved gel mixture with DNA onto the center of a pure link wash tube<br /><br />
· Centrifuge the column at room temperature at 10,000 × g for 1 minute. (Discard the flow through)<br /><br />
· Add 650 μL of Wash Buffer with ethanol to the column.<br /><br />
· Centrifuge the column at room temperature at 10,000 × g for 1 minute. Discard the flow through from the collection tube and place the column into the tube.<br /><br />
· Centrifuge the column at maximum speed at room temperature for 2–3 minutes to remove any residual Wash Buffer. Discard the collection tube.<br /><br />
· Place the spin column in a clean 1.7-mL PureLink Elution Tube supplied with the kit.<br /><br />
· Add 50 μL of Elution Buffer<br /><br />
· Incubate the column at room temperature for 1 minute.<br /><br />
· Centrifuge the column at maximum speed for 2 minutes.<br /><br />
· The elution tube contains the purified PCR product. Remove and discard the column. The recovered elution volume is ~48 μL.</p><br />
<p>PCR<br /><br />
10ul plasmid prep a4<br /><br />
1ul 10X buffer<br /><br />
1ul Spe1</p><br />
<p>Made 1% Gel for PCR Purification for plasmid prep a4<br /><br />
(Also ran with Nag1 and Uap1)<br /><br />
First well DNA ladder (New England Bio quick-load), second well AGM1 plasmid,<br /><br />
Third well NAG1, and fourth well UAP1</p><br />
<p><img src="http://farm9.staticflickr.com/8173/8049394500_1f00f5c7ef_n.jpg" /></p><br />
<p>Very little yield for linearized AGM1 plasmid but it is there. Std was 5uL, all others 10uL per lane. The smaller. The frag the more efficient the purification.</p><br />
<p>Transformation (Gibbson assembly)</p><br />
<p>Version 1 Version 2</p><br />
<p>7ul AGM1 plasmid 9ul AGM1 plasmid<br /><br />
1ul NAG1 0.5 NAG1<br /><br />
2ul UAP1 0.5 UAP1</p><br />
<p> 10ul 10ul<br /><br />
+ 10ul master mix + 10ul master mix</p><br />
<p>20ul total 20ul total </p><br />
<p>*PCR (version 1 and version 2) is in PCR machine</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/14/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>I filled two molds and was unable to fill more since the autoclave was being used and it could not wait to autoclave more. Incubator temp 31</p><br />
<p>The lab strains look the same. Ph same as well as temp</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/12/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Lab strain looks much better and uniform from last time, a sheet is expected. Ph 4. 5<br /><br />
Wild strain is not growing quickly but its growth seems more concentrated. Ph 4<br /><br />
Temp. 23.5 degrees.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/10/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The 10 beakers were moved to the incubator, temp. 30. Two more molds were. Contaminated and will be filled in. In all we filled 4 molds and 11 small tubes for test samples.</p><br />
<p>Kombucha-temp is 23. 5 in cabinet.<br /><br />
Assessment.<br /><br />
One of the lab strain, aceto food is growing weakly. There seems to be a particle floating inside.<br /><br />
Ph 4</p><br />
<p>Lab strain in blueberry juice is contaminated. Ph 2</p><br />
<p>Wild kombucha is growing best but still weakly. Ph 4. 5</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/07/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>We moved the molds out of the incubator and into cabinets in the lab. Four from before were contaminated, they were cleaned and four more molds were made. 5 star shapes were also put together.<br /><br />
Ten smaller beakers were also inoculated with the mycelia and were originally in the fan space (fan off).</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/06/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Came into lab. Jimmy had already made the substrate, we filled out 5 of the 9 molds needed with the oak pellet substrate. To avoid contamination, we wrapped the finished molds in plastic wrap. We also used aluminum star shaped containers, in order to create smaller molds. Two and a half. All molds were made with h2o2 mycelium. No new contaminants, though one seems to be developed.</p><br />
<p>Kombucha. Made three with lab strain scoby, two with aceto food, one with blueberry juice</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/04/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Came into lab today, 7 out of 16 molds were contaminated. It seems like the tapes used to seal up cracks are the culprits as most of the mold growing seemed to originate at the tapes. There needs to be a better way to seal things up. what was done: we merely cleaned out the contaminated trays and are leaving the rest for tomorrow.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/24/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><b>Ligation & Transformation</b></p><br />
<p>Two ligation reactions:<br /><b>First rnx is Labeled “Lig 1 SH 8/24”</b><br /><br />
4 ul purified A + pSB1C3<br /><br />
4 ul purified N<br /><br />
1 ul 10x T4 ligase buffer<br /><br />
1 ul T4 ligase<br /><br />
10 ul total</p><br />
<p>The second one (that is a bit of a crapshoot but could potentially put all three pieces together):<br /><b>Second rnx is Labeled “Lig 2 SH 8/24”</b><br /><br />
2 ul purified A + pSB1C3<br /><br />
3 ul purified N<br /><br />
3 ul purified U<br /><br />
1 ul 10x T4 ligase buffer<br /><br />
1 ul T4 ligase<br /><br />
10 ul total</p><br />
<p>Centrifuged for 20 seconds at 2.0rcf because T4 ligase was pipetted onto the side of the tube for Lig 2.<br /><br />
Began rnx at 7:58pm, running for 31 minutes on the timer.</p><br />
<p>Incubate at room temperature for 30 min to 1 h.</p><br />
<p>*** We should have used CIP/phosphatase so that the AGM1 gene with the pSB1C3 vector cannot religate... Since we did not, we are expecting to see more religated plasmids without the intended inserts for both Lig 1 and Lig 2 rnx’s. </p><br />
<p><b>Transformation set up for Ligation 1 and Ligation 2:</b></p><br />
<p>Pellet for 8.4rcf</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/23/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>PCR products of the N and U gene plasmid digests were retrieved and run on a 1% gel at 3:08pm for about 40 minutes.</p><br />
<p>5ul of 1KB Plus DNA ladder</p><br />
<p>2uL PCR product<br /><br />
2ul Xylene Cyanol loading dye<br /><br />
10ul H2O<br /><br />
14ul total</p><br />
<p>Lane 1: empty<br /><br />
Lane 2: 1KB PLUS DNA ladder<br /><br />
Lane 3: Tube A (NAG1)<br /><br />
Lane 4: Tube B (NAG1) + MgCl<br /><br />
Lane 5: Tube C (UAP1)<br /><br />
Lane 6: Tube D (UAP1) + MgCl<br /><br />
(Recall that we did not have the proper reverse primer for AGM1, so this was not included)</p><br />
<p><b>Predicted band sizes:</b><br /><br />
Lane 3: 747kb<br /><br />
Lane 4: 747kb<br /><br />
Lane 5: 1461kb<br /><br />
Lane 6: 1461kb<br /><br />
(with lanes 4 and 6 showing more distinct bands, if the PCR reaction was enhanced by the MgCl cofactor)</p><br />
<p>Also, running the gel for 40 minutes was way too long-- next time only 25-30 so our product doesn’t go off the gel!</p><br />
<p>Results:<br /><img src="http://farm9.staticflickr.com/8450/8049380964_fd22eba205_m.jpg" /></p><br />
<p>PCR products (tubes A, B, C, D) are in the hot pink “Cloning Materials” box and labeled “Genes N/U RE & PCR Products 8/23”</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/22/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>We purified our PCR products via miniprep. Only then did we look more closely at the gel to see that our "products" were in the 250-400 bp range, when we expect 800-1600 bp range. Clearly the PCRs failed. </p><br />
<p>In examining the cause of PCR failure more closely, we realized that the reverse primer for gene 1 (AGM1) is incorrect. The reverse complement of the forward sequence was never generated (see the "primers" google document to confirm this). The good news is that it's easy to generate the correct sequence and order the primer. The bad news is that we can't do the final gibson assembly without it. </p><br />
<p>To troubleshoot the PCRs that should have worked (NAG1 and UAP1), we are running PCRs again overnight. We are using different concentrations of primer/template and testing different Mg2+ concentrations. This time our reactions looked like:</p><br />
<p>Forward primer (10 uM): 1 ul<br /><br />
Reverse primer (10 uM): 1 ul<br /><br />
template DNA: 1 ul<br /><br />
H2O: 22 ul</p><br />
<p>OR</p><br />
<p>Forward primer (10 uM): 1 ul<br /><br />
Reverse primer (10 uM): 1 ul<br /><br />
template DNA: 1 ul<br /><br />
100 mM MgCl: 1 ul<br /><br />
H2O: 21 ul</p><br />
<p>Our PCR cofactor (1% MgCl2) was:<br /><br />
900ul H2O<br /><br />
100ul 1M MgCl2</p><br />
<p><b>A Tube: NAG1</b><br /><br />
1ul of Forward Primer 1 (Gene 2F)<br /><br />
1ul of Reverse Primer 2 (Gene 2R)<br /><br />
1ul of Template (NAG1-5)<br /><br />
22ul of H2O<br /><br />
25ul Total</p><br />
<p><b>B Tube: NAG1 with MgCl cofactor</b><br /><br />
1ul of Forward Primer (Gene 2F)<br /><br />
1ul of Reverse Primer (Gene 2R)<br /><br />
1ul of Template (NAG1-5)<br /><br />
1ul MgCl solution<br /><br />
21ul of H2O<br /><br />
25ul Total</p><br />
<p><b>C Tube: UAP1</b><br /><br />
1ul of Forward Primer 1 (Gene 3F)<br /><br />
1ul of Reverse Primer 2 (Gene 3R)<br /><br />
1ul of Template (UAP1-3)<br /><br />
22ul of H2O<br /><br />
25ul Total</p><br />
<p><b>D Tube: UAP1 with MgCl cofactor</b><br /><br />
1ul of Forward Primer 1 (Gene 3F)<br /><br />
1ul of Reverse Primer 2 (Gene 3R)<br /><br />
1ul of Template (NAG1-5)<br /><br />
1ul MgCl solution<br /><br />
21ul of H2O<br /><br />
25ul Total</p><br />
<p>We also decided to start cloning the classic digest-and-ligate way using our genes which are already in the biobrick plasmids. We digested AGM1 plasmid with SpeI (thus linearizing it). We digested NAG1 and UAP1 plasmids with SpeI and XbaI, liberating the genes (and RBS) from their backbone plasmids. </p><br />
<p><b>AGM Plasmid:</b><br /><br />
3ul AGM1 Plasmid<br /><br />
2ul Buffer<br /><br />
1ul SpeI<br /><br />
0ul XbaI<br /><br />
14ul H2O<br /><br />
20ul Total</p><br />
<p><b>NAG Plasmid:</b><br /><br />
3ul NAG1 Plasmid<br /><br />
2ul Buffer<br /><br />
1ul SpeI<br /><br />
1ul XbaI<br /><br />
13ul H2O<br /><br />
20ul Total</p><br />
<p><b>UAP Plasmids:</b><br /><br />
3ul UAP Plasmid<br /><br />
2ul Buffer<br /><br />
1ul SpeI<br /><br />
1ul XbaI<br /><br />
13ul H2O<br /><br />
20ul Total</p><br />
<p>We ran a gel of our digests, and they look great - the exact sizes we expected (I will attach it later). Another confirmation that our minipreps contain the genes we expect them to (even if we don't have the full sequence). We cut the pieces out of the gel that were the correct sizes and gel purified them. They are in the fridge and ready to ligate together.</p><br />
<p><img src="http://farm9.staticflickr.com/8456/8049368751_497bdfabb9_m.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/21/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>We ran a gel to confirm that we have PCR products of expected sizes. I glanced only quickly at the gel, saw that there were some bands (admittedly diffuse but the gel itself was a week old). The gel is attached (sad gel.png). Its name will become clear tomorrow.</p><br />
<p><img src="http://farm9.staticflickr.com/8030/8049366364_94191cecc0_m.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/20/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>We set up PCRs of the genes using primers containing overlapping sequences. For each PCR, we diluted the dessicated reagents (Taq Polymerase, dNTPs, MgCl, buffer) in the following:</p><br />
<p>Forward primer (10 uM): 2 ul<br /><br />
Reverse primer (10 uM): 2 ul<br /><br />
template DNA: 3 ul<br /><br />
H2O: 18 ul</p><br />
<p>(I may be off. I didn't take notes here. If I'm wrong and you remember, please let me know.)</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/17/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The DNA sequences came back. None of the forward reactions worked (especially surprising as these primers were supplied by iGEM headquarters). Of the reverse reactions, some worked and some didn't. There was no read for the NAG1 gene, for example, but as we only had one digest that looked positive, we have to move forward with this clone (for now). </p><br />
<p>The best hits were: </p><br />
<p>AGM1 - clone 4<br /><br />
NAG1 - clone 5<br /><br />
UAP1 - clone 3</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/16/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The cultures were well grown the next day (and the original colonies were still white, a promising sign). We miniprepped the plasmids from the cultures, and then used an XbaI/SpeI digest to identify plasmids with the correct-sized inserts. The expected sizes for the DNA fragments:</p><br />
<p>1.6 kB - AGM1<br /><br />
0.7 kB - NAG1<br /><br />
1.5 kB - UAP1<br /><br />
2.1 kB - biobrick plasmid<br /><img src="http://farm9.staticflickr.com/8460/8049355440_bf0b721d5e_m.jpg" /><br /><br />
All of the positive hits had bands of these expected sizes. Some of them had larger bands that add to a singly-cut plasmid (insert + backbone, e.g., AGM1 + biobrick plasmid, i.e., 1.6 kB + 2.1 kB = 3.7 kB) but the ones we considered positive contained only predicted sized bands - no miscellaneous weirdos. </p><br />
<p>The digests were run on a 1% agarose gel. I've attached the picture (gel annotated.png) that shows the inserts with the correct sized bands (the samples with the asterisks). These were sent for sequencing using the VF and VR (verify forward and verify reverse) primers.</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/15/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The next day we had lots of colonies (I don't have the pictures of the plates, but maybe someone else does). Many of these were red, indicating they were transformed due to residual RFP plasmid (as had happened previously). We circled several white colonies as prospective positive transformants. For each construct, we chose 5 clones and inoculated 4 ml of LB-chlor to grow these overnight at 37 deg C.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/14/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The second gibson assemblies that we did worked! We followed Ellen's advice to increase the G-bit DNA concentration. This means our final assembly reactions looked like this:</p><br />
<p>2.5 ul pSB1C3 (biobrick backbone plasmid DNA, linearized)<br /><br />
7.5 ul G-bit DNA*<br /><br />
10 ul master mix<br /><br />
20 ul total</p><br />
<p>* we divided the volume left by the number of G-bit parts. For NAG1, there were 3 parts, so each took up 2.5 ul. For UAP 1, there were 4 parts, so each took up 1.8 ul. For AGM1, there were 5 parts, so each took up 1.5 ul.</p><br />
<p>We incubated these for 1 hr at 50 deg C and then immediately transformed the commercial competent cells.</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/12/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Gibson, Transformation:<br /><br />
So instead of 50 fentomoles of each, try 100 but 50 of the plasmid as before. I think we have room in the 10 microliters for that. And maybe close the lid of the PCR machine?</p><br />
<p>Gibson assembly protocol</p><br />
<p>-reaction is in 0.2mL PCR tube using program “Gibson” under user “ellen”<br /><br />
50C for 1h, hold at 4C<br /><br />
-total reaction volume is 20 microliters<br /><br />
-all G-Blocks were resuspended at a concentration of 50 fentomoles per microliter<br /><br />
-TOTAL amount of DNA in tube (sum of all parts) should be between 200-1000 fentomoles. NOTE: last time we were at the low end of this!</p><br />
<p>Recommended procedure:<br /><br />
For ‘U’<br /><br />
1.85 µL U-1<br /><br />
1.85 µL U-2<br /><br />
1.85 µL U-3<br /><br />
1.85 µL U-4<br /><br />
2.6 µL pSB1C3<br /><br />
10.0 µL Gibson Master Mix<br /><br />
20.0 µL</p><br />
<p>For ’N’<br /><br />
2.5 µL N-1<br /><br />
2.5 µL N-2<br /><br />
2.5 µL N-3<br /><br />
2.5 µL pSB1C3<br /><br />
10.0 µL Gibson Master Mix<br /><br />
20.0 µL</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/10/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8174/8048768673_d51ef329a3.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/10/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Results of Gibson Assembly:<br /><br />
4 big plates of the 3 chitin path genes A, U, and N, a + control<br /><br />
2 small plaets: neg control, baseline control without antibio</p><br />
<p>Results:</p><br />
<p>Lawn on antibiotic free control</p><br />
<p>Some contamination on A & U plates</p><br />
<p>No growth on N, + Control plates</p><br />
<p>[PASTE ALL PHOTOS FROM ALEX EMAIL AFTER RESIZING]</p><br />
<p>Pink colonies may be traces of RFP plasmids remaining from when biobrick plasmid part was PCR’ed.</p><br />
<p>Reasons for failure could be:</p><br />
<p>1) use the heated lid on the PCR machine - I did not shut it because I thought it might jack up the temp.<br /><br />
2) the manual says to use a 2-3x overage of inserts to backbone. The tech service guy said use equimolar so we did. maybe we need to rethink that.<br /><br />
3) overall total conc of DNA in the rxn mix could be upped.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/08/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Notes for NAG1 Gibson</p><br />
<p>N-1 87163240<br /><br />
163696916 Date Ordered: 3rd Aug, 2012<br /><br />
200 ng = 1012.2 fmol</p><br />
<p>N-2 87163241<br /><br />
163696911 Date Ordered: 3rd Aug, 2012<br /><br />
200 ng - 1005.9 fmol</p><br />
<p>N-3 87163242<br /><br />
163696921 Date ordered: 3rd Aug, 2012<br /><br />
200 ng = 978.5 fmol</p><br />
<p>Gibson Assembly Master Mix<br /><br />
#E26115 Exp: 6/13<br /><br />
Lot: 0031206</p><br />
<p>PSBIC3<br /><br />
Biobrick Plasmid 2071 bases<br /><br />
650 * 2071 =<br /><br />
Mol. Weight: 1.346 x 106 fg/fmol</p><br />
<p>N1<br /><br />
10012.2 fmol / 20 μL<br /><br />
= 50.61 fmol/ μL<br /><br />
N2<br /><br />
1005.9 fmol / 20 μL<br /><br />
= 50.29 fmol/ μL<br /><br />
N3<br /><br />
978.5 fmol / 19 μL<br /><br />
= 51.50 fmol/ μL</p><br />
<p>4.3 μL water<br /><br />
+ 2.7 μL PSB1C3<br /><br />
+ 1.0 μL N1 (Concentration - 50.61 fmol/μL)<br /><br />
+ 1.0 μL N2 (Concentration - 50.29 fmol/μL)<br /><br />
+ 1.0 μL N3 (Concentration - 51.50 fmol/μL)<br /><br />
+ 10 μL Mastermix<br /><br />
= 20 μL</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
</td><br />
<td class="views-field views-field-created" ><br />
Aug/08/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8458/8048768341_cd215f8a44.jpg" /><br /><img src="http://farm9.staticflickr.com/8314/8048768463_ebf452dfea.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/07/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8313/8048773304_9ce0f49fd2.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/06/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>G-blocks arrived</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/04/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8451/8048765553_1ffd507e36.jpg" /><br /><img src="http://farm9.staticflickr.com/8172/8048770556_2604c4a9b2.jpg" /><br /><img src="http://farm9.staticflickr.com/8316/8048765169_52ca13cda9_n.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/03/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8450/8048766095_c94a54efd5.jpg" /><br /><img src="http://farm9.staticflickr.com/8313/8048765937_f6fd019924.jpg" /><br /><img src="http://farm9.staticflickr.com/8180/8048770890_12ba62d1a7.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/02/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8318/8048766337_a5795fb13d.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/01/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8182/8048766707_9cb88da4d7.jpg" /><br /><img src="http://farm9.staticflickr.com/8171/8048771682_17e08a6f17.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/30/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8179/8048766867_8c6cc28dd4.jpg" /><br /><img src="http://farm9.staticflickr.com/8174/8048767007_9a47831e22.jpg" /><br /><img src="http://farm9.staticflickr.com/8455/8048772414_005410d2f1.jpg" /><br /><img src="http://farm9.staticflickr.com/8169/8048767529_8993906e3d.jpg" /><br /><img src="http://farm9.staticflickr.com/8318/8048767697_95e77a28af.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/20/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8033/8048772282_58fab176aa.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even views-row-last"><br />
<td class="views-field views-field-field-sub-team" ><br />
Growing </td><br />
<td class="views-field views-field-created" ><br />
Jun/09/2012 </td><br />
<td class="views-field views-field-body" ><br />
<ol><li>Almost no growth, very thin film.</li><br />
<li>Cellulose very thin, seems to have grown on bottom (not top)</li><br />
<li>Thin growth, not measurable from sides, but def more significant than just scoby.</li><br />
<li>Super thick from bubbles, accidentally popped it. A little thicker than #9.</li><br />
<li>Infested w/ flies. Nice growth, not in a sheet, disposing.</li><br />
<li>Pretty thick, made a little pillow from the air bubbles.</li><br />
<li>Thin growth along top.</li><br />
<li>Thin growth along top.</li><br />
<li>Nice sheet, 2nd to 10+13.</li><br />
<li>Very thick cellulose, abt 1-2mm growth.</li><br />
<li>Thickest non-BB. Weird flakes (brown) everywhere.</li><br />
<li>Thin growth, a little thicker than the other thins.</li><br />
<li>Almost entirely cellulose, very little liquid left.</li><br />
</ol> </td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
</div> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Notebook/Photos
Team:NYU Gallatin/Notebook/Photos
2012-10-04T02:51:15Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-19 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Notebook}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-notebook" class="block block-menu"><br />
<br />
<h2>Take Notes</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Notebook" title="">Notebook</a></li><br />
<li class="last leaf active-trail"><a href="/Team:NYU_Gallatin/Notebook/Photos" title="" class="active-trail active">Photos</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Photos</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-19" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><div id="flickr-images">Loading Images...</div><br />
<script type="text/javascript"><br />
<!--//--><![CDATA[// ><!--<br />
<br />
setTimeout(function() {$.getJSON(flickr_main_url, displayImages);},1500);<br />
function displayImages(data) {<br />
// Start putting together the HTML string<br />
var htmlString = "";<br />
<br />
// Now start cycling through our array of Flickr photo details<br />
$.each(data.items, function(i,item){<br />
// I only want the ickle square thumbnails<br />
var sourceSquare = (item.media.m).replace("_m.jpg", "_q.jpg");<br />
// var sourceSquare = item.media.m;<br />
var l_sourceSquare = (item.media.m).replace("_m.jpg", "_b.jpg");<br />
<br />
// Here's where we piece together the HTML<br />
htmlString += '<li><a href="'+l_sourceSquare+'" rel="lightbox">';<br />
htmlString += '<img title="' + item.title + '" src="' + sourceSquare;<br />
htmlString += '" alt="'; htmlString += item.title + '" />';<br />
htmlString += '';<br />
});<br />
<br />
// Pop our HTML in the #images DIV<br />
$('#flickr-images').html(htmlString);<br />
<br />
// Close down the JSON function call<br />
}<br />
<br />
//--><!]]><br />
</script><p><br />
<a href="http://www.flickr.com/photos/85815851@N04/" target="_new">Check out our Flickr to see all of our photos!</a></p><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Notebook
Team:NYU Gallatin/Notebook
2012-10-04T02:50:51Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-notebook" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584 active-trail active"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos." class="active-trail active">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Notebook}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-notebook" class="block block-menu"><br />
<br />
<h2>Take Notes</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first leaf active-trail"><a href="/Team:NYU_Gallatin/Notebook" title="" class="active-trail active">Notebook</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Notebook/Photos" title="">Photos</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Lab Notes</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div class="view view-lab-notes view-id-lab_notes view-display-id-page view-dom-id-39c767fae3a156bb6d2ddba5c9f9ba4a"><br />
<br />
<br />
<br />
<div class="view-content"><br />
<table class="views-table cols-3" ><br />
<thead><br />
<tr><br />
<th class="views-field views-field-field-sub-team" ><br />
Team </th><br />
<th class="views-field views-field-created" ><br />
Date </th><br />
<th class="views-field views-field-body" ><br />
Note </th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr class="odd views-row-first"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/26/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Biobrick cloning:</p><br />
<p>I used the purified DNA pieces from 8.22.12 that Steven and Min purified (they’ve been at -20C so they should be okay). </p><br />
<p>Alkaline phosphatase the A-backbone:</p><br />
<p>10 uL DNA<br /><br />
4 uL sterile H2O<br /><br />
4 uL 10x buffer<br /><br />
2 ul alk phos enzyme<br /><br />
20 ul total</p><br />
<p>3’ overhangs require 15 min incubation at 37C (5’ overhangs require 60 min). SpeI leaves 3’ overhangs. Incubate 15 min at 37C...actually 45 min because the water bath isn’t up to inactivation temp.<br /><br />
Heat inactivate the enzyme 5 min at 65C.</p><br />
<p>Ligate: </p><br />
<p>2 uL A-pSC1C3<br /><br />
4 uL N<br /><br />
2 uL H2O<br /><br />
1 uL 10X ligase buffer<br /><br />
1 uL ligase<br /><br />
10 uL total</p><br />
<p>Also set up one ligation without insert (no N). Make up the volume with water so total is still 10 uL.</p><br />
<p>Incubate 1 h at RT. </p><br />
<p>Transform by heat shock transformation protocol into commercially competent DH5alpha cells. 2 transformation: one with 2 ul ligation, one with 8 ul ligation. Plate on LB-chlor plates. Incubate at 37C overnight.</p><br />
<p>During this time, we purified the DNA digested yesterday. We will ligate tomorrow using this DNA if today’s transformation is unsuccessful.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Alex<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/25/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The following PCR conditions did not work:</p><br />
<p>Reducing the primer:template ratio 10x<br /><br />
Increasing the primer:template ratio 10x<br /><br />
Setting the annealing temp to 57C or 60C<br /><br />
Lowering the annealing temp to 45C for 2 cycles and 50C for the remaining 30 cycles.<br /><br />
The primers are probably not good. </p><br />
<p>More NAG1 and UAP1 DNA inserts were liberated with SpeI and PstI. Plasmid containing A was linearized with SpeI. </p><br />
<p><img src="http://farm9.staticflickr.com/8033/8049412231_f44c508082_n.jpg" /></p><br />
<p>The correct pieces of DNA (circled) were cut out and put in the freezer, to be purified later</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/19/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>We filled 2 more molds, 10R and unknown. Our biggest problem so far is cracks and holes; its unknown the best way to do it, as the tape might be the reason for contamination. Temp: 29.5</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Jesse<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/19/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Restriction Enzyme Digest #2 (re-run):<br /><br />
Increasing amount of DNA from 10ul to 15ul</p><br />
<p>15ul DNA<br /><br />
2ul NEBuffer 2<br /><br />
1ul BSA<br /><br />
1ul EcoRI<br /><br />
1ul PstI<br /><br />
20ul Total</p><br />
<p>Reaction ran for 30+ minutes.</p><br />
<p>Gel Electrophoresis:<br /><br />
For loading dye, using only bromophenol blue (runs at 500bp)<br /><br />
Running on 7% gel: 1.05g agarose for 150ml volume TAE</p><br />
<p>2ul of 10x Bromophenol Blue loading dye<br /><br />
20ul of DNA<br /><br />
mix, total in each lane = 20ul<br /><br />
Set to run for 30 minutes.</p><br />
<p>Same results as yesterday.</p><br />
<p>Made 4ml cultures of new colonies: clones #16-22 are in the incubator at 11:40pm along with a neg. growth control tube..</p><br />
<p>PCR with A gene is running.</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/18/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>No growth in colonies 3, 4, 7, and negative control for growth.<br /><br />
Ellen did plasmid minipreps of colonies 1, 2, 5, 6, 8 - 15.</p><br />
<p>Restriction Digest (12 plasmid preps total) with EcoR1 and Pst1 was run at 37*C at 9:45pm for 30 minutes.</p><br />
<p>Master Cocktail (13):<br /><br />
52ul H2O<br /><br />
13ul PstI<br /><br />
13ul EcoRI-HF<br /><br />
26ul 10x NEBuffer 2<br /><br />
26ul 10x BSA<br /><br />
TOTAL = 130ul</p><br />
<p>10ul of cocktail mix and 10ul of DNA were combined.</p><br />
<p>RE digest products were run on a 1% gel for 40 minutes to see if an insert of 4kb comes out of the 2kb pSB1C3:</p><br />
<p>20ul DNA digest product<br /><br />
2ul of 10x bromophenol blue + xylene cyanol dye.<br /><br />
Mixed and loaded 20ul in each lane.</p><br />
<p>Lane 1: 10ul 1kb PLUS ladder<br /><br />
Lane 2: 20ul of colony 1<br /><br />
Lane 3: 20ul of colony 2<br /><br />
Lane 4: 20ul of colony 5<br /><br />
Lane 5: 20ul of colony 6<br /><br />
Lane 6: 20ul of colony 8<br /><br />
Lane 7: 20ul of colony 9<br /><br />
Lane 8: 20ul of colony 10<br /><br />
Lane 9: 20ul of colony 11<br /><br />
Lane 10: 20ul of colony 12<br /><br />
Lane 11: 20ul of colony 13<br /><br />
Lane 12: 20ul of colony 14<br /><br />
Lane 13: 20ul of colony 15</p><br />
<p>Results:</p><br />
<p><img src="http://farm9.staticflickr.com/8176/8049402211_63b5a9d244_m.jpg" /></p><br />
<p>Cannot see 4kb insert in any lanes, and can see 2kb backbone in lanes 13, 14, 15.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/17/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Two more molds were contaminated, but there are solid growths on both the tubes and most molds. We filled four but unfortunately, we ran out of substrates and the autoclave was malfunctioning. Temp in incubator lowered to 29C</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Ellen<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/17/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Both plates showed colony growth, with Gibson Construct plate #1 (higher dilution) showing more growth than Gibson Construct plate #2 (lower dilution).<br /><br />
Negative control (E. coli no plasmid) showed no growth.</p><br />
<p>Made Chlor LB broth media:<br /><br />
250ml LB<br /><br />
184ul stock Chloramphenicol per 50ml</p><br />
<p>Picked 15 colonies and grew overnight in 4ml culture tubes<br /><br />
Used older LB broth in fridge. Poured one negative control for growth.<br /><br />
All in incubator at 37*C overnight.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/16/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Transformed E. coli with Gibson construct were plated onto two plates (see Ellen re: dilution)</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/15/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>PCR Purification (A, N, U)<br /><br />
(Invitrogen)</p><br />
<p>· Add 4 volumes of PureLink Binding Buffer (B2) with isopropanol to 1 volume of the PCR product (50–100 μL). Mix well.<br /><br />
· Add the sample with the appropriate Binding Buffer (from step 1 of this procedure) to the PureLink Spin Column.<br /><br />
· Centrifuge the column at room temperature at 10,000 × g for 1 minute. (Discard the flow through)<br /><br />
· Add 650 μL of Wash Buffer with ethanol to the column.<br /><br />
· Centrifuge the column at room temperature at 10,000 × g for 1 minute. Discard the flow through from the collection tube and place the column into the tube.<br /><br />
· Centrifuge the column at maximum speed at room temperature for 2–3 minutes to remove any residual Wash Buffer. Discard the collection tube.<br /><br />
· Place the spin column in a clean 1.7-mL PureLink Elution Tube supplied with the kit.<br /><br />
· Add 50 μL of Elution Buffer<br /><br />
· Incubate the column at room temperature for 1 minute.<br /><br />
· Centrifuge the column at maximum speed for 2 minutes.<br /><br />
· The elution tube contains the purified PCR product. Remove and discard the column. The recovered elution volume is ~48 μL.</p><br />
<p>Made 1% Gel</p><br />
<p>· Ran in a gel for ~15-20 min<br /><img src="http://farm9.staticflickr.com/8458/8049392368_8984aff729_m.jpg" /><br /><br />
N U A(in plasmid) MWM</p><br />
<p>Cutting the gel and purifying</p><br />
<p>· Equilibrate a water bath 50 C<br /><br />
· Cut the gel<br /><br />
· 3 volumes (288ul)<br /><br />
· Place it in water bath for 10min<br /><br />
· Additional 5min</p><br />
<p>Purification procedure using centrifugation</p><br />
<p>· Load the dissolved gel mixture with DNA onto the center of a pure link wash tube<br /><br />
· Centrifuge the column at room temperature at 10,000 × g for 1 minute. (Discard the flow through)<br /><br />
· Add 650 μL of Wash Buffer with ethanol to the column.<br /><br />
· Centrifuge the column at room temperature at 10,000 × g for 1 minute. Discard the flow through from the collection tube and place the column into the tube.<br /><br />
· Centrifuge the column at maximum speed at room temperature for 2–3 minutes to remove any residual Wash Buffer. Discard the collection tube.<br /><br />
· Place the spin column in a clean 1.7-mL PureLink Elution Tube supplied with the kit.<br /><br />
· Add 50 μL of Elution Buffer<br /><br />
· Incubate the column at room temperature for 1 minute.<br /><br />
· Centrifuge the column at maximum speed for 2 minutes.<br /><br />
· The elution tube contains the purified PCR product. Remove and discard the column. The recovered elution volume is ~48 μL.</p><br />
<p>PCR<br /><br />
10ul plasmid prep a4<br /><br />
1ul 10X buffer<br /><br />
1ul Spe1</p><br />
<p>Made 1% Gel for PCR Purification for plasmid prep a4<br /><br />
(Also ran with Nag1 and Uap1)<br /><br />
First well DNA ladder (New England Bio quick-load), second well AGM1 plasmid,<br /><br />
Third well NAG1, and fourth well UAP1</p><br />
<p><img src="http://farm9.staticflickr.com/8173/8049394500_1f00f5c7ef_n.jpg" /></p><br />
<p>Very little yield for linearized AGM1 plasmid but it is there. Std was 5uL, all others 10uL per lane. The smaller. The frag the more efficient the purification.</p><br />
<p>Transformation (Gibbson assembly)</p><br />
<p>Version 1 Version 2</p><br />
<p>7ul AGM1 plasmid 9ul AGM1 plasmid<br /><br />
1ul NAG1 0.5 NAG1<br /><br />
2ul UAP1 0.5 UAP1</p><br />
<p> 10ul 10ul<br /><br />
+ 10ul master mix + 10ul master mix</p><br />
<p>20ul total 20ul total </p><br />
<p>*PCR (version 1 and version 2) is in PCR machine</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/14/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>I filled two molds and was unable to fill more since the autoclave was being used and it could not wait to autoclave more. Incubator temp 31</p><br />
<p>The lab strains look the same. Ph same as well as temp</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/12/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Lab strain looks much better and uniform from last time, a sheet is expected. Ph 4. 5<br /><br />
Wild strain is not growing quickly but its growth seems more concentrated. Ph 4<br /><br />
Temp. 23.5 degrees.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/10/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The 10 beakers were moved to the incubator, temp. 30. Two more molds were. Contaminated and will be filled in. In all we filled 4 molds and 11 small tubes for test samples.</p><br />
<p>Kombucha-temp is 23. 5 in cabinet.<br /><br />
Assessment.<br /><br />
One of the lab strain, aceto food is growing weakly. There seems to be a particle floating inside.<br /><br />
Ph 4</p><br />
<p>Lab strain in blueberry juice is contaminated. Ph 2</p><br />
<p>Wild kombucha is growing best but still weakly. Ph 4. 5</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/07/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>We moved the molds out of the incubator and into cabinets in the lab. Four from before were contaminated, they were cleaned and four more molds were made. 5 star shapes were also put together.<br /><br />
Ten smaller beakers were also inoculated with the mycelia and were originally in the fan space (fan off).</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/06/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Came into lab. Jimmy had already made the substrate, we filled out 5 of the 9 molds needed with the oak pellet substrate. To avoid contamination, we wrapped the finished molds in plastic wrap. We also used aluminum star shaped containers, in order to create smaller molds. Two and a half. All molds were made with h2o2 mycelium. No new contaminants, though one seems to be developed.</p><br />
<p>Kombucha. Made three with lab strain scoby, two with aceto food, one with blueberry juice</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/04/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Came into lab today, 7 out of 16 molds were contaminated. It seems like the tapes used to seal up cracks are the culprits as most of the mold growing seemed to originate at the tapes. There needs to be a better way to seal things up. what was done: we merely cleaned out the contaminated trays and are leaving the rest for tomorrow.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/24/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><b>Ligation & Transformation</b></p><br />
<p>Two ligation reactions:<br /><b>First rnx is Labeled “Lig 1 SH 8/24”</b><br /><br />
4 ul purified A + pSB1C3<br /><br />
4 ul purified N<br /><br />
1 ul 10x T4 ligase buffer<br /><br />
1 ul T4 ligase<br /><br />
10 ul total</p><br />
<p>The second one (that is a bit of a crapshoot but could potentially put all three pieces together):<br /><b>Second rnx is Labeled “Lig 2 SH 8/24”</b><br /><br />
2 ul purified A + pSB1C3<br /><br />
3 ul purified N<br /><br />
3 ul purified U<br /><br />
1 ul 10x T4 ligase buffer<br /><br />
1 ul T4 ligase<br /><br />
10 ul total</p><br />
<p>Centrifuged for 20 seconds at 2.0rcf because T4 ligase was pipetted onto the side of the tube for Lig 2.<br /><br />
Began rnx at 7:58pm, running for 31 minutes on the timer.</p><br />
<p>Incubate at room temperature for 30 min to 1 h.</p><br />
<p>*** We should have used CIP/phosphatase so that the AGM1 gene with the pSB1C3 vector cannot religate... Since we did not, we are expecting to see more religated plasmids without the intended inserts for both Lig 1 and Lig 2 rnx’s. </p><br />
<p><b>Transformation set up for Ligation 1 and Ligation 2:</b></p><br />
<p>Pellet for 8.4rcf</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/23/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>PCR products of the N and U gene plasmid digests were retrieved and run on a 1% gel at 3:08pm for about 40 minutes.</p><br />
<p>5ul of 1KB Plus DNA ladder</p><br />
<p>2uL PCR product<br /><br />
2ul Xylene Cyanol loading dye<br /><br />
10ul H2O<br /><br />
14ul total</p><br />
<p>Lane 1: empty<br /><br />
Lane 2: 1KB PLUS DNA ladder<br /><br />
Lane 3: Tube A (NAG1)<br /><br />
Lane 4: Tube B (NAG1) + MgCl<br /><br />
Lane 5: Tube C (UAP1)<br /><br />
Lane 6: Tube D (UAP1) + MgCl<br /><br />
(Recall that we did not have the proper reverse primer for AGM1, so this was not included)</p><br />
<p><b>Predicted band sizes:</b><br /><br />
Lane 3: 747kb<br /><br />
Lane 4: 747kb<br /><br />
Lane 5: 1461kb<br /><br />
Lane 6: 1461kb<br /><br />
(with lanes 4 and 6 showing more distinct bands, if the PCR reaction was enhanced by the MgCl cofactor)</p><br />
<p>Also, running the gel for 40 minutes was way too long-- next time only 25-30 so our product doesn’t go off the gel!</p><br />
<p>Results:<br /><img src="http://farm9.staticflickr.com/8450/8049380964_fd22eba205_m.jpg" /></p><br />
<p>PCR products (tubes A, B, C, D) are in the hot pink “Cloning Materials” box and labeled “Genes N/U RE & PCR Products 8/23”</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Julie<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/22/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>We purified our PCR products via miniprep. Only then did we look more closely at the gel to see that our "products" were in the 250-400 bp range, when we expect 800-1600 bp range. Clearly the PCRs failed. </p><br />
<p>In examining the cause of PCR failure more closely, we realized that the reverse primer for gene 1 (AGM1) is incorrect. The reverse complement of the forward sequence was never generated (see the "primers" google document to confirm this). The good news is that it's easy to generate the correct sequence and order the primer. The bad news is that we can't do the final gibson assembly without it. </p><br />
<p>To troubleshoot the PCRs that should have worked (NAG1 and UAP1), we are running PCRs again overnight. We are using different concentrations of primer/template and testing different Mg2+ concentrations. This time our reactions looked like:</p><br />
<p>Forward primer (10 uM): 1 ul<br /><br />
Reverse primer (10 uM): 1 ul<br /><br />
template DNA: 1 ul<br /><br />
H2O: 22 ul</p><br />
<p>OR</p><br />
<p>Forward primer (10 uM): 1 ul<br /><br />
Reverse primer (10 uM): 1 ul<br /><br />
template DNA: 1 ul<br /><br />
100 mM MgCl: 1 ul<br /><br />
H2O: 21 ul</p><br />
<p>Our PCR cofactor (1% MgCl2) was:<br /><br />
900ul H2O<br /><br />
100ul 1M MgCl2</p><br />
<p><b>A Tube: NAG1</b><br /><br />
1ul of Forward Primer 1 (Gene 2F)<br /><br />
1ul of Reverse Primer 2 (Gene 2R)<br /><br />
1ul of Template (NAG1-5)<br /><br />
22ul of H2O<br /><br />
25ul Total</p><br />
<p><b>B Tube: NAG1 with MgCl cofactor</b><br /><br />
1ul of Forward Primer (Gene 2F)<br /><br />
1ul of Reverse Primer (Gene 2R)<br /><br />
1ul of Template (NAG1-5)<br /><br />
1ul MgCl solution<br /><br />
21ul of H2O<br /><br />
25ul Total</p><br />
<p><b>C Tube: UAP1</b><br /><br />
1ul of Forward Primer 1 (Gene 3F)<br /><br />
1ul of Reverse Primer 2 (Gene 3R)<br /><br />
1ul of Template (UAP1-3)<br /><br />
22ul of H2O<br /><br />
25ul Total</p><br />
<p><b>D Tube: UAP1 with MgCl cofactor</b><br /><br />
1ul of Forward Primer 1 (Gene 3F)<br /><br />
1ul of Reverse Primer 2 (Gene 3R)<br /><br />
1ul of Template (NAG1-5)<br /><br />
1ul MgCl solution<br /><br />
21ul of H2O<br /><br />
25ul Total</p><br />
<p>We also decided to start cloning the classic digest-and-ligate way using our genes which are already in the biobrick plasmids. We digested AGM1 plasmid with SpeI (thus linearizing it). We digested NAG1 and UAP1 plasmids with SpeI and XbaI, liberating the genes (and RBS) from their backbone plasmids. </p><br />
<p><b>AGM Plasmid:</b><br /><br />
3ul AGM1 Plasmid<br /><br />
2ul Buffer<br /><br />
1ul SpeI<br /><br />
0ul XbaI<br /><br />
14ul H2O<br /><br />
20ul Total</p><br />
<p><b>NAG Plasmid:</b><br /><br />
3ul NAG1 Plasmid<br /><br />
2ul Buffer<br /><br />
1ul SpeI<br /><br />
1ul XbaI<br /><br />
13ul H2O<br /><br />
20ul Total</p><br />
<p><b>UAP Plasmids:</b><br /><br />
3ul UAP Plasmid<br /><br />
2ul Buffer<br /><br />
1ul SpeI<br /><br />
1ul XbaI<br /><br />
13ul H2O<br /><br />
20ul Total</p><br />
<p>We ran a gel of our digests, and they look great - the exact sizes we expected (I will attach it later). Another confirmation that our minipreps contain the genes we expect them to (even if we don't have the full sequence). We cut the pieces out of the gel that were the correct sizes and gel purified them. They are in the fridge and ready to ligate together.</p><br />
<p><img src="http://farm9.staticflickr.com/8456/8049368751_497bdfabb9_m.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Julie<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/21/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>We ran a gel to confirm that we have PCR products of expected sizes. I glanced only quickly at the gel, saw that there were some bands (admittedly diffuse but the gel itself was a week old). The gel is attached (sad gel.png). Its name will become clear tomorrow.</p><br />
<p><img src="http://farm9.staticflickr.com/8030/8049366364_94191cecc0_m.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Julie<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/20/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>We set up PCRs of the genes using primers containing overlapping sequences. For each PCR, we diluted the dessicated reagents (Taq Polymerase, dNTPs, MgCl, buffer) in the following:</p><br />
<p>Forward primer (10 uM): 2 ul<br /><br />
Reverse primer (10 uM): 2 ul<br /><br />
template DNA: 3 ul<br /><br />
H2O: 18 ul</p><br />
<p>(I may be off. I didn't take notes here. If I'm wrong and you remember, please let me know.)</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/17/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The DNA sequences came back. None of the forward reactions worked (especially surprising as these primers were supplied by iGEM headquarters). Of the reverse reactions, some worked and some didn't. There was no read for the NAG1 gene, for example, but as we only had one digest that looked positive, we have to move forward with this clone (for now). </p><br />
<p>The best hits were: </p><br />
<p>AGM1 - clone 4<br /><br />
NAG1 - clone 5<br /><br />
UAP1 - clone 3</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Alex<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/16/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The cultures were well grown the next day (and the original colonies were still white, a promising sign). We miniprepped the plasmids from the cultures, and then used an XbaI/SpeI digest to identify plasmids with the correct-sized inserts. The expected sizes for the DNA fragments:</p><br />
<p>1.6 kB - AGM1<br /><br />
0.7 kB - NAG1<br /><br />
1.5 kB - UAP1<br /><br />
2.1 kB - biobrick plasmid<br /><img src="http://farm9.staticflickr.com/8460/8049355440_bf0b721d5e_m.jpg" /><br /><br />
All of the positive hits had bands of these expected sizes. Some of them had larger bands that add to a singly-cut plasmid (insert + backbone, e.g., AGM1 + biobrick plasmid, i.e., 1.6 kB + 2.1 kB = 3.7 kB) but the ones we considered positive contained only predicted sized bands - no miscellaneous weirdos. </p><br />
<p>The digests were run on a 1% agarose gel. I've attached the picture (gel annotated.png) that shows the inserts with the correct sized bands (the samples with the asterisks). These were sent for sequencing using the VF and VR (verify forward and verify reverse) primers.</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/15/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The next day we had lots of colonies (I don't have the pictures of the plates, but maybe someone else does). Many of these were red, indicating they were transformed due to residual RFP plasmid (as had happened previously). We circled several white colonies as prospective positive transformants. For each construct, we chose 5 clones and inoculated 4 ml of LB-chlor to grow these overnight at 37 deg C.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/14/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The second gibson assemblies that we did worked! We followed Ellen's advice to increase the G-bit DNA concentration. This means our final assembly reactions looked like this:</p><br />
<p>2.5 ul pSB1C3 (biobrick backbone plasmid DNA, linearized)<br /><br />
7.5 ul G-bit DNA*<br /><br />
10 ul master mix<br /><br />
20 ul total</p><br />
<p>* we divided the volume left by the number of G-bit parts. For NAG1, there were 3 parts, so each took up 2.5 ul. For UAP 1, there were 4 parts, so each took up 1.8 ul. For AGM1, there were 5 parts, so each took up 1.5 ul.</p><br />
<p>We incubated these for 1 hr at 50 deg C and then immediately transformed the commercial competent cells.</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/12/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Gibson, Transformation:<br /><br />
So instead of 50 fentomoles of each, try 100 but 50 of the plasmid as before. I think we have room in the 10 microliters for that. And maybe close the lid of the PCR machine?</p><br />
<p>Gibson assembly protocol</p><br />
<p>-reaction is in 0.2mL PCR tube using program “Gibson” under user “ellen”<br /><br />
50C for 1h, hold at 4C<br /><br />
-total reaction volume is 20 microliters<br /><br />
-all G-Blocks were resuspended at a concentration of 50 fentomoles per microliter<br /><br />
-TOTAL amount of DNA in tube (sum of all parts) should be between 200-1000 fentomoles. NOTE: last time we were at the low end of this!</p><br />
<p>Recommended procedure:<br /><br />
For ‘U’<br /><br />
1.85 µL U-1<br /><br />
1.85 µL U-2<br /><br />
1.85 µL U-3<br /><br />
1.85 µL U-4<br /><br />
2.6 µL pSB1C3<br /><br />
10.0 µL Gibson Master Mix<br /><br />
20.0 µL</p><br />
<p>For ’N’<br /><br />
2.5 µL N-1<br /><br />
2.5 µL N-2<br /><br />
2.5 µL N-3<br /><br />
2.5 µL pSB1C3<br /><br />
10.0 µL Gibson Master Mix<br /><br />
20.0 µL</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/10/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8174/8048768673_d51ef329a3.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Alex<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/10/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Results of Gibson Assembly:<br /><br />
4 big plates of the 3 chitin path genes A, U, and N, a + control<br /><br />
2 small plaets: neg control, baseline control without antibio</p><br />
<p>Results:</p><br />
<p>Lawn on antibiotic free control</p><br />
<p>Some contamination on A & U plates</p><br />
<p>No growth on N, + Control plates</p><br />
<p>[PASTE ALL PHOTOS FROM ALEX EMAIL AFTER RESIZING]</p><br />
<p>Pink colonies may be traces of RFP plasmids remaining from when biobrick plasmid part was PCR’ed.</p><br />
<p>Reasons for failure could be:</p><br />
<p>1) use the heated lid on the PCR machine - I did not shut it because I thought it might jack up the temp.<br /><br />
2) the manual says to use a 2-3x overage of inserts to backbone. The tech service guy said use equimolar so we did. maybe we need to rethink that.<br /><br />
3) overall total conc of DNA in the rxn mix could be upped.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Alex<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/08/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Notes for NAG1 Gibson</p><br />
<p>N-1 87163240<br /><br />
163696916 Date Ordered: 3rd Aug, 2012<br /><br />
200 ng = 1012.2 fmol</p><br />
<p>N-2 87163241<br /><br />
163696911 Date Ordered: 3rd Aug, 2012<br /><br />
200 ng - 1005.9 fmol</p><br />
<p>N-3 87163242<br /><br />
163696921 Date ordered: 3rd Aug, 2012<br /><br />
200 ng = 978.5 fmol</p><br />
<p>Gibson Assembly Master Mix<br /><br />
#E26115 Exp: 6/13<br /><br />
Lot: 0031206</p><br />
<p>PSBIC3<br /><br />
Biobrick Plasmid 2071 bases<br /><br />
650 * 2071 =<br /><br />
Mol. Weight: 1.346 x 106 fg/fmol</p><br />
<p>N1<br /><br />
10012.2 fmol / 20 μL<br /><br />
= 50.61 fmol/ μL<br /><br />
N2<br /><br />
1005.9 fmol / 20 μL<br /><br />
= 50.29 fmol/ μL<br /><br />
N3<br /><br />
978.5 fmol / 19 μL<br /><br />
= 51.50 fmol/ μL</p><br />
<p>4.3 μL water<br /><br />
+ 2.7 μL PSB1C3<br /><br />
+ 1.0 μL N1 (Concentration - 50.61 fmol/μL)<br /><br />
+ 1.0 μL N2 (Concentration - 50.29 fmol/μL)<br /><br />
+ 1.0 μL N3 (Concentration - 51.50 fmol/μL)<br /><br />
+ 10 μL Mastermix<br /><br />
= 20 μL</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah </td><br />
<td class="views-field views-field-created" ><br />
Aug/08/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8458/8048768341_cd215f8a44.jpg" /><br /><img src="http://farm9.staticflickr.com/8314/8048768463_ebf452dfea.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/07/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8313/8048773304_9ce0f49fd2.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/06/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>G-blocks arrived</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/04/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8451/8048765553_1ffd507e36.jpg" /><br /><img src="http://farm9.staticflickr.com/8172/8048770556_2604c4a9b2.jpg" /><br /><img src="http://farm9.staticflickr.com/8316/8048765169_52ca13cda9_n.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/03/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8450/8048766095_c94a54efd5.jpg" /><br /><img src="http://farm9.staticflickr.com/8313/8048765937_f6fd019924.jpg" /><br /><img src="http://farm9.staticflickr.com/8180/8048770890_12ba62d1a7.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/02/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8318/8048766337_a5795fb13d.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/01/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8182/8048766707_9cb88da4d7.jpg" /><br /><img src="http://farm9.staticflickr.com/8171/8048771682_17e08a6f17.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/30/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8179/8048766867_8c6cc28dd4.jpg" /><br /><img src="http://farm9.staticflickr.com/8174/8048767007_9a47831e22.jpg" /><br /><img src="http://farm9.staticflickr.com/8455/8048772414_005410d2f1.jpg" /><br /><img src="http://farm9.staticflickr.com/8169/8048767529_8993906e3d.jpg" /><br /><img src="http://farm9.staticflickr.com/8318/8048767697_95e77a28af.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/20/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8033/8048772282_58fab176aa.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even views-row-last"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sara<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Jun/09/2012 </td><br />
<td class="views-field views-field-body" ><br />
<ol><li>Almost no growth, very thin film.</li><br />
<li>Cellulose very thin, seems to have grown on bottom (not top)</li><br />
<li>Thin growth, not measurable from sides, but def more significant than just scoby.</li><br />
<li>Super thick from bubbles, accidentally popped it. A little thicker than #9.</li><br />
<li>Infested w/ flies. Nice growth, not in a sheet, disposing.</li><br />
<li>Pretty thick, made a little pillow from the air bubbles.</li><br />
<li>Thin growth along top.</li><br />
<li>Thin growth along top.</li><br />
<li>Nice sheet, 2nd to 10+13.</li><br />
<li>Very thick cellulose, abt 1-2mm growth.</li><br />
<li>Thickest non-BB. Weird flakes (brown) everywhere.</li><br />
<li>Thin growth, a little thicker than the other thins.</li><br />
<li>Almost entirely cellulose, very little liquid left.</li><br />
</ol> </td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
</div> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin
Team:NYU Gallatin
2012-10-04T02:50:12Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html front not-logged-in no-sidebars page-node page-node- page-node-1 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first active"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter." class="active">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Default}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Cellulose Architecture</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-1" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p><img src="https://static.igem.org/mediawiki/2012/3/34/Aseatobacter-IMAGES-Chair_Diagrams.png" width="400" style="float: left; margin-right: 20px; margin-bottom: 20px;" /><span class="aseato">We grow chairs.</span><br /></p><p style="font-size: 22px;">In a world full of lifeless interiors and boxed pressed wood a miracle of biology is changing the way we create our surroundings.</p><br />
<div id="player"></div><br />
<script type="text/javascript"><br />
<!--//--><![CDATA[// ><!--<br />
<br />
<br />
(function() {<br />
function createPlayer(jqe, video, options) {<br />
var ifr = $('iframe', jqe);<br />
if (ifr.length === 0) {<br />
ifr = $('<iframe scrolling="no" frameborder="no">');<br />
ifr.addClass('player');<br />
if (options.playeropts)<br />
ifr.attr(options.playeropts);<br />
}<br />
var src = 'http://www.youtube.com/embed/' + video;<br />
if (options.playopts) {<br />
src += '?';<br />
for (var k in options.playopts) {<br />
src+= k + '=' + options.playopts[k] + '&';<br />
}<br />
}<br />
ifr.attr('src', src);<br />
jqe.append(ifr);<br />
}<br />
<br />
var defoptions = {<br />
autoplay: false,<br />
user: null,<br />
player: createPlayer,<br />
playeropts: {},<br />
loaded: function() {},<br />
playopts: {<br />
fs: 1,<br />
showinfo: 1,<br />
modestbranding: 1<br />
}<br />
};<br />
<br />
$.fn.extend({<br />
youTubeChannel: function(options) {<br />
var md = $(this);<br />
var allopts = $.extend(true, {}, defoptions, options);<br />
$.getJSON('http://gdata.youtube.com/feeds/api/users/' + allopts.user + '/uploads?alt=jsonc&v=2', null, function(data) {<br />
var videos = [];<br />
var playlist = '';<br />
$.each(data.data.items, function(i, item) {<br />
videos.push(item.id);<br />
if (i > 0)<br />
playlist += item.id + ',';<br />
});<br />
allopts.playopts.playlist = playlist;<br />
allopts.player(md, videos[0], allopts);<br />
});<br />
}<br />
});<br />
<br />
})();<br />
<br />
$(function() {<br />
$('#player').youTubeChannel({user:'aseatobacter', playeropts: { width: 400, height: 280 }});<br />
});<br />
<br />
<br />
//--><!]]><br />
</script></div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
<div id="block-block-4" class="block block-block"><br />
<br />
<h2>Latest News</h2><br />
<br />
<div class="content"><br />
<script type="text/javascript"><br />
<!--//--><![CDATA[// ><!--<br />
<br />
function tumblr(resp) {<br />
var months = ['Jan','Feb','Mar','Apr','May','Jun','Jul','Aug','Sep','Oct','Nov','Dec'];<br />
var posts = resp.posts;<br />
$('#blog .loading').replaceWith('<ul />');<br />
$ul = $('#blog ul');<br />
for (var i=0; i<4; i++) {<br />
var p = posts[i];<br />
var title = p['regular-title'] || p['link-text'] || null;<br />
if (title) {<br />
var date = new Date(p['unix-timestamp']*1000);<br />
var dateMonth = months[date.getMonth()];<br />
var dateDay = date.getDate();<br />
var html = dateMonth+' '+dateDay+' <a href="'+p['url']+'" rel="lightframe">'+title+'<br />';<br />
$ul.append(html);<br />
}<br />
}<br />
}<br />
<br />
//--><!]]><br />
</script><p><br />
Keep up with the latest news from the Aseatobacter project.</p><br />
<!-- Where you want your tumblog --><div id="blog"><br />
<div class="loading">Loading...</div><br />
</div><br />
<p><a href="http://aseatobacter.tumblr.com" target="_new">View More Blog Posts</a></p><br />
<!-- Bottom of the page, probably. Change host --><script src="http://aseatobacter.tumblr.com/api/read/json?callback=tumblr&num=10" type="text/javascript"></script> </div><br />
</div><br />
<div id="block-block-9" class="block block-block"><br />
<br />
<h2>Featured Photo</h2><br />
<br />
<div class="content"><br />
<div id="images"></div><br />
<p><a href="/Team:NYU_Gallatin/Notebook/Photos" class="more-link">More Photos</a></p><br />
<script type="text/javascript"><br />
<!--//--><![CDATA[// ><!--<br />
<br />
if($('#images').length != 0) {<br />
<br />
setTimeout(function() {$.getJSON(flickr_url, displayImages);},1500);<br />
function displayImages(data) {<br />
// Start putting together the HTML string<br />
var htmlString = "";<br />
<br />
// Now start cycling through our array of Flickr photo details<br />
var k=0;<br />
$.each(data.items, function(i,item){<br />
if(k == 0) {<br />
// I only want the ickle square thumbnails<br />
// var sourceSquare = (item.media.m).replace("_m.jpg", "_s.jpg");<br />
var sourceSquare = item.media.m;<br />
var l_sourceSquare = (item.media.m).replace("_m.jpg", "_b.jpg");<br />
<br />
// Here's where we piece together the HTML<br />
htmlString += '<li><a href="'+l_sourceSquare+'" rel="lightbox">';<br />
htmlString += '<img title="' + item.title + '" src="' + sourceSquare;<br />
htmlString += '" alt="'; htmlString += item.title + '" />';<br />
htmlString += '';<br />
k++;<br />
} <br />
});<br />
<br />
// Pop our HTML in the #images DIV<br />
$('#images').html(htmlString);<br />
}<br />
<br />
}<br />
<br />
//--><!]]><br />
</script> </div><br />
</div><br />
<div id="block-block-5" class="block block-block"><br />
<br />
<h2>Featured Video</h2><br />
<br />
<div class="content"><br />
<iframe width="250" height="200" src="http://www.youtube.com/embed/EBZTe9RWZLo" frameborder="0" allowfullscreen=""></iframe> </div><br />
</div><br />
<div id="block-block-6" class="block block-block"><br />
<br />
<br />
<div class="content"><br />
<p><img src="https://static.igem.org/mediawiki/igem.org/5/52/Aseatobacter-IMAGES-Pipet.png" style="float: right; margin-left: 20px; margin-bottom: 10px;" width="350" /><span class="aseato">What we want.</span></p><br />
<p>Our project seeks to improve the characteristics of cellulose secreted by the gram negative bacterium Acetobacter xylinum. This naturally occurring "chassis" secretes large amounts of cellulose into solution and has been studied for many years. We wish to improve the material properties of this bacterial cellulose by genetically engineering the strain to incorporate color, improved tensile strength and increased hydrophobicity into the improved cellulose based material. After testing it's properties, we will use this material to build larger scale objects.</p><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Templates/Styles
Team:NYU Gallatin/Templates/Styles
2012-10-04T02:48:00Z
<p>Sararobertson: </p>
<hr />
<div><html><br />
<head><br />
<nowiki><style><br />
/* Styles for the Wiki site */<br />
<br />
/* Neuropol Fonts */<br />
@font-face {<br />
font-family: neuropol;<br />
/* src: url('http://igem.melodramatic.com/sites/default/themes/igem/fonts/NEUROPOL.ttf'); */<br />
src: url('https://static.igem.org/mediawiki/2012/e/e6/Aseatobacter-FONT_NEUROPOL.txt');<br />
}<br />
.view-team h3,<br />
.view-team .views-label,<br />
.view-team span.username,<br />
.aseato,<br />
#page-title,<br />
#main-menu-links a span b,<br />
#page .sidebar .block h2,<br />
#block-block-9 h2,<br />
#block-block-4 h2,<br />
#block-block-5 h2,<br />
#block-block-2 span.stat,<br />
#site-slogan,<br />
#site-name {<br />
font-family: neuropol, "Courier New" !important;<br />
}<br />
<br />
/* Hidden Elements */<br />
#p-logo,<br />
#catlinks,<br />
#top-section #p-logo img,<br />
div.front #page-title,<br />
h1.firstHeading,<br />
#top-section, <br />
#footer-box,<br />
html.js .js-hide,<br />
#bodyContent p,<br />
.element-hidden {<br />
display: none;<br />
}<br />
<br />
#content {<br />
padding-top: 0 !important;<br />
}<br />
#content {<br />
padding: 0;<br />
}<br />
#bodyContent {<br />
padding: 0;<br />
margin: 0;<br />
}<br />
#bodyContent #page-wrapper p {<br />
display: block;<br />
}<br />
#header {<br />
}<br />
#page {<br />
font-size: 75%;<br />
}<br />
<br />
/* ---------- Basic Layout Styles ----------- */<br />
<br />
html,<br />
body,<br />
#page {<br />
height: 100%;<br />
}<br />
#content {<br />
width: 100%;<br />
}<br />
#page-wrapper {<br />
min-height: 100%;<br />
min-width: 950px;<br />
}<br />
#header div.section,<br />
#featured div.section,<br />
#messages div.section,<br />
#main,<br />
#triptych,<br />
#footer-columns {<br />
width: 950px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
}<br />
#header div.section {<br />
position: relative;<br />
}<br />
.region-header {<br />
float: right; /* LTR */<br />
margin: 0 5px 10px;<br />
}<br />
.with-secondary-menu .region-header {<br />
margin-top: 3em;<br />
}<br />
.without-secondary-menu .region-header {<br />
margin-top: 15px;<br />
}<br />
#secondary-menu {<br />
position: absolute;<br />
right: 0; /* LTR */<br />
top: 0;<br />
width: 480px;<br />
}<br />
#igem-content,<br />
#sidebar-first,<br />
#sidebar-second {<br />
display: inline;<br />
float: left; /* LTR */<br />
position: relative;<br />
}<br />
.one-sidebar #igem-content {<br />
width: 710px;<br />
}<br />
.two-sidebars #igem-content {<br />
width: 480px;<br />
}<br />
.no-sidebars #igem-content {<br />
width: 950px;<br />
float: none;<br />
}<br />
#sidebar-first,<br />
#sidebar-second {<br />
width: 210px;<br />
}<br />
#main-wrapper {<br />
min-height: 300px;<br />
}<br />
#igem-content .section,<br />
.sidebar .section {<br />
padding: 0 15px;<br />
}<br />
#footer-wrapper {<br />
padding: 0px 5px 0px;<br />
}<br />
.region-footer-firstcolumn,<br />
.region-footer-secondcolumn,<br />
.region-footer-thirdcolumn,<br />
.region-footer-fourthcolumn {<br />
padding: 0 10px;<br />
width: 220px;<br />
}<br />
<br />
#globalWrapper {<br />
z-index: 1;<br />
padding: 0px !important;<br />
}<br />
#contentSub {<br />
border: solid black 1px;<br />
}<br />
#canvas {<br />
position: fixed !important;<br />
top: 0 !important;<br />
left: 0 !important;<br />
}<br />
<br />
<br />
/**<br />
* Inline items.<br />
*/<br />
.container-inline div,<br />
.container-inline label {<br />
display: inline;<br />
}<br />
.container-inline .fieldset-wrapper {<br />
display: block;<br />
}<br />
.nowrap {<br />
white-space: nowrap;<br />
}<br />
<br />
.element-invisible {<br />
position: absolute !important;<br />
clip: rect(1px 1px 1px 1px); /* IE6, IE7 */<br />
clip: rect(1px, 1px, 1px, 1px);<br />
}<br />
.element-invisible.element-focusable:active,<br />
.element-invisible.element-focusable:focus {<br />
position: static !important;<br />
clip: auto;<br />
}<br />
<br />
/**<br />
* Markup free clearing.<br />
*<br />
* @see http://perishablepress.com/press/2009/12/06/new-clearfix-hack<br />
*/<br />
.clearfix:after {<br />
content: ".";<br />
display: block;<br />
height: 0;<br />
clear: both;<br />
visibility: hidden;<br />
}<br />
/* IE6 */<br />
* html .clearfix {<br />
height: 1%;<br />
}<br />
/* IE7 */<br />
*:first-child + html .clearfix {<br />
min-height: 1%;<br />
}<br />
<br />
<br />
/* ---------- Overall Specifications ---------- */<br />
<br />
body {<br />
line-height: 1.5;<br />
font-size: 100%;<br />
word-wrap: break-word;<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
outline: 0;<br />
font-family: "Helvetica";<br />
}<br />
#page, #main {<br />
font-family: "Helvetica";<br />
}<br />
a:link,<br />
a:visited {<br />
text-decoration: none;<br />
}<br />
a:hover,<br />
a:active,<br />
a:focus {<br />
text-decoration: underline;<br />
}<br />
tr.odd {<br />
background-color: #e8e9dc;<br />
}<br />
img {<br />
outline: 0;<br />
}<br />
<br />
/* ------------------ Fonts ------------------ */<br />
<br />
#header,<br />
#footer-wrapper,<br />
ul.contextual-links,<br />
ul.links,<br />
ul.primary,<br />
.item-list .pager,<br />
div.field-type-taxonomy-term-reference,<br />
div.messages,<br />
div.meta,<br />
p.comment-time,<br />
table,<br />
.breadcrumb {<br />
font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
}<br />
input,<br />
textarea,<br />
select,<br />
a.button {<br />
font-family: "Lucida Grande", "Lucida Sans Unicode", Verdana, sans-serif;<br />
}<br />
<br />
<br />
/* ------------------ Table Styles ------------------ */<br />
<br />
table {<br />
border: 0;<br />
border-spacing: 0;<br />
font-size: 0.7em;<br />
margin: 10px 0;<br />
width: 100%;<br />
border: solid #909268 1px;<br />
border-right: none;<br />
border-top: none;<br />
}<br />
table table {<br />
font-size: 1em;<br />
}<br />
#footer-wrapper table {<br />
font-size: 1em;<br />
}<br />
table tr th {<br />
background: #53561d;<br />
color: #fff;<br />
border-bottom-style: none;<br />
}<br />
table tr th,<br />
table tr th a,<br />
table tr th a:hover {<br />
color: #FFF;<br />
font-weight: bold;<br />
font-size: 0.9em;<br />
}<br />
table tbody tr th {<br />
vertical-align: top;<br />
}<br />
tr td,<br />
tr th {<br />
padding: 4px 9px;<br />
border: solid #909268 1px;<br />
border-left: none;<br />
border-bottom: none;<br />
text-align: left; /* LTR */<br />
vertical-align: top;<br />
}<br />
<br />
tr td.last,<br />
tr th {<br />
<br />
}<br />
#footer-wrapper tr td,<br />
#footer-wrapper tr th {<br />
border-color: #555;<br />
border-color: rgba(255, 255, 255, 0.18);<br />
}<br />
table ul.links {<br />
margin: 0;<br />
padding: 0;<br />
font-size: 1em;<br />
}<br />
table ul.links li {<br />
padding: 0 1em 0 0;<br />
}<br />
<br />
/* ------------------ List Styles ------------------ */<br />
<br />
.block ol,<br />
.block ul {<br />
margin: 0;<br />
padding: 0 0 0.25em 1em; /* LTR */<br />
}<br />
.contextual-links-wrapper {<br />
font-size: small !important;<br />
}<br />
ul.contextual-links {<br />
font-size: 0.923em;<br />
}<br />
.contextual-links-wrapper a {<br />
text-shadow: 0 0 0 !important;<br />
}<br />
.item-list .pager {<br />
font-size: 0.929em;<br />
}<br />
ul.menu li {<br />
margin: 0;<br />
list-style: none;<br />
}<br />
.region-content ul,<br />
.region-content ol {<br />
margin: 1em 0;<br />
padding: 0 0 0.25em 2.5em; /* LTR */<br />
}<br />
.item-list ul li {<br />
margin: 0;<br />
padding: 0.2em 0.5em 0 0; /* LTR */<br />
}<br />
ul.tips {<br />
padding: 0 0 0 1.25em; /* LTR */<br />
}<br />
#sidebar-first li a {<br />
color: black;<br />
}<br />
#sidebar-first li a:hover,<br />
#sidebar-first li a.active {<br />
color: #757418;<br />
text-decoration: underline;<br />
}<br />
<br />
/* ------------------ Header ------------------ */<br />
#logo {<br />
float: left; /* LTR */<br />
padding: 15px 15px 15px 10px; /* LTR */<br />
}<br />
#name-and-slogan {<br />
padding-top: 34px;<br />
margin: 0 0 10px 15px; /* LTR */<br />
}<br />
#site-name {<br />
color: #686868;<br />
font-size: 50px;<br />
text-align: center;<br />
margin: 10px 0 0 0;<br />
}<br />
h1#site-name {<br />
margin: 0;<br />
}<br />
#site-name a {<br />
font-weight: normal;<br />
}<br />
#site-slogan {<br />
font-size: 1.0;<br />
margin: 0;<br />
padding: 0;<br />
word-spacing: 0.1em;<br />
border: 0;<br />
text-align: center;<br />
}<br />
<br />
/* ------------------- Main ------------------- */<br />
<br />
#main {<br />
margin-top: 20px;<br />
margin-bottom: 0px;<br />
}<br />
<br />
/* ----------------- Content ------------------ */<br />
<br />
.content {<br />
margin-top: 10px;<br />
}<br />
h1#page-title {<br />
font-size: 2em;<br />
line-height: 1;<br />
margin-top: 0;<br />
}<br />
#igem-content h2 {<br />
margin-bottom: 2px;<br />
font-size: 1.429em;<br />
line-height: 1.4;<br />
}<br />
.igem-section,<br />
.one-sidebar #igem-content {<br />
padding: 13px;<br />
}<br />
#page .node .content,<br />
#page .view {<br />
font-size: 1.3em;<br />
}<br />
.node .content p,<br />
#page .view p,<br />
.front .block p {<br />
line-height: 1.1em;<br />
}<br />
.meta {<br />
font-size: 0.857em;<br />
color: #68696b;<br />
margin-bottom: -5px;<br />
}<br />
.submitted .user-picture img {<br />
float: left; /* LTR */<br />
height: 20px;<br />
margin: 1px 5px 0 0; /* LTR */<br />
}<br />
.link-wrapper {<br />
text-align: right;<br />
}<br />
.field-type-image img,<br />
.user-picture img {<br />
margin: 0 0 1em;<br />
}<br />
ul.links {<br />
color: #68696b;<br />
font-size: 0.821em;<br />
}<br />
.node-unpublished {<br />
margin: -20px -15px 0;<br />
padding: 20px 15px 0;<br />
}<br />
/* ------------------ Sidebar ----------------- */<br />
.sidebar .block {<br />
padding: 15px 20px;<br />
margin: 0 0 20px;<br />
}<br />
.sidebar h2 {<br />
margin: 0 0 0.5em;<br />
border-bottom: 1px solid #d6d6d6;<br />
padding-bottom: 5px;<br />
text-shadow: 0 1px 0 #fff;<br />
font-size: 1.071em;<br />
line-height: 1.2;<br />
}<br />
.sidebar .block .content {<br />
font-size: 0.914em;<br />
line-height: 1.4;<br />
}<br />
.sidebar tbody {<br />
border: none;<br />
}<br />
.sidebar tr.even,<br />
.sidebar tr.odd {<br />
background: none;<br />
border-bottom: 1px solid #d6d6d6;<br />
}<br />
<br />
/* ------------------ Footer ------------------ */<br />
<br />
#footer-wrapper {<br />
color: #c0c0c0;<br />
color: rgba(255, 255, 255, 0.65);<br />
font-size: 0.857em;<br />
background-color: #c0c0c0;<br />
}<br />
#footer-wrapper a {<br />
color: #fcfcfc;<br />
color: rgba(255, 255, 255, 0.8);<br />
}<br />
#footer-wrapper a:hover,<br />
#footer-wrapper a:focus {<br />
color: #fefefe;<br />
color: rgba(255, 255, 255, 0.95);<br />
text-decoration: underline;<br />
}<br />
#footer-wrapper .block {<br />
margin: 0;<br />
}<br />
#footer-columns .block-menu,<br />
#igem-footer .block {<br />
margin: 0;<br />
padding: 0;<br />
border: none;<br />
}<br />
#igem-footer .block .content {<br />
margin-top: 0;<br />
padding: 0;<br />
}<br />
#igem-footer .block h2 {<br />
margin: 0;<br />
}<br />
<br />
/* iGem Styles */<br />
#page-title {<br />
padding: 0;<br />
margin: 0;<br />
font-family: Helvetica;<br />
}<br />
<br />
#main-menu a {<br />
color: #707070;<br />
}<br />
#canvas {<br />
position: absolute;<br />
top: 0;<br />
left: 0;<br />
}<br />
<br />
.lightbox2-alt-layout #imageData #bottomNav, .lightbox2-alt-layout-data #bottomNav {<br />
margin-bottom: 0;<br />
}<br />
<br />
/* Bacteria & iGEMs Blocks */<br />
#page #block-block-2, #page #block-block-3 {<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
background: black;<br />
opacity:0.3;<br />
filter:alpha(opacity=30); /* For IE8 and earlier */<br />
position: absolute;<br />
z-index: 9999;<br />
}<br />
#block-block-2 .content,<br />
#block-block-3 .content p {<br />
padding: 10px;<br />
margin: 0;<br />
font-size: 10px;<br />
}<br />
#block-block-2 h2,<br />
#block-block-3 h2 {<br />
color: white;<br />
font-size: 12px;<br />
line-height: 12px;<br />
padding: 10px 10px 0 10px;<br />
margin: 0;<br />
border: 0;<br />
}<br />
<br />
/* Bacteria Stats Block */<br />
#block-block-2 {<br />
right: 150px;<br />
top: -150px;<br />
}<br />
#page #block-block-2:hover {<br />
top: 0;<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
#block-block-2 #bacteria {<br />
text-align: center;<br />
text-transform: uppercase;<br />
font-weight: bold;<br />
}<br />
#block-block-2 span.stat {<br />
display: block;<br />
margin: 0;<br />
padding: 0;<br />
font-size: 24px;<br />
font-weight: bold;<br />
}<br />
<br />
/* iGEM Block */<br />
#block-block-3 {<br />
right: 20px;<br />
top: -175px;<br />
width: 120px;<br />
}<br />
#block-block-3 img {<br />
width: 100px;<br />
}<br />
#page #block-block-3:hover {<br />
top: 10px;<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
<br />
<br />
/* Front page styles */<br />
<br />
div.front #main-inner {<br />
padding: 0;<br />
margin: 0;<br />
}<br />
div.front #main-inner .block {<br />
padding: 20px 20px 10px 20px;<br />
margin-bottom: 15px;<br />
}<br />
div.front #main-inner #block-block-6 {<br />
margin-bottom: 0;<br />
}<br />
#block-block-7 div.content {<br />
padding: 0;<br />
}<br />
<br />
#block-block-9,<br />
#block-block-4,<br />
#block-block-5 {<br />
width: 257px;<br />
margin-right: 10px;<br />
float: left;<br />
height: 270px;<br />
}<br />
#block-block-5 {<br />
margin-right: 0;<br />
clear: right;<br />
}<br />
#block-block-9 h2,<br />
#block-block-4 h2,<br />
#block-block-5 h2 {<br />
border: 0;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#block-block-6 {<br />
clear: both;<br />
font-size: 1.3em;<br />
margin-bottom: 0;<br />
}<br />
<br />
#block-block-9 li {<br />
list-style: none;<br />
text-align: center;<br />
}<br />
#block-block-9 img {<br />
border: solid black 1px;<br />
}<br />
<br />
#block-block-9 .more-link,<br />
#block-block-6 .more-link,<br />
#block-block-4 .more-link,<br />
#block-block-5 .more-link {<br />
font-size: 12px;<br />
padding: 5px 5px;<br />
margin: 0;<br />
margin-top: 10px;<br />
line-height: 14px;<br />
}<br />
<br />
<br />
/* News Block */<br />
span.homedate {<br />
background: black;<br />
color: white;<br />
display: block;<br />
-moz-border-radius: 0px 5px 5px 0px;<br />
border-radius: 0px 5px 5px 0px;<br />
margin: 0;<br />
padding: 0;<br />
height: 20px;<br />
text-align: center;<br />
font-size: 20px;<br />
font-weight: bold;<br />
float: left;<br />
padding: 5px;<br />
margin-right: 10px;<br />
}<br />
b.homedate {<br />
background-color: #757418;<br />
color: white;<br />
display: block;<br />
-moz-border-radius: 5px 5px 0px 0px;<br />
border-radius: 5px 5px 0px 0px;<br />
width: 30px;<br />
text-align: center;<br />
font-weight: normal;<br />
font-size: 11px;<br />
padding: 0;<br />
float: left;<br />
margin-top: 4px;<br />
margin-right: -4px;<br />
<br />
/* Safari */<br />
-webkit-transform: rotate(-90deg);<br />
<br />
/* Firefox */<br />
-moz-transform: rotate(-90deg);<br />
<br />
/* IE */<br />
-ms-transform: rotate(-90deg);<br />
<br />
/* Opera */<br />
-o-transform: rotate(-90deg);<br />
<br />
/* Internet Explorer */<br />
filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=3);<br />
}<br />
#block-block-4 li {<br />
list-style: none;<br />
clear: both;<br />
margin-bottom: 15px;<br />
vertical-align: center;<br />
font-size: 13px;<br />
}<br />
#block-block-4 li a,<br />
#block-block-4 li {<br />
color: #757418;<br />
text-decoration: underline;<br />
}<br />
#block-block-4 ul {<br />
padding: 0;<br />
}<br />
<br />
div.social {<br />
/* background: url('../images/trans-bg-white.png'); */<br />
/* border: solid black 2px; */<br />
background: white;<br />
border: solid black 2px;<br />
color: black;<br />
display: inline-block;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
padding: 15px; <br />
text-align: center;<br />
width: 152px;<br />
margin-right: 0px;<br />
/*<br />
opacity:0.5;<br />
filter:alpha(opacity=50); */<br />
-webkit-transition: all 0.5s ease; <br />
-moz-transition: all 0.5s ease; <br />
-ms-transition: all 0.5s ease; <br />
-o-transition: all 0.5s ease; <br />
transition: all 0.5s ease;<br />
height: 300px;<br />
margin-top: -25px;<br />
}<br />
div.social:hover {<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
div.social.last {<br />
margin-right: 0;<br />
}<br />
#block-block-7 p {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
div.social div.social-icon {<br />
<br />
}<br />
div.social div.social-icon img {<br />
width: 150px;<br />
height: 150px;<br />
margin-top: 5px;<br />
margin-bottom: 15px;<br />
opacity:0;<br />
filter:alpha(opacity=0); /* For IE8 and earlier */<br />
-webkit-transition: all 0.5s ease; <br />
-moz-transition: all 0.5s ease; <br />
-ms-transition: all 0.5s ease; <br />
-o-transition: all 0.5s ease; <br />
transition: all 0.5s ease;<br />
}<br />
div.social div.social-icon img:hover {<br />
opacity:.50;<br />
filter:alpha(opacity=50); /* For IE8 and earlier */<br />
}<br />
div.social#social-facebook {<br />
background: #fff url('../images/social/dark-face.png') center 20px no-repeat;<br />
}<br />
div.social#social-flikr {<br />
background: #fff url('../images/social/dark-flikr.png') center 20px no-repeat;<br />
}<br />
div.social#social-twitter {<br />
background: #fff url('../images/social/dark-twitter.png') center 20px no-repeat;<br />
}<br />
div.social#social-youtube {<br />
background: #fff url('../images/social/dark-youtube.png') center 20px no-repeat;<br />
}<br />
div.social#social-rss {<br />
background: #fff url('../images/social/dark-rss.png') center 20px no-repeat;<br />
}<br />
<br />
/* Nav Styles */<br />
<br />
/* --------------- Main Menu ------------ */<br />
<br />
#main-menu {<br />
height: 80px;<br />
overflow: hidden;<br />
padding: 0;<br />
text-align: center;<br />
width: 970px;<br />
z-index: 9999;<br />
}<br />
#main-menu-links {<br />
font-size: 0.929em;<br />
}<br />
#main-menu-links li {<br />
display: inline-block;<br />
list-style: none;<br />
padding: 0;<br />
margin: 0;<br />
text-align: left;<br />
}<br />
<br />
#main-menu-links a {<br />
opacity:0.1;<br />
filter:alpha(opacity=10); /* For IE8 and earlier */<br />
color: #333;<br />
float: left; /* LTR */<br />
width: 76px;<br />
overflow: hidden;<br />
height: 76px;<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
}<br />
#main-menu-links a span {<br />
margin-left: 80px;<br />
display: block;<br />
font-size: 11px;<br />
line-height: 12px;<br />
-moz-border-radius: 10px;<br />
border-radius: 10px;<br />
width: 88px;<br />
text-align: left;<br />
padding: 8px;<br />
height: 55px;<br />
}<br />
#main-menu-links a b {<br />
display: block;<br />
}<br />
#main-menu-links a:hover,<br />
#main-menu-links a:focus,<br />
#main-menu-links a.active {<br />
opacity:1.0;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
width: 190px;<br />
text-decoration: none;<br />
}<br />
#main-menu-links a:active,<br />
#main-menu-links a.active {<br />
opacity:1.0;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
<br />
/* Home */<br />
#main-menu-links li.menu-218 a {<br />
background: url('https://static.igem.org/mediawiki/2012/5/56/Aseatobacter-NAV-Home.png') left center no-repeat;<br />
}<br />
/* Team */<br />
#main-menu-links li.menu-388 a {<br />
background: url('https://static.igem.org/mediawiki/2012/7/73/Aseatobacter-NAV-Team.png') left center no-repeat;<br />
}<br />
/* Project */<br />
#main-menu-links li.menu-307 a {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d2/Aseatobacter-NAV-Project.png') left center no-repeat;<br />
}<br />
/* Parts */<br />
#main-menu-links li.menu-308 a {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Parts.png') left center no-repeat;<br />
}<br />
/* Modeling */<br />
#main-menu-links li.menu-310 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/ed/Aseatobacter-NAV-Modeling.png') left center no-repeat;<br />
}<br />
/* Notebook */<br />
#main-menu-links li.menu-584 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/e8/Aseatobacter-NAV-Notebook.png') left center no-repeat;<br />
}<br />
/* Safety */<br />
#main-menu-links li.menu-312 a {<br />
background: url('https://static.igem.org/mediawiki/2012/5/5f/Aseatobacter-NAV-Safety.png') left center no-repeat;<br />
}<br />
/* Attributions */<br />
#main-menu-links li.menu-313 a {<br />
background: url('https://static.igem.org/mediawiki/2012/c/c9/Aseatobacter-NAV-Attributions.png') left center no-repeat;<br />
}<br />
/* Profile */<br />
#main-menu-links li.menu-306 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/ea/Aseatobacter-NAV-Profile.png') left center no-repeat;<br />
}<br />
<br />
/* Page titles */<br />
div.page-team #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Small-Safety.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-5 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d5/Aseatobacter-NAV-Small-Modeling.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
/* Project */<br />
div.page-node-3 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/41/Aseatobacter-NAV-Small-Home.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-4 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/e/ea/Aseatobacter-NAV-Small-Parts.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-6 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/b/b7/Aseatobacter-NAV-Small-Notebook.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-7 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Small-Safety.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
/* Attributions */<br />
div.page-node-8 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/41/Aseatobacter-NAV-Small-Home.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
<br />
<br />
/* ---------- Color Module Styles ----------- */<br />
<br />
body,<br />
body.overlay {<br />
color: #C4C487;<br />
/* background-color: #9c9f7f; */<br />
background-color: #98986c;<br />
}<br />
.comment .comment-arrow {<br />
border-color: #393a2d;<br />
}<br />
#page,<br />
#main-wrapper {<br />
background: transparent;<br />
}<br />
<br />
.no-sidebars #main-inner,<br />
.one-sidebar #igem-content,<br />
div.front #main-inner .block {<br />
background: transparent url('https://static.igem.org/mediawiki/2012/c/cf/Aseatobacter-IMAGES-trans-bg.png');<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
border: solid black 2px;<br />
}<br />
<br />
div.front #main-inner #block-block-9,<br />
div.front #main-inner #block-block-4,<br />
div.front #main-inner #block-block-5 {<br />
/* background: transparent url('../images/trans-bg-white.png'); */<br />
background: white;<br />
color: black;<br />
}<br />
div.front #main-inner #block-block-9 a,<br />
div.front #main-inner #block-block-4 a,<br />
div.front #main-inner #block-block-5 a,<br />
#block-block-2 span.stat {<br />
color: #757418;<br />
}<br />
<br />
div.front.no-sidebars #main-inner {<br />
background: none;<br />
border: none;<br />
}<br />
#page .sidebar .block {<br />
background: #fff;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
border: solid black 2px;<br />
}<br />
<br />
#page .sidebar .block h2 {<br />
margin: 0;<br />
border: 0;<br />
padding: 0;<br />
font-size: 20px;<br />
}<br />
.no-sidebars #main-inner {<br />
padding: 0 20px;<br />
border: solid black 2px;<br />
}<br />
.igem-section {<br />
color: #e9e9c8;<br />
}<br />
.tabs ul.primary li a.active {<br />
background-color: #ffffff;<br />
}<br />
.tabs ul.primary li.active a {<br />
background-color: #ffffff;<br />
border-bottom: 1px solid #ffffff;<br />
}<br />
a, a:visited, a:active {<br />
color: #C4C487;<br />
}<br />
a:hover,<br />
a:focus {<br />
color: #fff;<br />
}<br />
a:active {<br />
color: #55540d;<br />
}<br />
<br />
#main-menu-links a span {<br />
border: solid black 2px;<br />
background: transparent url('https://static.igem.org/mediawiki/2012/c/cf/Aseatobacter-IMAGES-trans-bg.png');<br />
color: black;<br />
}<br />
<br />
#main-menu-links a span b {<br />
color: white;<br />
padding-bottom: 5px;<br />
font-size: 10px;<br />
}<br />
<br />
#page-wrapper,<br />
#footer-wrapper {<br />
background-color: transparent;<br />
}<br />
.region-header,<br />
.region-header a,<br />
.region-header li a.active,<br />
#name-and-slogan,<br />
#name-and-slogan a,<br />
#secondary-menu-links li a {<br />
color: #fffeff;<br />
}<br />
<br />
/* iGEMs Colors */<br />
#top-section #p-logo {<br />
background: transparent;<br />
color: #9c9f7f;<br />
border: none;<br />
}<br />
#top-section #menubar.right-menu a {<br />
background: none;<br />
color: #535445;<br />
}<br />
#top-section #menubar.right-menu a:hover {<br />
color: black;<br />
}<br />
#top-section #search-controls input {<br />
color: #535445;<br />
}<br />
#top-section #menubar.left-menu a {<br />
color: #535445;<br />
}<br />
#top-section #menubar.left-menu:hover {<br />
background: none;<br />
}<br />
#content {<br />
background: transparent;<br />
}<br />
#footer-box {<br />
background: #393a2d;<br />
border: solid #393a2d 1px;<br />
border-top: 0;<br />
}<br />
#footer-box a {<br />
color: #9c9f7f;<br />
}<br />
#page-title {<br />
color: #000;<br />
border: none;<br />
}<br />
#site-name a {<br />
color: black;<br />
}<br />
#site-name a:hover {<br />
text-decoration: none;<br />
}<br />
#site-slogan {<br />
color: #fff;<br />
}<br />
<br />
.field-name-field-photo img {<br />
border: solid black 1px;<br />
}<br />
#main .views-view-grid img.default-pic,<br />
.field-name-field-photo img.default-pic {<br />
border: none;<br />
}<br />
#main .views-view-grid td,<br />
#main .views-view-grid tr td,<br />
#main .views-view-grid tr th,<br />
#main table.views-view-grid {<br />
background: transparent;<br />
border: 0;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
}<br />
#main .views-view-grid img,<br />
#main .view-header img {<br />
border: solid black 1px;<br />
float: left;<br />
margin: 0 15px 15px 0;<br />
}<br />
.view-team h3 {<br />
color: black;<br />
}<br />
.view-team .views-label {<br />
font-size: 1.4em;<br />
color: #C4C487;<br />
}<br />
.view-team a.username {<br />
font-size: 22pt;<br />
color: white;<br />
}<br />
#main .view-team div.field-content {<br />
padding: 0;<br />
margin: 0;<br />
line-height: 20px;<br />
}<br />
.view-team td {<br />
width: 50%;<br />
height: 150px;<br />
vertical-align: top;<br />
}<br />
.aseato {<br />
color: black;<br />
font-size: 1.4em;<br />
}<br />
<br />
#top-main-menu {<br />
width: 100%;<br />
height: 30px;<br />
text-align: center;<br />
position: absolute;<br />
top: 0;<br />
left: 0;<br />
margin: 0;<br />
background: black;<br />
font-size: 15px;<br />
z-index: 10;<br />
}<br />
#top-main-menu li {<br />
display: inline-block;<br />
padding-right: 15px;<br />
}<br />
#top-main-menu li a {<br />
color: white;<br />
}<br />
#top-main-menu a:hover,<br />
#top-main-menu a.active {<br />
color: #757418;<br />
}<br />
<br />
#flickr-images li {<br />
list-style: none;<br />
display: inline-block;<br />
padding: 7px 9px;<br />
}<br />
#flickr-images li img {<br />
border: solid black 1px;<br />
}<br />
<br />
table a:link, table a:visited, table a:active {<br />
color: black;<br />
text-decoration: underline;<br />
}<br />
table a:hover {<br />
color: black;<br />
text-decoration: underline;<br />
}<br />
<br />
ul li {<br />
list-style-image: none;<br />
list-style-type: square;<br />
}<br />
<br />
ul li ul li {<br />
list-style-image: none;<br />
list-style-type: circle;<br />
}<br />
<br />
img.border {<br />
border: solid black 1px;<br />
}<br />
<br />
#blog {<br />
font-size: 0.9em;<br />
}<br />
</style></nowiki><br />
</head><br />
</html></div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/
Team:NYU Gallatin/
2012-10-04T02:47:51Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html front not-logged-in no-sidebars page-node page-node- page-node-1 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first active"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter." class="active">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Default}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Cellulose Architecture</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-1" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p><img src="https://static.igem.org/mediawiki/2012/3/34/Aseatobacter-IMAGES-Chair_Diagrams.png" width="400" style="float: left; margin-right: 20px; margin-bottom: 20px;" /><span class="aseato">We grow chairs.</span><br /></p><p style="font-size: 22px;">In a world full of lifeless interiors and boxed pressed wood a miracle of biology is changing the way we create our surroundings.</p><br />
<div id="player"></div><br />
<script type="text/javascript"><br />
<!--//--><![CDATA[// ><!--<br />
<br />
<br />
(function() {<br />
function createPlayer(jqe, video, options) {<br />
var ifr = $('iframe', jqe);<br />
if (ifr.length === 0) {<br />
ifr = $('<iframe scrolling="no" frameborder="no">');<br />
ifr.addClass('player');<br />
if (options.playeropts)<br />
ifr.attr(options.playeropts);<br />
}<br />
var src = 'http://www.youtube.com/embed/' + video;<br />
if (options.playopts) {<br />
src += '?';<br />
for (var k in options.playopts) {<br />
src+= k + '=' + options.playopts[k] + '&';<br />
}<br />
}<br />
ifr.attr('src', src);<br />
jqe.append(ifr);<br />
}<br />
<br />
var defoptions = {<br />
autoplay: false,<br />
user: null,<br />
player: createPlayer,<br />
playeropts: {},<br />
loaded: function() {},<br />
playopts: {<br />
fs: 1,<br />
showinfo: 1,<br />
modestbranding: 1<br />
}<br />
};<br />
<br />
$.fn.extend({<br />
youTubeChannel: function(options) {<br />
var md = $(this);<br />
var allopts = $.extend(true, {}, defoptions, options);<br />
$.getJSON('http://gdata.youtube.com/feeds/api/users/' + allopts.user + '/uploads?alt=jsonc&v=2', null, function(data) {<br />
var videos = [];<br />
var playlist = '';<br />
$.each(data.data.items, function(i, item) {<br />
videos.push(item.id);<br />
if (i > 0)<br />
playlist += item.id + ',';<br />
});<br />
allopts.playopts.playlist = playlist;<br />
allopts.player(md, videos[0], allopts);<br />
});<br />
}<br />
});<br />
<br />
})();<br />
<br />
$(function() {<br />
$('#player').youTubeChannel({user:'aseatobacter', playeropts: { width: 400, height: 280 }});<br />
});<br />
<br />
<br />
//--><!]]><br />
</script></div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
<div id="block-block-4" class="block block-block"><br />
<br />
<h2>Latest News</h2><br />
<br />
<div class="content"><br />
<script type="text/javascript"><br />
<!--//--><![CDATA[// ><!--<br />
<br />
function tumblr(resp) {<br />
var months = ['Jan','Feb','Mar','Apr','May','Jun','Jul','Aug','Sep','Oct','Nov','Dec'];<br />
var posts = resp.posts;<br />
$('#blog .loading').replaceWith('<ul />');<br />
$ul = $('#blog ul');<br />
for (var i=0; i<4; i++) {<br />
var p = posts[i];<br />
var title = p['regular-title'] || p['link-text'] || null;<br />
if (title) {<br />
var date = new Date(p['unix-timestamp']*1000);<br />
var dateMonth = months[date.getMonth()];<br />
var dateDay = date.getDate();<br />
var html = dateMonth+' '+dateDay+' <a href="'+p['url']+'" rel="lightframe">'+title+'<br />';<br />
$ul.append(html);<br />
}<br />
}<br />
}<br />
<br />
//--><!]]><br />
</script><p><br />
Keep up with the latest news from the Aseatobacter project.</p><br />
<!-- Where you want your tumblog --><div id="blog"><br />
<div class="loading">Loading...</div><br />
</div><br />
<p><a href="http://aseatobacter.tumblr.com" target="_new">View More Blog Posts</a></p><br />
<!-- Bottom of the page, probably. Change host --><script src="http://aseatobacter.tumblr.com/api/read/json?callback=tumblr&num=10" type="text/javascript"></script> </div><br />
</div><br />
<div id="block-block-9" class="block block-block"><br />
<br />
<h2>Featured Photo</h2><br />
<br />
<div class="content"><br />
<div id="images"></div><br />
<p><a href="/Team:NYU_Gallatin/Notebook/Photos" class="more-link">More Photos</a></p><br />
<script type="text/javascript"><br />
<!--//--><![CDATA[// ><!--<br />
<br />
if($('#images').length != 0) {<br />
<br />
setTimeout(function() {$.getJSON(flickr_url, displayImages);},1500);<br />
function displayImages(data) {<br />
// Start putting together the HTML string<br />
var htmlString = "";<br />
<br />
// Now start cycling through our array of Flickr photo details<br />
var k=0;<br />
$.each(data.items, function(i,item){<br />
if(k == 0) {<br />
// I only want the ickle square thumbnails<br />
// var sourceSquare = (item.media.m).replace("_m.jpg", "_s.jpg");<br />
var sourceSquare = item.media.m;<br />
var l_sourceSquare = (item.media.m).replace("_m.jpg", "_b.jpg");<br />
<br />
// Here's where we piece together the HTML<br />
htmlString += '<li><a href="'+l_sourceSquare+'" rel="lightbox">';<br />
htmlString += '<img title="' + item.title + '" src="' + sourceSquare;<br />
htmlString += '" alt="'; htmlString += item.title + '" />';<br />
htmlString += '';<br />
k++;<br />
} <br />
});<br />
<br />
// Pop our HTML in the #images DIV<br />
$('#images').html(htmlString);<br />
}<br />
<br />
}<br />
<br />
//--><!]]><br />
</script> </div><br />
</div><br />
<div id="block-block-5" class="block block-block"><br />
<br />
<h2>Featured Video</h2><br />
<br />
<div class="content"><br />
<iframe width="250" height="200" src="http://www.youtube.com/embed/EBZTe9RWZLo" frameborder="0" allowfullscreen=""></iframe> </div><br />
</div><br />
<div id="block-block-6" class="block block-block"><br />
<br />
<br />
<div class="content"><br />
<p><img src="https://static.igem.org/mediawiki/igem.org/5/52/Aseatobacter-IMAGES-Pipet.png" style="float: right; margin-left: 20px; margin-bottom: 10px;" width="350" /><span class="aseato">What we want.</span></p><br />
<p>Our project seeks to improve the characteristics of cellulose secreted by the gram negative bacterium Acetobacter xylinum. This naturally occurring "chassis" secretes large amounts of cellulose into solution and has been studied for many years. We wish to improve the material properties of this bacterial cellulose by genetically engineering the strain to incorporate color, improved tensile strength and increased hydrophobicity into the improved cellulose based material. After testing it's properties, we will use this material to build larger scale objects.</p><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Parts
Team:NYU Gallatin/Parts
2012-10-04T02:31:20Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-4 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308 active-trail active"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry." class="active-trail active">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Parts}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-parts-menu" class="block block-menu"><br />
<br />
<h2>Pick a Part</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last leaf active-trail"><a href="/Team:NYU_Gallatin/Parts" title="" class="active-trail active">Parts</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Parts</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-4" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8180/8045870937_7a040e1618_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p>Here are the parts we contributed to the Bio Bricks library this year.</p><br />
<table cellspacing="0" cellpadding="3" border="0"><tr><th></th><br />
<th></th><br />
<th>part number</th><br />
<th>description</th><br />
<th>type</th><br />
<th>designer</th><br />
</tr><tr><td style="color: red">♥</td><br />
<td></td><br />
<td><a href="http://partsregistry.org/Part:BBa_K850000" target="_new">Bba_K850000</a></td><br />
<td>AGM1 gene from candida albicans</td><br />
<td>coding</td><br />
<td>Min-Gyu Kim</td><br />
</tr><tr><td style="color: red">♥</td><br />
<td></td><br />
<td><a href="http://partsregistry.org/Part:BBa_K850001" target="_new">Bba_K850001</a></td><br />
<td>NAG1 gene from candida albicans</td><br />
<td>coding</td><br />
<td>Min-Gyu Kim</td><br />
</tr><tr><td style="color: red">♥</td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K850002" target="_new">Bba_K850002</a></td><br />
<td>UAP1 gene from candida albicans</td><br />
<td>coding</td><br />
<td>Min-Gyu Kim</td><br />
</tr><tr><td style="color: red"></td><br />
<td></td><br />
<td><a href="http://partsregistry.org/Part:BBa_K850004" target="_new">Bba_K850004</a></td><br />
<td>NAG5 gene from candida albicans</td><br />
<td>coding</td><br />
<td>Will Long</td><br />
</tr></table></div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Attributions
Team:NYU Gallatin/Attributions
2012-10-04T02:27:03Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-8 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313 active-trail active"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due." class="active-trail active">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Attributions}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-attributions" class="block block-menu"><br />
<br />
<h2>Attributions</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last leaf active-trail"><a href="/Team:NYU_Gallatin/Attributions" title="" class="active-trail active">Attributions</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Attributions</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-8" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p>This year we broke the team up into sub-teams, each focusing on a different aspect of the project. Below find our mini-teams, members, and links to their specific pages.</p><br />
<h3>Team: Cloning</h3><br />
<p>The cloning team consisted of mentors Ellen and Julie and students Min Kim, Alex, Will, Lev, Robyn, Alison, Christina, Steven and Anne.</p><br />
<h3>Team: Growing</h3><br />
<p>The growing team consisted of mentor Corrie and students Josue, James, Jesse, Sara, and Dan.</p><br />
<h3>Team: Transformations</h3><br />
<p>The transformations team consisted of mentor Oliver and students Josh, Sarah, and Alison.</p><br />
<h3>Team: Design</h3><br />
<p>Growing | Mycelia Team: Mentor; Oliver Medvedik and Melanie Fessel.<br /><br />
Students: Shruti Grover, James Schwartz, Josue Ledema, Tania Doles.<br /><br />
Design Team: Mentors; Mitchell Joachim and Melanie Fessel. Students:<br /><br />
Shruti Grover, James Schwartz, Philip Weller. and these are overall credits: Terreform ONE + Genspace, Mitchell<br /><br />
Joachim, Oliver Medvedik, Melanie Fessel, Maria Aiolova, Ellen<br /><br />
Jorgenson, Shruti Grover, James Schwartz, Josue Ledema, Tania Doles,<br /><br />
Philip Weller, Greg Pucillo, Jesse Hull. The design team consisted of mentors Mitch and Phil and students James, Shruti, Justin, Maria. The website was developed by Sara.</p><br />
<h3>Team: Human Practices</h3><br />
<p>The human practices team consisted of mentors Oliver and Mitch and student Dan. Special thanks to landlord Al and his wife B for use of their store in Brooklyn.</p><br />
<h3>References</h3><br />
<ul><li><a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2937499/">Novel In Vivo-Degradable Cellulose-Chitin Copolymer fromMetabolically Engineered Gluconacetobacter xylinus” Yadav, V. et al, ApplEnviron Microbiol. 2010 September; 76(18): 6257–6265.</a></li><br />
</ul><h3>And Our Sponsors:</h3><br />
<div style="background: white"><br />
<center><br /><a href="https://www.assaydepot.com"><img src="http://igem.melodramatic.com/logos/assaydepotlogo.png" /></a><br /><a href="https://www.neb.com"><img src="http://igem.melodramatic.com/logos/hp_neb_logo.gif" /></a><br /><a href="http://www.idtdna.com/site"><img src="http://igem.melodramatic.com/logos/IDTLogo2010.png" /></a><br /><a href="http://www.terreform.org"><img src="http://igem.melodramatic.com/logos/terreform_logo_main2.jpg" /></a><br /><a href="http://genspace.org"><img src="http://igem.melodramatic.com/logos/GENSPACE-logo-large.jpg" width="400" /></a><br /></center><br />
</div><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Safety
Team:NYU Gallatin/Safety
2012-10-04T02:24:16Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-7 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312 active-trail active"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety." class="active-trail active">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Safety}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-safety-menu" class="block block-menu"><br />
<br />
<h2>Be Safe</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last leaf active-trail"><a href="/Team:NYU_Gallatin/Safety" title="" class="active-trail active">Safety</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Safety</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-7" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8177/8052397780_e69014b32e_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><h3 class="aseato">Risks to the safety and health of team members or others in the lab?</h3><br />
<p>Our project uses strains and reagents that are used in biosafety level 1 (BSL1) laboratories. No special precautions are required, other than those specified for work in laboratories at that level, i.e. no food and drinks permitted in the laboratory, gloves and other appropriate personal protective equipment worn during experiments and any toxic solvents used to be disposed of in accordance with Environmental Protection Agency regulations.</p><br />
<h3 class="aseato">Risks to the safety and health of the general public if released by design or accident?</h3><br />
<p>Our project utilizes non-pathogenic derivatives of E. coli strain K-12, so in the event of accidental or otherwise release, the health risks are minimal. E. coli K-12 and derivative strains have an outstanding track record regarding human health and safety. We are also using the cellulose producing strain Acetobacter xylinum and the naturally occurring fungus, Ganoderma lucidum. These organisms are classified as non-pathogenic and can be safely used in a BSL1 facility. </p><br />
<h3 class="aseato">Risks to environmental quality if released by design or accident?<?h3?><br />
</h3><p>The risks upon accidental environmental risk are minimal, as described previously, concerning the uses of bacterial strains of E. coli K-12, Acetobacter xylinum and the eukaryotic fungus, Ganoderma lucidum. Clearly, for any project contemplating intentional release of genetically modified organisms, proper assessments regarding long-term safety and subsequent approval by the United States Department of Agriculture, Food and Drug Administration and/or the Environmental Protection Agency, must be adhered to. In our project, the new organism we are engineering will be used for manufacturing bio-polymers, such as cellulose or chitin based derivatives, within a fermenter-type vessel, with subsequent harvesting of the bio-polymers. Thus, we do not intend to release the viable engineered organism as part of our project.</p><br />
<h3 class="aseato">Risks to security through malicious misuse by individuals, groups or states?</h3><br />
<p>Our BioBricks are not designed to confer any pathogenic attributes to E. coli or A. xylinum, nor is there any data to suggest that they pose any detrimental effects on the environment. Furthermore, since the known uses of cellulose based bio-polymers is primarily as structural material used in biodegradable wound dressings and construction purposes, we do not anticipate any risk of malicious misuse of this technology by individual, groups or states.</p><br />
<h3 class="aseato">Are any parts or devices in your project associated with(or known to cause):</h3><br />
<h3>Pathogenicity, infectivity, or toxicity?</h3><br />
<p>None of the parts or devices that we have used during our project confer any known pathogenicity, infectivity or toxicity to E. coli, Acetobacter or humans. The only known function of these expressed enzymes is to catalyze the formation of chitin based bio-polymers.</p><br />
<h3>Threats to environmental quality?</h3><br />
<p>None of the parts or devices that we have used during our project pose any known threats to environmental quality. The end products are also biodegradable.</p><br />
<h3>Security concerns?</h3><br />
<p>None of the parts or devices that we have used during our project raise any known security concerns as they are not designed to confer any known pathogenicity, infectivity, toxicity or environmental damage.</p><br />
<h3 class="aseato">Under what biosafety provisions will / do you operate?</h3><br />
<p>We are operating in laboratories that are designed to be fully compliant with bio-safety level one (BSL1) recommendations, as described in "Biosafety in Microbiological and Biomedical Laboratories (BMBL) 5th Edition".</p><br />
<h3 class="aseato">Does your institution have its own biosafety rules and if so what are they?</h3><br />
<p>Genspace, where sub-cloning and culturing is performed, adheres to biosafety rules that are in accordance with established guidelines found in the publication "Biosafety in Microbiological and Biomedical Laboratories (BMBL) 5th Edition".</p><br />
<ul><li>Genspace Biosafety Rules</li><br />
<li>Interim Lab Safety Rules</li><br />
</ul><h3 class="aseato">Does your institution have an Institutional Biosafety Committee or equivalent group?</h3><br />
<p>Genspace has an Advisory Board consisting of experts in biosafety, biosecurity, and genetic engineering who hold positions in academia, industry and government. They serve as our Institutional Biosafety Committee. The portions of the project to be carried out at Genspace are BioBrick construction, the construction of plasmids containing sequenced required for chitin biosynthesis and other non-pathogenic sequences and the production of biodegradable biopolymers. This is within the project parameters recommended by our Advisory Board. </p><br />
<h3 class="aseato">Describe any concerns or changes that were made based on this review.</h3><br />
<p>No additional concerns or changes to our project were raised.</p><br />
<h3 class="aseato">Will / did you receive any biosafety and/or lab training before beginning your project? If so, describe this training.</h3><br />
<p>Students participating in this project received safety training (general/chemical/biological) either at Genspace prior to beginning the project. The safety training consisted of a presentation covering the various aspects of safety found in molecular biology laboratories; i.e. proper microbiological techniques, safe disposal of recombinant organisms, etc. Upon completion of the presentation, students were shown the location of all safety equipment i.e. eye wash stations, first aid kits, fire extinguishers and safety exits. Students were also supervised by iGEM instructors at Genspace throughout the duration of the project.</p><br />
<h3 class="aseato">Does your country have national biosafety regulations or guidelines? If so, provide a link to them online if possible.</h3><br />
<p>Guidelines for national bio-safety regulations in the United States via the National Institutes of Health and the Center for Disease Control</p><br />
<h3 class="aseato">Do you have other ideas on how to deal with safety or security issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering?</h3><br />
<p>Genetically engineered bacteria could potentially require the incorporation of redundant genetic pathways that can function as a "kill-switch" to prevent the unchecked replication of the genetically modified organism in the wild, if the organisms are intended to be released into the environment. </p><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project/Transforming
Team:NYU Gallatin/Project/Transforming
2012-10-04T02:22:35Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-35 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail">Project</a><ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Project/Cloning" title="">Cloning</a></li><br />
<li class="leaf active-trail"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff." class="active-trail active">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Characterization" title="">Characterizing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Designing" title="">Designing</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Project/Socializing" title="">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Transformation</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-35" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8311/8052386481_6e29d9d7c0_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p><img src="http://farm9.staticflickr.com/8452/8052046690_74e9f03b01_n.jpg" class="border" style="float: left; margin-right: 20px; margin-bottom: 15px;" />With regard to transformation, electroporation is well-known for its higher cell wall penetration rate and its efficiency on higher-organism cells, mammalian cells in particular. We used electroporation on E. Coli cells, adapting and improving available electroporation protocols to optimize transformed colony yield. <img src="http://farm9.staticflickr.com/8454/8052039349_973bb2a2b1_m.jpg" class="border" style="float: right; margin-left: 20px; margin-bottom: 15px; margin-top: 20px;" /> We hypothesized that corrected voltage and cell preparation procedures would allow us to successfully transform. Acetobacter Xylinum through electroporation. Tests included E.Coli and Acetobacter Xylinum transformation for RFP and GFP expression. Pure Acetobacter Xylinum cultures were also grown in media for several weeks and a chart has been prepared to describe and detail growth patterns. Using a spectrophotometer, light absorbency readings were taken regularly to allow for the collection of daily data. Through this measurement technique, we also determined optimal growth phases for the preparation of Acetobacter Xylinum as an electro-competent cell. </p><br />
<p><img src="http://farm9.staticflickr.com/8317/8052051236_7e6f368694_n.jpg" class="border" style="clear: left" /> <img src="http://farm9.staticflickr.com/8182/8052044117_7b58cb9ea3_n.jpg" class="border" /></p><br />
<h1>Protocols</h1><br />
<h2>Modified E. Coli and Acetobacter Electroporation Protocol</h2><br />
<p>Protocol Adapted From Following Paper:<br /><a href="https://docs.google.com/a/brown.edu/folder/d/0B52k0YOxsn7EQk9kc2VxdlI0NTQ/edit?docId=0B9bdNJ3ouX7GSlFlQ0N5S2hBZW8">https://docs.google.com/a/brown.edu/folder/d/0B52k0YOxsn7EQk9kc2VxdlI0NTQ/edit?docId=0B9bdNJ3ouX7GSlFlQ0N5S2hBZW8</a></p><br />
<h3>Materials Needed:</h3><br />
<ul><li>Ice Cold sterile H20</li><br />
<li>Ice Cold 10% Glycerine</li><br />
<li>Plasmid</li><br />
<li>Bacterial Strain</li><br />
<li>Sterile LB Broth</li><br />
<li>Sterile SOC Broth</li><br />
<li>For Acetobacter: Sterile Acetobacter media. </li><br />
</ul><h3>Materials we used:</h3><br />
<ul><li>MM194 and JM109 E. Coli strains</li><br />
<li>PBR332 plasmid at 5ng/mL concentration</li><br />
</ul><h3>Equipment Used</h3><br />
<ul><li>Bio-Rad Gene-Pulser Electroporation Machine, Resistor, and Capacitance Extender</li><br />
<li>Refrigerated Centrifuge</li><br />
<li>Spectrophotometer</li><br />
</ul><h3>Electro-competent Cell Preparation (for 50 transformations)</h3><br />
<ol><li>Inoculate 5ml liquid LB culture for overnight incubation at 37 degrees with agitation at 225rpm. Use Acetobacter media for Acetobacter cultures instead of LB.</li><br />
<li>Next day, pour 27mL liquid LB into 4 separate 50mL tubes and pre-heat to 37degrees.</li><br />
<li>To each tube, add 1.25mL of overnight culture.</li><br />
<li>Incubate the 50mL tubes with agitation (225rpm 37degrees)</li><br />
<li>Incubate until an A600 absorbance reading of approximately 0.4 is reached, this should take approximately one hour. Acetobacter cultures, which have a much slower growth rate, may be incubated overnight if absorbance readings are not reached. </li><br />
<li>Once bacterial cultures reach desired density, take them out of incubation and put them in an ice bath for 30 minutes.</li><br />
<li>After cooling, spin the tubes in a refrigerated (4degC) centrifuge for 12min at 4100rpm.</li><br />
<li>Pour off supernatant, taking care not to disturb the pellet and re-suspend bacteria pellet in 25mL ice-cold sterile water. Use pipette to accomplish this; do not use a vortex machine.</li><br />
<li>Centrifuge again for 12 minutes at 4100 rpm and 4 degrees C temp</li><br />
<li>Pour off supernatant again, re-suspend pellet in 4mL ice-cold sterile water and transfer suspended mixture to 15mL tube.</li><br />
<li>Centrifuge again for 12 minutes at 4100 rpm and 4 degrees C</li><br />
<li>Pour off water and re-suspend pellet in 2mL ice cold 10% glycerin</li><br />
<li>Centrifuge for 12 Minutes at 4100 rpm and 4 degrees C</li><br />
<li>Aspirate as much supernatant as possible using a micro-pipette and re-suspend pellet in 2mL ice cold 10% glycerin.</li><br />
<li>Store samples on ice for immediate use or freeze down 40ul aliquots at -80degC.</li><br />
</ol><p>Note: Centrifuging has been tried at an extra 100rpm speed for 13 minutes successfully, supernatant was easier to discard. </p><br />
<h3>Electroporation Protocol</h3><br />
<ol><li>Use 40mL aliquots of the suspended bacteria for each transformation.</li><br />
<li>Add 2mL of plasmid (we used PBR322 at 5ng/mL) to 40mL of bacteria suspension and mix</li><br />
<li>Transfer sample to ice cold 1mm gap electroporation cuvette</li><br />
<li>Remove all moisture from outside of cuvette with kimwipe, this is important to prevent electrical arcing. Note: If an arc is observed, then your sample most likely did not successfully transform!</li><br />
<li>Set electroporation machine to 2.5kV current with 200W resistance and 25mF capacitance</li><br />
<li>Using Bio-Rad Gene Pulser: Insert cuvette into cuvette holder, making sure electrodes on the cuvette are touching those in the holder. Make sure cuvette holder is behind a Plexiglas safety shield.</li><br />
<li>Hold down the two red buttons on the gene pulser until you hear a beep, then release, this should indicate that a successful charge was dispersed</li><br />
<li>Using warm SOC media, quickly transfer contents of cuvette and place them into a sterile 15mL tubes, containing 1mL of warm SOC media.</li><br />
<li>Incubate the culture for 1 hour at 37 degrees with gentle agitation</li><br />
<li>After incubation, take 200mL of the sample and plate onto appropriate agar, use beads to spread the sample around the plate</li><br />
</ol><p></p><center><img src="http://farm8.staticflickr.com/7121/7864390690_87fb603e4b_n.jpg" class="border" /> <img src="http://farm9.staticflickr.com/8431/7864392046_b300d7dd16_n.jpg" class="border" /></center><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
<div id="block-views-lab-notes-block-1" class="block block-views"><br />
<br />
<h2>Transformation Lab Notes</h2><br />
<br />
<div class="content"><br />
<div class="view view-lab-notes view-id-lab_notes view-display-id-block_1 view-dom-id-c6a9b70b6f09d2a1ba5fb778386864f1"><br />
<br />
<br />
<br />
<div class="view-content"><br />
<table class="views-table cols-3" ><br />
<thead><br />
<tr><br />
<th class="views-field views-field-field-sub-team" ><br />
Team </th><br />
<th class="views-field views-field-created" ><br />
Date </th><br />
<th class="views-field views-field-body" ><br />
Note </th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr class="odd views-row-first"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/10/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8174/8048768673_d51ef329a3.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/07/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8313/8048773304_9ce0f49fd2.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/04/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8451/8048765553_1ffd507e36.jpg" /><br /><img src="http://farm9.staticflickr.com/8172/8048770556_2604c4a9b2.jpg" /><br /><img src="http://farm9.staticflickr.com/8316/8048765169_52ca13cda9_n.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/03/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8450/8048766095_c94a54efd5.jpg" /><br /><img src="http://farm9.staticflickr.com/8313/8048765937_f6fd019924.jpg" /><br /><img src="http://farm9.staticflickr.com/8180/8048770890_12ba62d1a7.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/02/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8318/8048766337_a5795fb13d.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/01/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8182/8048766707_9cb88da4d7.jpg" /><br /><img src="http://farm9.staticflickr.com/8171/8048771682_17e08a6f17.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/30/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8179/8048766867_8c6cc28dd4.jpg" /><br /><img src="http://farm9.staticflickr.com/8174/8048767007_9a47831e22.jpg" /><br /><img src="http://farm9.staticflickr.com/8455/8048772414_005410d2f1.jpg" /><br /><img src="http://farm9.staticflickr.com/8169/8048767529_8993906e3d.jpg" /><br /><img src="http://farm9.staticflickr.com/8318/8048767697_95e77a28af.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even views-row-last"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/20/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8033/8048772282_58fab176aa.jpg" /></p><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
</div> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Team
Team:NYU Gallatin/Team
2012-10-04T02:15:44Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in no-sidebars page-team" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388 active-trail active"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation." class="active-trail active">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Team}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Team</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div class="view view-team view-id-team view-display-id-page view-dom-id-7eee5c45b82b8a185f4086ea3747a2d1"><br />
<div class="view-header"><br />
<p>Hosted at Genspace, the first-ever community biotechnology laboratory, and sponsored by the NYU Gallatin, undergraduate students from 5 different universities and 10 different majors spent their summer in a creative loft in Brooklyn trying to grow furniture.</p><br />
</div><br />
<br />
<br />
<br />
<div class="view-content"><br />
<h3>Students</h3><br />
<table class="views-view-grid cols-2"><br />
<tbody><br />
<tr class="row-1 row-first"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8169/8027494891_8d49639fbf_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Alex</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Westfield Senior High School</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">DIY Bio</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8182/8047647804_ede5cf61ab_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Alison</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Cooper Union for the Advancement of Science and Art</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Interdisciplinary Engineering (BSE)</div> </div> </td><br />
</tr><br />
<tr class="row-2"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8449/8027481756_69ef909a53_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Arthur</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">SUNY Albany</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Nanoscale Engineering & Nanobio Science</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8296/7868151874_4408cfacf0_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Daniel</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">City University of New York</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Synthetic Biology</div> </div> </td><br />
</tr><br />
<tr class="row-3"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8042/8044744559_3d908686ed_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">James</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Studio Art</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8041/8046077035_1fed79ea9d_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Jesse</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU Gallatin</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Architecture & Travel Writing</div> </div> </td><br />
</tr><br />
<tr class="row-4"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8038/8027486102_6a068ef1ce_n.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Josh</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Brown University</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Biology</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8180/8049008265_23c7ecf4e2_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Josue</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU- Gallatin School of Individualized Study</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Narrative and Humanity</div> </div> </td><br />
</tr><br />
<tr class="row-5"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8311/8052260336_1b3e424952_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Justin</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU Gallatin</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Architecture/Design</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8171/8052102347_1875f86e63.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Min-Gyu</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Jericho High School</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Synthetic Biology</div> </div> </td><br />
</tr><br />
<tr class="row-6"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8460/8047411422_c5db56f670_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Robyn</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Massapequa High School</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8436/7869370860_365cc459b0_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Sara</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Columbia University</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Neuroscience & Behavior</div> </div> </td><br />
</tr><br />
<tr class="row-7"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8435/7868150876_78c57e5b87_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Sarah</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Université de Montréal</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Communication</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8315/8045833408_f763e97205_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Shruti</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Royal College of Art/ Imperial College London</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">MA and MSc Innovation Design Engineering</div> </div> </td><br />
</tr><br />
<tr class="row-8"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8462/8027764242_3a29fb95ec_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Steven</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Eugene Lang College The New School for Liberal Arts</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Interdisciplinary Science - Biology of Health track</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8309/8048756242_87cfe3fd5a_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Tania</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Swarthmore College '12, </div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Biology, Ethnobotanical Design</div> </div> </td><br />
</tr><br />
<tr class="row-9 row-last"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8452/8027489848_3e7917b5ce_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Will</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Bronx High School of Science</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Robotics</div> </div> </td><br />
<td class="col-2 col-last"><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<h3>Mentors</h3><br />
<table class="views-view-grid cols-2"><br />
<tbody><br />
<tr class="row-1 row-first"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8459/8027483888_6090a89620_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Anne</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Genspace</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Too Many Things</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8171/8052101270_c8a70787b1_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Corrie</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">MakerBot</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">3D Printing</div> </div> </td><br />
</tr><br />
<tr class="row-2"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8301/7868153360_dd1af48845_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Ellen</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Co-founder, Genspace NYC and Adjunct Assistant Prof. of pathology at New York Medical College</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Molecular Biology</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8312/8027604375_701c0d3a6a.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Julie</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Albert Einstein College of Medicine</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Molecular biology</div> </div> </td><br />
</tr><br />
<tr class="row-3"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8171/8052286333_3a0bc46a5b_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Maria</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Terreform</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Co-Founder</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8170/8052239465_02d6045ef7_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Melanie</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Terreform ONE, Ecological Design Group for Urban Infrastructure, Building, Planning, and Art</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Director of Design Research</div> </div> </td><br />
</tr><br />
<tr class="row-4"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm8.staticflickr.com/7273/7869335184_53ac84cde5_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Mitch</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">New York University</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Ph.D., Associate Professor in Practice</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8180/8046097510_f9535ceed0_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Nurit</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Genspace</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Arts & Culture Program Director</div> </div> </td><br />
</tr><br />
<tr class="row-5 row-last"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8424/7868155546_d6e1aeb473_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Oliver</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Genspace Co-founder, Director of Scientific Programs</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Ph.D. at Harvard Medical School, in the Biomedical and Biological Sciences program</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8031/8052293622_95b358612a_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Philip</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">California Polytechnic State University</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Architecture</div> </div> </td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
</div> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project/Socializing
Team:NYU Gallatin/Project/Socializing
2012-10-04T02:05:36Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-25 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail">Project</a><ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Project/Cloning" title="">Cloning</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff.">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Characterization" title="">Characterizing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Designing" title="">Designing</a></li><br />
<li class="last leaf active-trail"><a href="/Team:NYU_Gallatin/Project/Socializing" title="" class="active-trail active">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Our Human Practices</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-25" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8178/8048894791_5ebc0b2651_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><!--Load the AJAX API--><script type="text/javascript" src="https://www.google.com/jsapi"></script><script type="text/javascript"><br />
<!--//--><![CDATA[// ><!--<br />
<br />
<br />
// Load the Visualization API and the piechart package.<br />
google.load('visualization', '1.0', {'packages':['corechart']});<br />
<br />
// Set a callback to run when the Google Visualization API is loaded.<br />
google.setOnLoadCallback(drawChart);<br />
<br />
// Callback that creates and populates a data table,<br />
// instantiates the pie chart, passes in the data and<br />
// draws it.<br />
function drawChart() {<br />
<br />
// Create the GENDER data table.<br />
var data = new google.visualization.DataTable();<br />
data.addColumn('string', 'Gender');<br />
data.addColumn('number', 'Surveyed');<br />
data.addRows([ ['Female', 49.4], ['Male', 50.6], ]);<br />
var options = {'width':200, 'height':200, 'legend':'bottom', chartArea:{left:5,top:5,width:"90%",height:"90%"} };<br />
var chart = new google.visualization.PieChart(document.getElementById('chart_gender'));<br />
chart.draw(data, options);<br />
<br />
// Create the AGE data table.<br />
var data = new google.visualization.DataTable();<br />
data.addColumn('string', 'Age');<br />
data.addColumn('number', 'Age');<br />
data.addRows([ ['17 or younger', 3], ['18 to 34', 23.8], ['35 to 49', 28.6], ['50 to 64', 34.5], ['65 or older', 10.1], ]);<br />
var options = { 'width':200, 'height':200, 'legend':'bottom', chartArea:{left:5,top:5,width:"90%",height:"90%"} };<br />
var chart = new google.visualization.PieChart(document.getElementById('chart_age'));<br />
chart.draw(data, options);<br />
<br />
// Create the EDUCATION data table.<br />
var data = new google.visualization.DataTable();<br />
data.addColumn('string', 'Education');<br />
data.addColumn('number', 'Percent');<br />
data.addRows([ ['Some High School', 1.8], ['High School Diploma', 10.7], ['Some College', 19.0], ['College Degree', 33.9], ['Graduate Degree', 34.5], ]);<br />
var options = {'width':200, 'height':200, 'legend':'bottom', chartArea:{left:5,top:5,width:"90%",height:"90%"} };<br />
var chart = new google.visualization.PieChart(document.getElementById('chart_edu'));<br />
chart.draw(data, options);<br />
<br />
<br />
// Create and populate the APPROVAL BY TYPE data table.<br />
var data = google.visualization.arrayToDataTable([<br />
['Type', 'Approve', 'Disapprove', 'No Opinion'], <br />
['Food', 35.1, 53.6, 11.3], ['Clothes', 56.5, 29.2, 14.3], ['Fuels', 70.2, 14.9, 14.9], ['Medicine', 70.2, 19, 10.7],<br />
]);<br />
new google.visualization.ColumnChart(document.getElementById('chart_type')).<br />
draw(data, {width:660, height:400, legend:{position: 'bottom'}, chartArea:{left:25,top:25,width:"95%",height:"80%"}} );<br />
<br />
// Create and populate the APPROVAL BY GENDER data table.<br />
var data = google.visualization.arrayToDataTable([<br />
['Type', 'Men', 'Women'], <br />
['Food', 48.2, 21.7], ['Clothes', 74.1, 38.6], ['Fuels', 84.7, 55.4], ['Medicine', 83.5, 56.6], ['GM is Safe', 67.1, 37.3],<br />
]);<br />
new google.visualization.ColumnChart(document.getElementById('chart_type_gender')).<br />
draw(data, {width:660, height:400, legend:{position: 'bottom'}, chartArea:{left:25,top:25,width:"95%",height:"80%"}} );<br />
<br />
// Create and populate the APPROVAL BY AWARENESS data table.<br />
var data = google.visualization.arrayToDataTable([<br />
['Type', 'Food', 'Clothes', 'Fuels', 'Medicine', 'GM is Safe'], <br />
['Unaware', 22.9, 45.8, 50, 62.5, 43.8], ['Some Awareness', 41, 63.9, 78.7, 77, 62.3], ['Aware', 39, 57.6, 78, 69.5, 49.2],<br />
]);<br />
new google.visualization.ColumnChart(document.getElementById('chart_type_aware')).<br />
draw(data, {width:660, height:400, legend:{position: 'bottom'}, chartArea:{left:25,top:25,width:"95%",height:"80%"}} );<br />
}<br />
<br />
<br />
//--><!]]><br />
</script><h1>Exploring Consumer Reactions</h1><br />
<p>The biological portion of our project altered the cellulose produced by <i>acetobacter xylinum</i> for use as a fabrication material in consumer products. Accordingly, the human practices portion of our project focused on the consumer market for genetically modified (GM) products and sought to identify the primary demographic and psychographic predictors of approval for those products. We used both quantitative and qualitative measures to research this question.</p><br />
<p>The quantitative measure was in the form of a ten item survey administered to a national sample via the world wide web. The survey asked respondents whether they were aware that GM food and cotton were already sold in stores, whether they approved of GM food, clothes, fuels, and medicine, how safe they perceived GM products to be, and basic demographic information including their age, gender, and highest level of education completed. A 37 percent response rate yielded 168 usable responses, and results are reported with 95 percent confidence and a confidence interval of 7.5 percent. We found that product type, gender, and awareness of existing GM products were all predictors of approval for GM products. We also found that women were significantly less likely to approve of GM products (p<br />
</p><p>As a qualitative measure of opinion concerning GM products, we created an artificial store selling GM products at a widely attended street festival in Brooklyn, NY and interviewed visitors concerning their perceptions of actual and hypothetical GM products on display at the store. We interviewed women in particular and found that the perception of GM products as unsafe or untrustworthy is a likely cause of disapproval for GM products.</p><br />
<h1>The Survey</h1><br />
<p><a href="/Team:NYU_Gallatin/Project/Socializing/Survey"><img src="http://farm9.staticflickr.com/8452/8048903468_10fa09f84d_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" /></a>Our human practices portion consists of a study concerning relationships among awareness, education, and approval of different genetically modified products. e.g. Do people care whether cotton is genetically engineered as much as food? The survey results were collected online as well as our shoppe at Atlantic Antic from volunteers off the street. </p><br />
<p><a href="/Team:NYU_Gallatin/Project/Socializing/Survey">Take the survey yourself!</a></p><br />
<h2 style="clear: both">Methodology</h2><br />
<ul><li>10 item web survey regarding genetically modified (GM) products:<br />
<ul><li>Awareness that GM food and cotton are sold (2 items).</li><br />
<li>Approval for GM food, clothes, fuel and medicine (4 items).</li><br />
<li>Perceived safety of GM products (1 item).</li><br />
<li>Age, gender and education (3 items). </li><br />
</ul></li><br />
<li>Respondents were recruited by a survey research firm using email and online advertising, and through social networks.</li><br />
<li>Most respondents received $0.50 to a charity or the chance to win $100 in an online sweepstakes. </li><br />
<li>Survey administered the week of 9/21/12.</li><br />
</ul><h2>Sample Overview</h2><br />
<ul><li>National sample, including more than 50 U.S. metro areas.</li><br />
<li>37 percent response rate, 168 usable responses.</li><br />
</ul><!--Div that will hold the pie chart--><div style="background: white; padding: 15px; text-align: center; -moz-border-radius: 15px; border-radius: 15px;"><br />
<div id="chart_gender" style="display: inline-block"></div><br />
<div id="chart_age" style="display: inline-block"></div><br />
<div id="chart_edu" style="display: inline-block; clear: right"></div><br />
<div id="chart_gender_title" style="display: inline-block; width: 200px; background: white; color: black; text-align: center;">Gender</div><br />
<div id="chart_gender_title" style="display: inline-block; width: 200px; background: white; color: black; text-align: center;">Age</div><br />
<div id="chart_gender_title" style="display: inline-block; width: 200px; background: white; color: black; text-align: center;">Education</div><br />
</div><br />
<h2>Results</h2><br />
<p>The results of our survey showed some interesting insights into the way different types of people view GM products.</p><br />
<h3>Approval Varies by Type</h3><br />
<div style="background: white; padding: 15px; text-align: center; -moz-border-radius: 15px; border-radius: 15px;"><br />
<div id="chart_type" style="display: inline-block"></div><br />
</div><br />
<h3>Approval Varies by Gender</h3><br />
<p>Women seem to approve of GM products much less than men.</p><br />
<div style="background: white; padding: 15px; text-align: center; -moz-border-radius: 15px; border-radius: 15px;"><br />
<div id="chart_type_gender" style="display: inline-block"></div><br />
</div><br />
<h3>Effect of Awareness on Approval</h3><br />
<p>GM Awareness has a limited effect on approval.</p><br />
<div style="background: white; padding: 15px; text-align: center; -moz-border-radius: 15px; border-radius: 15px;"><br />
<div id="chart_type_aware" style="display: inline-block"></div><br />
</div><br />
<h2>Summary</h2><br />
<p></p><ul><li>Product type, gender, awareness all affect approval for GM products.</li><br />
<li>Increasing GM awareness primarily influences undecideds. </li><br />
<li>Age and education showed no significant effect. </li><br />
<li>Results are 95 percent confidence +/- 7.5 percent. </li><br />
<li>Further research needed to examine the mechanism affecting approval. We believe perceived risk versus reward and emotions of disgust and fear are likely drivers. </li><br />
</ul><h1>The Shop</h1><br />
<p>To showcase the wonder and power of genetically modified products to the public, we setup a one-day-only popup shop in Brooklyn, NY on the day of the biggest street fair in New York City -- The Atlantic Antic! With tons of street traffic and several film crews documenting the day and interviewing visitors, the store was a huge success. Check out some of the "products" we were selling that day.</p><br />
<h2>GMO based consumer products: Present and Future</h2><br />
<h3>Living Watch</h3><br />
<p><img src="http://farm9.staticflickr.com/8172/8052323830_97938ac8b7_n.jpg" class="border" /> <img src="http://farm9.staticflickr.com/8321/8052326135_e8fa43ac12_n.jpg" /></p><br />
<p>This biologically based oscillator is attuned not only to lunar and solar cycles, but to biological circadian rhythms as well. Housed in an organic scaffold and bezel setting, the time is digitally indicated by truly organic light emitting diodes; cells that have been genetically modified to bio-luminesce in response to oscillating genetic circuits. With a housing and strap made from laboratory grown keratinocytes and chondrocytes (a.k.a. Victimless Leather), it ensures complete biodegradability when time runs out. </p><br />
<p><i>Availability: Near Future</i></p><br />
<h3>BioCrete</h3><br />
<p><img src="http://farm9.staticflickr.com/8042/8052317291_0bf8cd8cc3_n.jpg" class="border" /> <img src="http://farm9.staticflickr.com/8320/8052332604_63b1440577_n.jpg" class="border" /></p><br />
<p>Did you know that the production of cement is a very energy intensive process and is a source of 5% of industrial CO2 emissions? Build your foundation instead using BioCrete. A genetically engineered strain of a naturally occurring bacterium, Sporosarcina pasteurii, has been designed to secrete both calcium carbonate and spider silk proteins to generate a very durable cement to produce concrete with optimum tensile strength. The strain has also been engineered to be salt tolerant and photosynthetic. Mix with some soil and water, add the freez-dried bacteria, expose to moderate sunlight and grow your dream house!</p><br />
<p><i>Availability: Near to Far Future</i></p><br />
<h3>Microbial Fuel Cell / Engineered ProBiotics</h3><br />
<p>Always feel as if you’re flushing money down the drain? With the Microbial Fuel Cell, you can generate enough power to light up your home. Attaches easily to existing waste water pipes and harnesses bacteria to generate a steady and reliable output of “Bac-tricity.” Naturally occurring E. coli colonize high-surface area carbon nanotube anodes and contribute electrons from their membrane surface. With our genetically modified probiotic supplement, you can “turbo-charge” your gut microbes with probiotic strains over-expressing proteins that optimize the external transfer of electrons. These will yield up to 10 times the current flow as natural strains, ensuring that your roll-on OLED display and Xbox Holodeck doesn’t run out of power. Don’t forget to ask your pharmacist about the “Do Your Duty” Federal Tax Credit available upon purchase.<br /><br />
Availability: Far Future</p><br />
<h3>MicroAlgae BioDiesel</h3><br />
<p><img src="http://farm9.staticflickr.com/8450/8052312163_c33467fdc5_z.jpg" class="border" /></p><br />
<p>Everyone is going green these days, including the U.S. Navy! The grown photosynthetic algae harvests CO2 directly from the atmosphere and uses sunlight to biosynthesize energy packed hydrocarbons. Since the CO2 that is subsequently released from the burning of this fuel has been taken up from the atmosphere, the result is a net carbon-neutral load on the environment. New strains are being genetically engineered to produce higher yields of hydrocarbons which can be used to power everything from F-18 Hornets to the family sedan. </p><br />
<p><i>Availability: Near Future</i></p><br />
<h3>Enzyme based Cleaners</h3><br />
<p>The addition of genetically modified enzymes that degrade proteins (proteases), carbohydrates (amylases) and greases (lipases) to cleaning compounds such as detergents, surface cleaners, contact lens solutions, etc. ensures the speedy removal of accumulated dirt. In addition, enzymes function at lower temperatures, thereby reducing the need for hot water during cleaning. A sample, by no means complete, of some products that contain enzymes for cleaning purposes is on display here.</p><br />
<p><i>Availability: Now</i></p><br />
<h3>GloFish: Genetically Modified Pets</h3><br />
<p>Originally engineered at the National University of Singapore to act as a biosensor to detect pollutants in rivers, these genetically modified zebra fish have proven to be a hit at pet stores nationwide. </p><br />
<p>From <a href="http://www.glofish.com:">www.glofish.com:</a><br /><br />
“GloFish® are brilliantly wonderful fish that add color and excitement to any aquarium, whether at home or the office, or in classrooms. GloFish are similar to other fish, except they have a much brighter disposition. GloFish fluorescent fish are available for purchase in five stunningly beautiful colors: Starfire Red®, Electric Green®, Sunburst Orange®, Cosmic Blue® and Galactic Purple®. Each new GloFish fluorescent fish inherits its unique color directly from its parents, maintains the color throughout its life, and passes the color along to its offspring.”</p><br />
<p><i>Availability: Now</i></p><br />
<h3>The Harvard iGARDEN</h3><br />
<p><img src="http://farm9.staticflickr.com/8314/8052349869_e465b14405_z.jpg" class="border" /></p><br />
<p>Designed as an “open source tool-kit for plant engineering”, the iGARDEN kit was created by Harvard University students during the 2010 International Genetic Engineering competition.<br /><br />
From the Harvard Team IGEM 2010 website:<br /><br />
“The Harvard iGarden is a venture into plant engineering. Our aim is to create a toolkit for the cultivation of a personalized garden containing features introduced through synthetic biology. In addition to a "genetic fence" designed to prevent the spread of introduced genetic material, we have developed three independent features to be included in this toolkit - inclusion of novel flavors, knockdown of plant allergens, and modification of petal color. We envision the iGarden as a medium through which the non-scientist can see the power and potential of synthetic biology and apply it to everyday life.”</p><br />
<p><i>Availability: Near Future</i></p><br />
<h3>Gen2Seat (Generation 2, Seat)</h3><br />
<p><img src="http://farm9.staticflickr.com/8462/8052319709_4ccaecde9b_z.jpg" class="border" /></p><br />
<p>Furniture that is grown using biopolymers derived from genetically modified Acetobacter strains, isolated from Kombucha, that secrete chitin, a durable material also found in insect exoskeletons. What will they think of next! Draped over an interior cushioning derived from fungal mycelia, this chair is light, sturdy and eventually compostable. This consumer item is designed to be produced using a minimum of energy expenditure and is currently being developed by the NYU-Gallatin IGEM team, along with members of Terreform One and Genspace.</p><br />
<p><i>Availability: Very Near Future</i></p><br />
<h3>BioProgrammable Paint</h3><br />
<p><img src="http://farm9.staticflickr.com/8320/8052327397_0d13a808e1_z.jpg" class="border" /></p><br />
<p>Not sure what color to paint your walls? Decide later with programmable paint! Contains micro-encapsulated strains of genetically engineered B. subtilis bacteria. Each bacterium contains a series of genes cloned from various plant biosynthetic pathways that synthesize pigment molecules, such as red lycopene found in tomatoes and orange beta-carotene found in carrots. When freshly applied, the oxygen activated microbes get to work, producing a slowly changing spectrum of synchronized color on applied surfaces for up to a week, with previous pigments being degraded. When your favorite color comes into view, simply wave the enclosed UV emitting wand in the direction of the surface to disable the bacteria and lock in the color. Improved varieties of programmable paint are being worked on that will also absorb allergens and toxins such as carbon monoxide and mold spores.</p><br />
<p><i>Availability: Far Future</i></p><br />
<h3>Genetically Modified Foods</h3><br />
<p>Currently at the center of various controversies, genetically modified crops come in a range of varieties. Crops that have been developed today include varieties of maize, soy and alfalfa, that express genes from the naturally occurring soil bacterium B. thuringiensis. The expressed protein is fatal to insect larvae when they ingest the crops. Most current crops are engineered to be either pest or herbicide resistant. Future varieties of food crop plants are being engineered to have enhanced production of nutrients. Golden rice varieties have been engineered that produce beta-carotene (Viatmin A). Currently 80% of papayas grown in Hawaii are derived from a variety that has been genetically engineered to contain a gene making it resistant to papaya ringspot virus, a natural pest of the papaya plant.</p><br />
<p><i>Availability: Now</i></p><br />
<h3>Detergent enzymes</h3><br />
<p>Taken From Novozymes.com:<br /><br />
Enzymes have been used in detergents since the 1960s. The use of enzymes in laundry and automatic dish washing detergents provides consumers with well proven benefits - both in the washing process itself and in terms of the wider environment.<br /><br />
Enzymes can reduce the environmental load of detergent products since they:<br /><br />
• Save energy and CO2 emissions by enabling lower wash temperatures while maintaining washing performance<br /><br />
• Partly replace other chemicals in detergents, such as surfactants<br /><br />
• Enable compactation, reducing packaging and transportation costs<br /><br />
• Are biodegradable, leaving no harmful residues<br /><br />
• Have no negative environmental impact on sewage treatment processes<br /><br />
• Do not present a risk to aquatic life<br /><br />
Laundry washing is one of the activities that consume the most energy in an ordinary household. By washing at 30 rather than 60 or 40 degrees, the CO2 savings potential in Europe and the US is around 32 million tons – equivalent to the emission of 8 million cars.</p><br />
<p>Position on detergent enzymes<br /><br />
The use of enzymes in detergents provides consumers with well proven benefits. Detergent enzymes present no risk to consumers, nor to employees in detergent production, provided a few simple precautionary measurements are followed in order to avoid the generation of airborne enzyme dust or aerosol.</p><br />
<p>No health risk<br /><br />
At Novozymes only well-known and safe microorganisms is used for enzyme production. Novozymes applies genetic engineering to benefit optimally from the company’s production plants and raw materials - to the clear benefit of the environment.</p><br />
<p>During the production process the enzyme products are recovered from the genetically modified organisms (GMO) and purified. Therefore there are no GMOs present neither in Novozymes' enzyme products. Moreover, Novozymes' production activities are approved and closely regulated and monitored by the Danish environmental authorities.</p><br />
<p>Encapsulated or liquid enzymes can be handled conveniently and safely.</p><br />
<p>Modern biotechnology and detergent enzymes<br /><br />
Man's use of enzyme reactions dates back to antiquity. The making of cheese, vinegar and wine, the leavening of bread, and the brewing of beer are all enzymatic processes which have their origins in prehistory.</p><br />
<p>In the past few decades the industry has increased its use of enzymes, and enzymes are now widely used in many different industries. As they can often replace harsh chemicals and help save on water, energy and raw materials, they have a positive impact on the environment.</p><br />
<p>Enzymes are widely used in the detergent industry where they provide clear cleaning performance benefits in laundry and dish washing detergent products. Enzyme properties may also be improved by the use of protein engineering technique whereby specific amino acid substitutions in the enzyme are coded for in the enzyme gene.</p><br />
<p>Examples are the surfactant replacing enzyme Lipoclean, the improved cold washing efficiency of Polarzyme, and the bleach-resistant starch degrading enzyme Duramyl.</p><br />
<p><a href="http://www.root-cn.com/Laundry-Ball-Knowledge/Laundry%20Detergent%20%20How%20Enzymes%20are%20Changing%20Your%20Wash_663.Html">http://www.root-cn.com/Laundry-Ball-Knowledge/Laundry%20Detergent%20%20H...</a></p><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project/Socializing
Team:NYU Gallatin/Project/Socializing
2012-10-04T01:42:38Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-25 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail">Project</a><ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Project/Cloning" title="">Cloning</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff.">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Characterization" title="">Characterizing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Designing" title="">Designing</a></li><br />
<li class="last leaf active-trail"><a href="/Team:NYU_Gallatin/Project/Socializing" title="" class="active-trail active">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Our Human Practices</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-25" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8178/8048894791_5ebc0b2651_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><!--Load the AJAX API--><script type="text/javascript" src="https://www.google.com/jsapi"></script><script type="text/javascript"><br />
<!--//--><![CDATA[// ><!--<br />
<br />
<br />
// Load the Visualization API and the piechart package.<br />
google.load('visualization', '1.0', {'packages':['corechart']});<br />
<br />
// Set a callback to run when the Google Visualization API is loaded.<br />
google.setOnLoadCallback(drawChart);<br />
<br />
// Callback that creates and populates a data table,<br />
// instantiates the pie chart, passes in the data and<br />
// draws it.<br />
function drawChart() {<br />
<br />
// Create the GENDER data table.<br />
var data = new google.visualization.DataTable();<br />
data.addColumn('string', 'Gender');<br />
data.addColumn('number', 'Surveyed');<br />
data.addRows([ ['Female', 49.4], ['Male', 50.6], ]);<br />
var options = {'width':200, 'height':200, 'legend':'bottom', chartArea:{left:5,top:5,width:"90%",height:"90%"} };<br />
var chart = new google.visualization.PieChart(document.getElementById('chart_gender'));<br />
chart.draw(data, options);<br />
<br />
// Create the AGE data table.<br />
var data = new google.visualization.DataTable();<br />
data.addColumn('string', 'Age');<br />
data.addColumn('number', 'Age');<br />
data.addRows([ ['17 or younger', 3], ['18 to 34', 23.8], ['35 to 49', 28.6], ['50 to 64', 34.5], ['65 or older', 10.1], ]);<br />
var options = { 'width':200, 'height':200, 'legend':'bottom', chartArea:{left:5,top:5,width:"90%",height:"90%"} };<br />
var chart = new google.visualization.PieChart(document.getElementById('chart_age'));<br />
chart.draw(data, options);<br />
<br />
// Create the EDUCATION data table.<br />
var data = new google.visualization.DataTable();<br />
data.addColumn('string', 'Education');<br />
data.addColumn('number', 'Percent');<br />
data.addRows([ ['Some High School', 1.8], ['High School Diploma', 10.7], ['Some College', 19.0], ['College Degree', 33.9], ['Graduate Degree', 34.5], ]);<br />
var options = {'width':200, 'height':200, 'legend':'bottom', chartArea:{left:5,top:5,width:"90%",height:"90%"} };<br />
var chart = new google.visualization.PieChart(document.getElementById('chart_edu'));<br />
chart.draw(data, options);<br />
<br />
<br />
// Create and populate the APPROVAL BY TYPE data table.<br />
var data = google.visualization.arrayToDataTable([<br />
['Type', 'Approve', 'Disapprove', 'No Opinion'], <br />
['Food', 35.1, 53.6, 11.3], ['Clothes', 56.5, 29.2, 14.3], ['Fuels', 70.2, 14.9, 14.9], ['Medicine', 70.2, 19, 10.7],<br />
]);<br />
new google.visualization.ColumnChart(document.getElementById('chart_type')).<br />
draw(data, {width:660, height:400, legend:{position: 'bottom'}, chartArea:{left:25,top:25,width:"95%",height:"80%"}} );<br />
<br />
// Create and populate the APPROVAL BY GENDER data table.<br />
var data = google.visualization.arrayToDataTable([<br />
['Type', 'Men', 'Women'], <br />
['Food', 48.2, 21.7], ['Clothes', 74.1, 38.6], ['Fuels', 84.7, 55.4], ['Medicine', 83.5, 56.6], ['GM is Safe', 67.1, 37.3],<br />
]);<br />
new google.visualization.ColumnChart(document.getElementById('chart_type_gender')).<br />
draw(data, {width:660, height:400, legend:{position: 'bottom'}, chartArea:{left:25,top:25,width:"95%",height:"80%"}} );<br />
<br />
// Create and populate the APPROVAL BY AWARENESS data table.<br />
var data = google.visualization.arrayToDataTable([<br />
['Type', 'Food', 'Clothes', 'Fuels', 'Medicine', 'GM is Safe'], <br />
['Unaware', 22.9, 45.8, 50, 62.5, 43.8], ['Some Awareness', 41, 63.9, 78.7, 77, 62.3], ['Aware', 39, 57.6, 78, 69.5, 49.2],<br />
]);<br />
new google.visualization.ColumnChart(document.getElementById('chart_type_aware')).<br />
draw(data, {width:660, height:400, legend:{position: 'bottom'}, chartArea:{left:25,top:25,width:"95%",height:"80%"}} );<br />
}<br />
<br />
<br />
//--><!]]><br />
</script><h1>Exploring Consumer Reactions</h1><br />
<p>The biological portion of our project altered the cellulose produced by <i>acetobacter xylinum</i> for use as a fabrication material in consumer products. Accordingly, the human practices portion of our project focused on the consumer market for genetically modified (GM) products and sought to identify the primary demographic and psychographic predictors of approval for those products. We used both quantitative and qualitative measures to research this question.</p><br />
<p>The quantitative measure was in the form of a ten item survey administered to a national sample via the world wide web. The survey asked respondents whether they were aware that GM food and cotton were already sold in stores, whether they approved of GM food, clothes, fuels, and medicine, how safe they perceived GM products to be, and basic demographic information including their age, gender, and highest level of education completed. A 37 percent response rate yielded 168 usable responses, and results are reported with 95 percent confidence and a confidence interval of 7.5 percent. We found that product type, gender, and awareness of existing GM products were all predictors of approval for GM products. We also found that women were significantly less likely to approve of GM products (p<br />
</p><p>As a qualitative measure of opinion concerning GM products, we created an artificial store selling GM products at a widely attended street festival in Brooklyn, NY and interviewed visitors concerning their perceptions of actual and hypothetical GM products on display at the store. We interviewed women in particular and found that the perception of GM products as unsafe or untrustworthy is a likely cause of disapproval for GM products.</p><br />
<h1>The Survey</h1><br />
<p><a href="/Team:NYU_Gallatin/Project/Socializing/Survey"><img src="http://farm9.staticflickr.com/8452/8048903468_10fa09f84d_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" /></a>Our human practices portion consists of a study concerning relationships among awareness, education, and approval of different genetically modified products. e.g. Do people care whether cotton is genetically engineered as much as food? The survey results were collected online as well as our shoppe at Atlantic Antic from volunteers off the street. </p><br />
<p><a href="/Team:NYU_Gallatin/Project/Socializing/Survey">Take the survey yourself!</a></p><br />
<h2 style="clear: both">Methodology</h2><br />
<ul><li>10 item web survey regarding genetically modified (GM) products:<br />
<ul><li>Awareness that GM food and cotton are sold (2 items).</li><br />
<li>Approval for GM food, clothes, fuel and medicine (4 items).</li><br />
<li>Perceived safety of GM products (1 item).</li><br />
<li>Age, gender and education (3 items). </li><br />
</ul></li><br />
<li>Respondents were recruited by a survey research firm using email and online advertising, and through social networks.</li><br />
<li>Most respondents received $0.50 to a charity or the chance to win $100 in an online sweepstakes. </li><br />
<li>Survey administered the week of 9/21/12.</li><br />
</ul><h2>Sample Overview</h2><br />
<ul><li>National sample, including more than 50 U.S. metro areas.</li><br />
<li>37 percent response rate, 168 usable responses.</li><br />
</ul><!--Div that will hold the pie chart--><div style="background: white; padding: 15px; text-align: center; -moz-border-radius: 15px; border-radius: 15px;"><br />
<div id="chart_gender" style="display: inline-block"></div><br />
<div id="chart_age" style="display: inline-block"></div><br />
<div id="chart_edu" style="display: inline-block; clear: right"></div><br />
<div id="chart_gender_title" style="display: inline-block; width: 200px; background: white; color: black; text-align: center;">Gender</div><br />
<div id="chart_gender_title" style="display: inline-block; width: 200px; background: white; color: black; text-align: center;">Age</div><br />
<div id="chart_gender_title" style="display: inline-block; width: 200px; background: white; color: black; text-align: center;">Education</div><br />
</div><br />
<h2>Results</h2><br />
<p>The results of our survey showed some interesting insights into the way different types of people view GM products.</p><br />
<h3>Approval Varies by Type</h3><br />
<div style="background: white; padding: 15px; text-align: center; -moz-border-radius: 15px; border-radius: 15px;"><br />
<div id="chart_type" style="display: inline-block"></div><br />
</div><br />
<h3>Approval Varies by Gender</h3><br />
<p>Women seem to approve of GM products much less than men.</p><br />
<div style="background: white; padding: 15px; text-align: center; -moz-border-radius: 15px; border-radius: 15px;"><br />
<div id="chart_type_gender" style="display: inline-block"></div><br />
</div><br />
<h3>Effect of Awareness on Approval</h3><br />
<p>GM Awareness has a limited effect on approval.</p><br />
<div style="background: white; padding: 15px; text-align: center; -moz-border-radius: 15px; border-radius: 15px;"><br />
<div id="chart_type_aware" style="display: inline-block"></div><br />
</div><br />
<h2>Summary</h2><br />
<p></p><ul><li>Product type, gender, awareness all affect approval for GM products.</li><br />
<li>Increasing GM awareness primarily influences undecideds. </li><br />
<li>Age and education showed no significant effect. </li><br />
<li>Results are 95 percent confidence +/- 7.5 percent. </li><br />
<li>Further research needed to examine the mechanism affecting approval. We believe perceived risk versus reward and emotions of disgust and fear are likely drivers. </li><br />
</ul></div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project/Designing
Team:NYU Gallatin/Project/Designing
2012-10-04T01:41:38Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-23 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail">Project</a><ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Project/Cloning" title="">Cloning</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff.">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Characterization" title="">Characterizing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf active-trail"><a href="/Team:NYU_Gallatin/Project/Designing" title="" class="active-trail active">Designing</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Project/Socializing" title="">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Gen2Seat: Genetic Generation Seat</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-23" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8170/8045883113_7cbfdfe00a_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><h2>Designing the Chair</h2><br />
<p>It was always a chair, from the very first brainstorming session. Somehow it just seemed like it fit. What can we do with cellulose, bone, mycelium, and other squishy and hard and structural pieces found naturally in the world? The process was a whirlwind of sketches and attempts -- everything from fruit rollups to wood chips -- until a working model started to emerge.</p><br />
<p></p><center><img src="http://farm9.staticflickr.com/8038/8046110823_41af45f8c9_z.jpg" /></center><br />
<h2>About the Chair</h2><br />
<p><img src="http://farm9.staticflickr.com/8172/8045961128_d692068eda_m.jpg" style="float: left; margin-right: 20px; margin-bottom: 10px; " />The emergence of citizen biotech must be seen within the broader context of advanced technologies becoming ever more readily available to individuals and groups. With that availability, comes enhanced opportunities to develop new ideas. We have produced the first full-scale synthetic biological chair entitled; Genetic Generation Seat or Gen2Seat. At IGEM (International Genetically Engineered Machines) competition, we have genetically engineered the naturally occurring bacterium Acetobacter xylinum.<img src="http://farm9.staticflickr.com/8322/8046038775_9a0074005e_m.jpg" style="float: right; margin-top: 10px; margin-left: 20px; margin-bottom: 10px; " /> This bacterium secretes copious amounts of cellulose, which can then be harvested and used directly as a building material. Alternatively, our goal is to create a novel strain that can also secrete the biopolymer chitin, which is normally produced by arthropods, such as insects and crustaceans. In addition, we fused mycelium blocks with the modified acetobactor to create a new biopolymer. Applying the tools of synthetic biology, alongside other biological disciplines, such as microbiology and tissue engineering, will allow us to create products more organically, with minimal waste and energy expenditure.</p><br />
<ul><li>Media: biopolymer of acetobacter, chitin, mycelium.</li><br />
<li>Size: 20"x 21"x 14".</li><br />
<li>Support/ Consultation: Ecovative Design LLC, Suzanne Lee and BioCouture.</li><br />
<li>Sponsor: NYU Gallatin.</li><br />
</ul><h2>What's Inside</h2><br />
<p></p><center><img src="http://farm9.staticflickr.com/8034/8045955365_20a8c73fbc_b.jpg" /></center><br />
<h2>Previous Attempts</h2><br />
<p></p><center><img src="http://farm9.staticflickr.com/8042/8046147303_6d3ac1f74e_z.jpg" /></center><br /><center><img src="http://farm9.staticflickr.com/8317/8045909224_6b5012bcd4_b.jpg" width="650" class="border" /></center><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project/Growing
Team:NYU Gallatin/Project/Growing
2012-10-04T01:40:50Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-22 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail">Project</a><ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Project/Cloning" title="">Cloning</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff.">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Characterization" title="">Characterizing</a></li><br />
<li class="leaf active-trail"><a href="/Team:NYU_Gallatin/Project/Growing" title="" class="active-trail active">Growing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Designing" title="">Designing</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Project/Socializing" title="">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Growing Cellulose</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-22" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8320/8044405099_98f49bfd49_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p>Growing cellulose is like growing a giant vat of kombucha tea, in fact all of the basic ingredients are the same and if we had been brave enough to taste one of our cellulose growths perhaps we might have enjoyed what we found. Here you'll find the adventures (and mis-adventures!) of growing cellulose as an upholstery fabric.</p><br />
<h1>Small Growths</h1><br />
<p>To start our experiment in harvesting cellulose on a large scale, we wanted to try out different ingredients and see which ones yielded the most product.</p><br />
<p></p><center><img src="http://farm9.staticflickr.com/8433/7861082432_1478d8a31c_n.jpg" class="border" /> <img src="http://farm8.staticflickr.com/7106/7861055800_9060fb1f69_n.jpg" class="border" /></center><br /><center><img src="http://farm9.staticflickr.com/8175/8044426800_1f32897848_n.jpg" class="border" /> <img src="http://farm9.staticflickr.com/8029/8044427164_fe2bc776ae_n.jpg" class="border" /></center><br />
<h1>Large Growths</h1><br />
<p>Eventually the scale and the smell were too much, and we had to construct a little cellulose growth center on the roof of our Brooklyn building.</p><br />
<p></p><center><img src="http://farm9.staticflickr.com/8034/8048990682_5d509b407b_n.jpg" class="border" /> <img src="http://farm9.staticflickr.com/8172/8048986135_60e6734129_n.jpg" class="border" /></center><br /><center><img src="http://farm9.staticflickr.com/8462/8048991235_db29469882_n.jpg" class="border" /> <img src="http://farm9.staticflickr.com/8320/8048993475_9d03b25ebe_n.jpg" class="border" /></center><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project/Transforming
Team:NYU Gallatin/Project/Transforming
2012-10-04T01:39:51Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-35 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail">Project</a><ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Project/Cloning" title="">Cloning</a></li><br />
<li class="leaf active-trail"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff." class="active-trail active">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Characterization" title="">Characterizing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Designing" title="">Designing</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Project/Socializing" title="">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Transformation</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-35" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p><img src="http://farm9.staticflickr.com/8452/8052046690_74e9f03b01_n.jpg" class="border" style="float: left; margin-right: 20px; margin-bottom: 15px;" />With regard to transformation, electroporation is well-known for its higher cell wall penetration rate and its efficiency on higher-organism cells, mammalian cells in particular. We used electroporation on E. Coli cells, adapting and improving available electroporation protocols to optimize transformed colony yield. <img src="http://farm9.staticflickr.com/8454/8052039349_973bb2a2b1_m.jpg" class="border" style="float: right; margin-left: 20px; margin-bottom: 15px; margin-top: 20px;" /> We hypothesized that corrected voltage and cell preparation procedures would allow us to successfully transform. Acetobacter Xylinum through electroporation. Tests included E.Coli and Acetobacter Xylinum transformation for RFP and GFP expression. Pure Acetobacter Xylinum cultures were also grown in media for several weeks and a chart has been prepared to describe and detail growth patterns. Using a spectrophotometer, light absorbency readings were taken regularly to allow for the collection of daily data. Through this measurement technique, we also determined optimal growth phases for the preparation of Acetobacter Xylinum as an electro-competent cell. </p><br />
<p><img src="http://farm9.staticflickr.com/8317/8052051236_7e6f368694_n.jpg" class="border" style="clear: left" /> <img src="http://farm9.staticflickr.com/8182/8052044117_7b58cb9ea3_n.jpg" class="border" /></p><br />
<h1>Protocols</h1><br />
<h2>Modified E. Coli and Acetobacter Electroporation Protocol</h2><br />
<p>Protocol Adapted From Following Paper:<br /><a href="https://docs.google.com/a/brown.edu/folder/d/0B52k0YOxsn7EQk9kc2VxdlI0NTQ/edit?docId=0B9bdNJ3ouX7GSlFlQ0N5S2hBZW8">https://docs.google.com/a/brown.edu/folder/d/0B52k0YOxsn7EQk9kc2VxdlI0NTQ/edit?docId=0B9bdNJ3ouX7GSlFlQ0N5S2hBZW8</a></p><br />
<h3>Materials Needed:</h3><br />
<ul><li>Ice Cold sterile H20</li><br />
<li>Ice Cold 10% Glycerine</li><br />
<li>Plasmid</li><br />
<li>Bacterial Strain</li><br />
<li>Sterile LB Broth</li><br />
<li>Sterile SOC Broth</li><br />
<li>For Acetobacter: Sterile Acetobacter media. </li><br />
</ul><h3>Materials we used:</h3><br />
<ul><li>MM194 and JM109 E. Coli strains</li><br />
<li>PBR332 plasmid at 5ng/mL concentration</li><br />
</ul><h3>Equipment Used</h3><br />
<ul><li>Bio-Rad Gene-Pulser Electroporation Machine, Resistor, and Capacitance Extender</li><br />
<li>Refrigerated Centrifuge</li><br />
<li>Spectrophotometer</li><br />
</ul><h3>Electro-competent Cell Preparation (for 50 transformations)</h3><br />
<ol><li>Inoculate 5ml liquid LB culture for overnight incubation at 37 degrees with agitation at 225rpm. Use Acetobacter media for Acetobacter cultures instead of LB.</li><br />
<li>Next day, pour 27mL liquid LB into 4 separate 50mL tubes and pre-heat to 37degrees.</li><br />
<li>To each tube, add 1.25mL of overnight culture.</li><br />
<li>Incubate the 50mL tubes with agitation (225rpm 37degrees)</li><br />
<li>Incubate until an A600 absorbance reading of approximately 0.4 is reached, this should take approximately one hour. Acetobacter cultures, which have a much slower growth rate, may be incubated overnight if absorbance readings are not reached. </li><br />
<li>Once bacterial cultures reach desired density, take them out of incubation and put them in an ice bath for 30 minutes.</li><br />
<li>After cooling, spin the tubes in a refrigerated (4degC) centrifuge for 12min at 4100rpm.</li><br />
<li>Pour off supernatant, taking care not to disturb the pellet and re-suspend bacteria pellet in 25mL ice-cold sterile water. Use pipette to accomplish this; do not use a vortex machine.</li><br />
<li>Centrifuge again for 12 minutes at 4100 rpm and 4 degrees C temp</li><br />
<li>Pour off supernatant again, re-suspend pellet in 4mL ice-cold sterile water and transfer suspended mixture to 15mL tube.</li><br />
<li>Centrifuge again for 12 minutes at 4100 rpm and 4 degrees C</li><br />
<li>Pour off water and re-suspend pellet in 2mL ice cold 10% glycerin</li><br />
<li>Centrifuge for 12 Minutes at 4100 rpm and 4 degrees C</li><br />
<li>Aspirate as much supernatant as possible using a micro-pipette and re-suspend pellet in 2mL ice cold 10% glycerin.</li><br />
<li>Store samples on ice for immediate use or freeze down 40ul aliquots at -80degC.</li><br />
</ol><p>Note: Centrifuging has been tried at an extra 100rpm speed for 13 minutes successfully, supernatant was easier to discard. </p><br />
<h3>Electroporation Protocol</h3><br />
<ol><li>Use 40mL aliquots of the suspended bacteria for each transformation.</li><br />
<li>Add 2mL of plasmid (we used PBR322 at 5ng/mL) to 40mL of bacteria suspension and mix</li><br />
<li>Transfer sample to ice cold 1mm gap electroporation cuvette</li><br />
<li>Remove all moisture from outside of cuvette with kimwipe, this is important to prevent electrical arcing. Note: If an arc is observed, then your sample most likely did not successfully transform!</li><br />
<li>Set electroporation machine to 2.5kV current with 200W resistance and 25mF capacitance</li><br />
<li>Using Bio-Rad Gene Pulser: Insert cuvette into cuvette holder, making sure electrodes on the cuvette are touching those in the holder. Make sure cuvette holder is behind a Plexiglas safety shield.</li><br />
<li>Hold down the two red buttons on the gene pulser until you hear a beep, then release, this should indicate that a successful charge was dispersed</li><br />
<li>Using warm SOC media, quickly transfer contents of cuvette and place them into a sterile 15mL tubes, containing 1mL of warm SOC media.</li><br />
<li>Incubate the culture for 1 hour at 37 degrees with gentle agitation</li><br />
<li>After incubation, take 200mL of the sample and plate onto appropriate agar, use beads to spread the sample around the plate</li><br />
</ol></div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
<div id="block-views-lab-notes-block-1" class="block block-views"><br />
<br />
<h2>Transformation Lab Notes</h2><br />
<br />
<div class="content"><br />
<div class="view view-lab-notes view-id-lab_notes view-display-id-block_1 view-dom-id-7d572c2866ee1cad175a8b10b5085952"><br />
<br />
<br />
<br />
<div class="view-content"><br />
<table class="views-table cols-3" ><br />
<thead><br />
<tr><br />
<th class="views-field views-field-field-sub-team" ><br />
Team </th><br />
<th class="views-field views-field-created" ><br />
Date </th><br />
<th class="views-field views-field-body" ><br />
Note </th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr class="odd views-row-first"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/10/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8174/8048768673_d51ef329a3.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/07/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8313/8048773304_9ce0f49fd2.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/04/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8451/8048765553_1ffd507e36.jpg" /><br /><img src="http://farm9.staticflickr.com/8172/8048770556_2604c4a9b2.jpg" /><br /><img src="http://farm9.staticflickr.com/8316/8048765169_52ca13cda9_n.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/03/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8450/8048766095_c94a54efd5.jpg" /><br /><img src="http://farm9.staticflickr.com/8313/8048765937_f6fd019924.jpg" /><br /><img src="http://farm9.staticflickr.com/8180/8048770890_12ba62d1a7.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/02/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8318/8048766337_a5795fb13d.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/01/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8182/8048766707_9cb88da4d7.jpg" /><br /><img src="http://farm9.staticflickr.com/8171/8048771682_17e08a6f17.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/30/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8179/8048766867_8c6cc28dd4.jpg" /><br /><img src="http://farm9.staticflickr.com/8174/8048767007_9a47831e22.jpg" /><br /><img src="http://farm9.staticflickr.com/8455/8048772414_005410d2f1.jpg" /><br /><img src="http://farm9.staticflickr.com/8169/8048767529_8993906e3d.jpg" /><br /><img src="http://farm9.staticflickr.com/8318/8048767697_95e77a28af.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even views-row-last"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/20/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8033/8048772282_58fab176aa.jpg" /></p><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
</div> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project/Cloning
Team:NYU Gallatin/Project/Cloning
2012-10-04T01:36:49Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-21 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail">Project</a><ul class="menu clearfix"><li class="first leaf active-trail"><a href="/Team:NYU_Gallatin/Project/Cloning" title="" class="active-trail active">Cloning</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff.">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Characterization" title="">Characterizing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Designing" title="">Designing</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Project/Socializing" title="">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Cloning</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-21" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8038/8044401408_5ac681d0f7_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><h1>Project</h1><br />
<p><img src="http://farm9.staticflickr.com/8310/8046195496_184143ce61_m.jpg" style="float: right; margin-bottom: 10px; margin-left: 10px; border: solid black 1px;" />Designer Suzanne Lee showed that bacterial cellulose could be used in novel ways, including to make clothing using a more eco-friendly process. Our team set out to demonstrate that new characteristics could be added to the cellulose produced by Acetobacter xylinum using synthetic biology methods. Altering physical characteristics such as strength, color, odor, etc. would result in exciting new materials to create with. </p><br />
<p>Cellulose is a polymer made up of long β-1,4 glucan chains. In Acetobacter, the enzyme cellulose synthase catalyzes the biosynthesis of cellulose from UDP-glucose. We hypothesized that mixed polymers containing different sugars would have unique physical properties. Cellulose synthase has been reported to utilize UDP-N-acetylglucosamine (NAG) molecules (components of chitin) as well, resulting in a polymer containing both glucose and NAG units- a cellulose-chitin hybrid. We wanted to test the properties of this new material, so we set out to engineer Acetobacter to produce this hybrid polymer.</p><br />
<h1>Strategy</h1><br />
<p>The yeast Candida albicans produces chitin and uses it in spore formation. To incorporate NAG into Acetobacter cellulose, we focused on three yeast genes (the pathway consisting of NAG5 (GlcNac kinase) catalyzes the conversion to GlcNac-6P, AGM1 (Phosphoacetyl-glucosamine mutase) which converts GlcNac-6-P to GlcNac-1-P, and UAP1 (UDP-GlcNac pyrophosphorylase) which adds UDP. </p><br />
<p><img src="http://farm9.staticflickr.com/8322/8046206114_ea3482c939_m.jpg" style="float: left; margin-bottom: 10px; margin-right: 10px; border: solid black 1px;" />The most efficient method was to use Gibson assembly to piece together each gene from small, ovelapping fragments of between 300 and 500bp ("G-blocks") and clone it into pSB1C3 separately. We could not construct the entire pathway with G-blocks because it was too large, and there is a limit of six fragments for efficient Gibson assembly. The coding sequences were modified to reflect codon usage in Acetobacter, and an Acetobacter RBS was added in front of each gene. The G-blocks that we had synthesized for each gene are shown below:</p><br />
<ul><li><a onclick="javascript:$('#g-agm1').toggle();">G-blocks for AGM1</a><br /><div id="g-agm1" style="display: none"><br />
<p>GAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTGAGGAGGATGAACGACGCATGTCAATTGAACAAACATTATCACAATATTTACCATCACATCCAAAACCACAAGGTGTGACATTTACTTATGGGACAGCAGGATTCCGTATGAAAGCTGATAAATTAGATTATGTCACTTTTACCGTTGGGATCATTGCTTCATTAAGATCGAAATATTTACAAGGGAAAACCGTTGGTGTTATGATTACTGCTTCTCATAATCCCCCGGAAGATAATGGGGTTAAAGTTGTTGATCCATTAGGTAGTATGTTGGAAAGTTCATGGGAAAAATATGCTACTGATTTAGCCAATGCTTCTCCTTCTCCTTCTA 402</p><br />
<p>TATGCTACTGATTTAGCCAATGCTTCTCCTTCTCCTTCTAACGATTCAGAAGGGGAAAAAAATCTGTTGGTGGAAGTTATTAAAAATTTGGTTTCTGATTTGAAAATTGATTTATCTATTCCTGCTAATGTTGTTATTGCTAGGGATTCAAGAGAATCTAGTCCAGCATTATCAATGGCAACTATTGATGGATTTCAAAGTGTTCCCAACACTAAATATCAAGATTTTGGATTATTTACTACCCCAGAATTACATTATGTTACTAGAACATTAAACGATCCCGATTTTGGTAAACCAACTGAAGATGGTTATTATTCTAAATTAGCAAAATCTTTCCAAGAAATTTATACCATTTGTGAATCTAATAATGAAAAAATCGATATAACTATTGATGCTGCTAATGGTGTTGGAGCCCCCAAA 420</p><br />
<p>TATAACTATTGATGCTGCTAATGGTGTTGGAGCCCCCAAAATTCAAGAATTATTAGAAAAATATTTACATAAAGAAATCAGTTTTACCGTGGTTAACGGTGATTATAAACAACCAAATTTATTAAATTTTGATTGTGGAGCTGATTATGTCAAGACTAATCAAAAATTACCTAAAAATGTCAAACCAGTAAATAATAAATTATATGCTTCATTTGATGGCGATGCGGATAGATTAATATGTTATTATCAAAACAATGATAATAAATTCAAATTATTAGATGGTGATAAATTATCGACGTTATTTGCGTTATTTTTACAACAATTATTTAAACAAATTGACCCCACTAAGATTTCATTGAATATTGGTGTGGTTCAAACTGC 381</p><br />
<p>CCCACTAAGATTTCATTGAATATTGGTGTGGTTCAAACTGCTTATGCTAATGGATCTTCAACAAAATATGTTGAAGATGTTTTGAAAATTCCTGTTCGTTGTACTCCTACTGGTGTTAAACATTTACATCATGAAGCTGAAAATTTCGATATTGGTGTATATTTTGAAGCTAATGGGCATGGTACAGTTATTTTCAATCCTGAAGCCGAAAAGAAAATTTTCAATTATAAACCAAATAATGATAATGAAGCTAAAGCTATTAAAGTTTTACAAAATTTTAGTCAATTAATTAATCAAACTGTGGGTGATGCAATTTCCGATTTATTGGCCGTGTTAATTGTCGTTCATTATTTGAAATTATCACCAAGTGATTGGGATAATGAATATACTGA 392</p><br />
<p>TTGAAATTATCACCAAGTGATTGGGATAATGAATATACTGATTTACCTAATAAATTGGTTAAAGTGATTGTTCCTGATAGATCTATATTCAAAACTACAAATGCTGAAAGAACTTTGGTTGAACCTAAAGGTATGCAAGATGAAATTGATAAATTAGTTGCCCAATATCCAAATGGAAGATCTTTTGTAAGAGCTTCTGGTACTGAAGATGCTGTTAGAGTTTATGCTGAAGCTGATACGCAAAATAACGTTGAAGAATTATCTAAAGCAGTATCTGAATTAGTTAAATAGTACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCC 348</p><br />
</div><br />
</li><br />
<li><a onclick="javascript:$('#g-nag5').toggle();">G-blocks for NAG5</a><br /><div id="g-nag5" style="display: none"><br />
<p>GAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTGAGGAGGATGAACGACGCATGACTGAGA CTAGCATTAG TGGGTTGCGT GGCCCCAAGT CCATGTATTT TATGGAGATTGTTGATGTGT CGTCGCAAGA ATCCAGTGTG TTGTCGAGTA TTGTTGAATC GTTTACGTCTGCGGTATCTG CATCGAACTT GGGGGTATAC TCTGATGAAG TGCTTTGTGA TATCAAACTGTCGTTGAAAG AGAAATCCCC AATTACTATG TTACCTAACT ATAATGTCTC CCCTACAGGCGACGAGCATG GACAGTATTT GGTTATTGAT TTAGGAGGGT</p><br />
<p>CCCTACAGGCGACGAGCATG GACAGTATTT GGTTATTGAT TTAGGAGGGT CGACATTGAG AATAGCAGTGGTAGACATTT CCAAGCCACA CCCAAATTTG TCGAGAAGTG AGAGGATAAC TATAGTTGTGGAAAAGAGTT GGATTATTGG CAACGACTTT AAGAGGATTG ATGGTGAGTT TTTCAAGTATATTGGGTCCA AGATTAACGA GATATTGATG GGACAGAATG TTATTGATGT AAAGTCGGTT ATCAATACTG GTATAACCTG GTCGTTCCCG TTGGAAACAA CCGACTACAA TAGAGGCAAGATCAAGCATG TTTCCAAAGG GTATACTGTG GGAGAGG</p><br />
<p>CAA TAGAGGCAAGATCAAGCATG TTTCCAAAGG GTATACTGTG GGAGAGGATA TTTACGACAA GGATTTAAAGATGGTTTTGG AAGACACGTT GAGACAAGAG TACGGGTTGA CACTTGACGT GCAGTCTATATTGAACGACT CGTTGGCGGT GTATTCTGCT GGGTGCTTTA TTGATTCGAA GATGAAGTTGGCCATGGTGT TGGGGACAGG GATTAACATG TGCTGTTCCC TAAAAAGGTC AAGTGATATCCACCCCTCCA AGATGTTGGC TGATGCTACG TTGTTTAATT GTGAGCTCTC GTTGTTTGGCCAGAATCTAT GTAAAGACTT TGCTACGAAA TATGATATCA TTATAGACAA</p><br />
<p> CAGAATCTAT GTAAAGACTT TGCTACGAAA TATGATATCA TTATAGACAA GAGGTTTGCTGGTTTGCTGC ACCACTTTAA GACGTTTATG GAGCCTGACC CTATTACAAA AACGCTTTTCCAGCCGCACG AGTTGATGAC CAGTGGGAGG TACTTGCCAG AATTGACGAG TTGGTGGTGGTAGATTTGA TTGAGGCTGG CGAGATTTTT CAAAATGTTG ACCACCAACA GATGTACCAAGAGTATGGTG GGTTTAGTGG GGAGTTGATT TGTTTTGTGC ATGAGAATGA CGATTATGATGATATACATG ACAAGTTGTG CAAGGCCTAC GGCTGGACGA CGGTTGGGTTGAGTGACATTGTCTGCTTGA AAGAAGTTGT ATCGTGCATT ATCAAGCGGG </p><br />
<p>GAGTGACATTGTCTGCTTGA AAGAAGTTGT ATCGTGCATT ATCAAGCGGG CGGCGTTTAT TGTTGCCAATGCGATTATTG CGTTTTTCAA ATTGTTGGGC AGTGACGAGT TGGGTGGTGA TGTGACGATTGGGTATGTGG GGTCGGTCTT GAACTACTTT CACAAGTATA GACGGTTGAT TGTTGAGTATGTGAATAGCG CAGAGGAGGC CAAGGGGATA AAGGTTGACT TGAAGTTGAT TGAAAATAGCTCGATTATAG GTGCTGCCAT AGGTGCTGCC TATCATAAG TAGTACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACC</p><br />
</div><br />
</li><br />
<li><a onclick="javascript:$('#g-uap1').toggle();">G-blocks for UAP1</a><br /><div id="g-uap1" style="display: none"><br />
<p>GAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTGAGGAGGATGAACGACGCATGACAGTTAAATCACAACAACAAATTATTGATTCATTCAAACAAGCTAATCAAGATCAACTTTTCCAATATTATGATTCATTGACAATAAATCAACAACAAGAATTTATAGATCAATTGTCAACTATTGAAGAACCAGCTAAATTGATTTCTACTGTAGAACAAGCGATTCAATTTTCTCAAACCAATTCTACATCAAGAAATTTCACTCAATTACCTAATGAACAAACAGCATCAACTTTAGATTTATCAAAAGACATTTTACAAAATTGGACCGAATTAGGTTTAAAAGCCATTGGTAATGGAGAAGTTGCCGTTTTATTGATGGCAGGAGGTCAAGGAAC 433</p><br />
<p>GAGAAGTTGCCGTTTTATTGATGGCAGGAGGTCAAGGAACTAGATTAGGTTCAAGTGCTCCCAAAGGTTGTTTTAATATTGAATTACCATCACAAAAATCATTATTTCAAATTCAAGCTGAAAAAATTTTGAAAATTGAACAATTAGCTCAACAATATTTGAAATCGACTGAAAAACCAATTATTAATTGGTATATTATGACCAGTGGTCCTACTAGAAATGCTACTGAATCATTTTTCATTGAAAATAATTATTTTGGTTTAAATTCTCATCAAGTGATTTTTTTCAATCAAGGAACGTTGCCATGTTTTAATTTACAAGGCAATAAAATCTTATTAGAACTGAAAAATTCAATTTGTCAATCACCCGATGGTAATGGTGGATTATATAAGGC 384</p><br />
<p>TTTGTCAATCACCCGATGGTAATGGTGGATTATATAAGGCATTAAAAGATAATGGAATACTAGATGATTTCAATTCTAAGGGCATCAAACATATTCATATGTATTGTGTTGATAATTGTTTAGTTAAAGTTGCTGATCCAATTTTCATTGGATTTGCCATTGCCAAAAAATTTGATTTGGCAACAAAAGTGGTTAGAAAAAGAGACGCTAATGAAAGTGTTGGATTAATTGTTTTAGATCAAGATAATCAAAAACCTTGTGTTATTGAATATAGTGAAATTTCTCAAGAATTGGCTAACAAAAAAGACCCTCAAGATTCTTCTAAATTATTTTTAAGAGCTGCTAATATTGTTAATCATTATTATTCAGTGGAATTTTTAAATAAAATGATTCCTAAATGGATTTCATCTCAAAAATATTTACCATTCC 429</p><br />
<p>ATTCCTAAATGATTTCATCTCAAAAATATTTACCATTCCATATAGCTAAAAAGAAAATCCCAAGTTTGAATTTAGAAAATGGAGAATTTTATAAACCAACTGAACCAAATGGTATTAAATTAGAACAATTCATTTTCGATGTTTTCCCATCAGTCGAATTAAATAAATTTGGTTGTTTAGAAGTCGATCGTTTAGATGAATTTTCTCCATTGAAAAACGCCGATGGTGCTAAAAATGATACTCCAACAACTTGTAGAAATCATTACCTTGAAAGAAGTTCCAAATGGGTTATTCAAAATGGTGGAGTTATTGATAATCAAGGATTAGTTGAAGTTGATAGTAAAACCAGTTATGGTGGTGAAGGTTTAGAATTTGTTAATGGTAAACATTTCAAAAATGGCGATATTATTTAATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCC 470</p><br />
</div><br />
</li><br />
</ul><p>This worked very well, and resulted in the submission of three new parts to the BioBrick Library (Bba_K850000, Bba_K850001, Bba_K850002). We then set out to fuse these three genes into a single pSB1C3-based plasmid. PCR primers were synthesized to bracket each of the three genes and also add sequernce that would facilitate Gibson assembly of the entire pathway. Our reasoning was that we could then use Gibson assembly to piece together the three genes in the pathway together into pSB1C3. The sequences of these primers is shown below. We included two forward primers dfor the AGM1 gene- one that included the T7 promoter (known to work in Acetobacter, whose own promoters are not clearly understood yet), and one that did not.</p><br />
<p></p><center><img src="http://farm9.staticflickr.com/8035/8049080716_3bef9f0a16_n.jpg" class="border" /> <img src="http://farm9.staticflickr.com/8319/8049081732_b72fe60544_n.jpg" /></center><br />
<h1>Primers</h1><br />
<ul><li><a onclick="javascript:$('#f-agm1').toggle();">Forward AGM1 (biobrick plasmid + promoter</a><br /><div id="f-agm1" style="display: none"><br />
<p>CAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTAATACGACTCACTATAGGGAATACAAGCTACTTGTTCTTTTTGCATGAGGAGGATGAACGACGCATG</p><br />
</div><br />
</li><li><a onclick="javascript:$('#r-agm1').toggle();">Reverse AGM1</a><br /><div id="r-agm1" style="display: none"><br />
<p>GCAGTATCTGAATTAGTTAAATAGTGAGGAGGATGAACGACGCATGAGACAAGCTATATTTTCCAACCCTAACGATGCTGCGCAGCATCGTTAGGGTTGGAAAATATAGCTTGTCTCATGCGTCGTTCATCCTCCTCACTATTTAACTAATTCAGATACTGC</p><br />
</div><br />
</li><br />
<li><a onclick="javascript:$('#f-nag5').toggle();">Forward NAG5</a><br /><div id="f-nag5" style="display: none"><br />
<p>CGTTGAAGAATTATCTAAAGCAGTATCTGAATTAGTTAAATAGTGAGGAGGATGAACGACGCATGAGACAAGCTATATTTTCCAACCC</p><br />
</div><br />
</li><br />
<li><a onclick="javascript:$('#r-nag5').toggle();">Reverse NAG5</a><br /><div id="r-nag5" style="display: none"><br />
<p>GCTGGATTAAAGTCAAAGTTGTAGTGAGGAGGATGAACGACGCATGACAGTTAAATCACAACAACAAATTATTGATTCATTCATGAATGAATCAATAATTTGTTGTTGTGATTTAACTGTCATGCGTCGTTCATCCTCCTCACTACAACTTTGACTTTAATCCAGC</p><br />
</div><br />
</li><br />
<li><a onclick="javascript:$('#f-uap1').toggle();">Forward UAP1</a><br /><div id="f-uap1" style="display: none"><br />
<p>GTTTGCGATAACGCTGCCGCTGGATTAAAGTCAAAGTTGTAGTGAGGAGGATGAACGACGCATGACAGTTAAATCACAAC</p><br />
</div><br />
</li><br />
<li><a onclick="javascript:$('#r-uap1').toggle();">Reverse UAP1 (biobrick plasmid)</a><br /><div id="r-uap1" style="display: none"><br />
<p>CAAAAATGGCGATATTATTTAATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTATTAAATAATATCGCCATTTTTG</p><br />
</div><br />
</li><br />
</ul><p>The primers for the NAG5 and UAP1 genes worked well, resulting in PCR products of the expected size. However, the AGM1 primers did not result in a PCR product even when used under a variety of conditions. We then altered our cloning strategy and attempeted to use traditional BioBrick assembly. The plasmid containing AGM1 (Bba_K850000) was digested with Spe1 and Pst1, and the product gel-purified and treated with Antarctic phosphatase. The NAG5 gene was cut out of the Bba_K850001 plasmid using Xba1 and Pst1 and gel-purified. These two pieces of DNA were ligated together to produce a plasmid containing the AGM1 and Xba1 parts of the pathway in a BioBrick format. This construct was then cut with Spe1 and Pst1, and the process repeated with the UDP1 gene cut from the Bba_K850002 BioBrick plasmid with Xba1 and Pst1.</p><br />
<p>This resulted in a plasmid containing the entire pathway (AGM1, NAG5 and UDP1) but no promoter. To test the pathway in Acetobacter, we cut it out of the BioBrick vector using EcoR1 and Pst1 and cloned it into the MCS of pUC18 which has a T7 promoter.</p><br />
<p><a href="/Team:NYU_Gallatin/Project/Cloning/Primers">Learn how to design primers</a> from Julie Wolf.</p><br />
<h1>Protocols</h1><br />
<p>Here are some protocols we used in our cloning process.</p><br />
<ul><li><a href="/Team:NYU_Gallatin/Project/Cloning/Protocols/Transformation">Transformation Protocol</a></li><br />
</ul><h1>Gibson Assembly</h1><br />
<p></p><center><br /><img src="http://farm9.staticflickr.com/8041/8048773499_8b8e3875bc_z.jpg" /><br /><img src="http://farm9.staticflickr.com/8458/8048773043_b64baa80e9_z.jpg" /><br /><img src="http://farm9.staticflickr.com/8315/8048773361_603f32760b_z.jpg" /><br /><img src="http://farm9.staticflickr.com/8310/8048773201_2bbaec290f_z.jpg" /><br /></center><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Team
Team:NYU Gallatin/Team
2012-10-04T01:36:31Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in no-sidebars page-team" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388 active-trail active"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation." class="active-trail active">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Team}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Team</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div class="view view-team view-id-team view-display-id-page view-dom-id-3300a53a06c975df8028ebc4875158db"><br />
<div class="view-header"><br />
<p>Hosted at Genspace, the first-ever community biotechnology laboratory, and sponsored by the NYU Gallatin, undergraduate students from 5 different universities and 10 different majors spent their summer in a creative loft in Brooklyn trying to grow furniture.</p><br />
</div><br />
<br />
<br />
<br />
<div class="view-content"><br />
<h3>Students</h3><br />
<table class="views-view-grid cols-2"><br />
<tbody><br />
<tr class="row-1 row-first"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8169/8027494891_8d49639fbf_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Alex</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Westfield Senior High School</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">DIY Bio</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8182/8047647804_ede5cf61ab_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Alison</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Cooper Union for the Advancement of Science and Art</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Interdisciplinary Engineering (BSE)</div> </div> </td><br />
</tr><br />
<tr class="row-2"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8449/8027481756_69ef909a53_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Arthur</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">SUNY Albany</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Nanoscale Engineering & Nanobio Science</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8296/7868151874_4408cfacf0_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Daniel</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">City University of New York</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Synthetic Biology</div> </div> </td><br />
</tr><br />
<tr class="row-3"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8042/8044744559_3d908686ed_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">James</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Studio Art</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8041/8046077035_1fed79ea9d_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Jesse</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU Gallatin</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Architecture & Travel Writing</div> </div> </td><br />
</tr><br />
<tr class="row-4"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8038/8027486102_6a068ef1ce_n.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Josh</span></span> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8180/8049008265_23c7ecf4e2_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Josue</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU- Gallatin School of Individualized Study</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Narrative and Humanity</div> </div> </td><br />
</tr><br />
<tr class="row-5"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8311/8052260336_1b3e424952_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Justin</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU Gallatin</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Architecture/Design</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8171/8052102347_1875f86e63.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Min-Gyu</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Jericho High School</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Synthetic Biology</div> </div> </td><br />
</tr><br />
<tr class="row-6"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8460/8047411422_c5db56f670_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Robyn</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Massapequa High School</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8436/7869370860_365cc459b0_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Sara</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Columbia University</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Neuroscience & Behavior</div> </div> </td><br />
</tr><br />
<tr class="row-7"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8435/7868150876_78c57e5b87_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Sarah</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Université de Montréal</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Communication</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8315/8045833408_f763e97205_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Shruti</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Royal College of Art/ Imperial College London</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">MA and MSc Innovation Design Engineering</div> </div> </td><br />
</tr><br />
<tr class="row-8"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8462/8027764242_3a29fb95ec_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Steven</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Eugene Lang College The New School for Liberal Arts</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Interdisciplinary Science - Biology of Health track</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8309/8048756242_87cfe3fd5a_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Tania</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Swarthmore College '12, </div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Biology, Ethnobotanical Design</div> </div> </td><br />
</tr><br />
<tr class="row-9 row-last"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8452/8027489848_3e7917b5ce_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Will</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Bronx High School of Science</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Robotics</div> </div> </td><br />
<td class="col-2 col-last"><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<h3>Mentors</h3><br />
<table class="views-view-grid cols-2"><br />
<tbody><br />
<tr class="row-1 row-first"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8459/8027483888_6090a89620_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Anne</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Genspace</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Too Many Things</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8171/8052101270_c8a70787b1_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Corrie</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">MakerBot</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">3D Printing</div> </div> </td><br />
</tr><br />
<tr class="row-2"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8301/7868153360_dd1af48845_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Ellen</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Co-founder, Genspace NYC and Adjunct Assistant Prof. of pathology at New York Medical College</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Molecular Biology</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8312/8027604375_701c0d3a6a.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Julie</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Albert Einstein College of Medicine</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Molecular biology</div> </div> </td><br />
</tr><br />
<tr class="row-3"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8171/8052286333_3a0bc46a5b_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Maria</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Terreform</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Co-Founder</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8170/8052239465_02d6045ef7_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Melanie</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Terreform ONE, Ecological Design Group for Urban Infrastructure, Building, Planning, and Art</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Director of Design Research</div> </div> </td><br />
</tr><br />
<tr class="row-4"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm8.staticflickr.com/7273/7869335184_53ac84cde5_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Mitch</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">New York University</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Ph.D., Associate Professor in Practice</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8180/8046097510_f9535ceed0_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Nurit</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Genspace</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Arts & Culture Program Director</div> </div> </td><br />
</tr><br />
<tr class="row-5 row-last"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8424/7868155546_d6e1aeb473_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Oliver</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Genspace Co-founder, Director of Scientific Programs</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Ph.D. at Harvard Medical School, in the Biomedical and Biological Sciences program</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8031/8052293622_95b358612a_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Philip</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">California Polytechnic State University</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Architecture</div> </div> </td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
</div> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project/Characterization
Team:NYU Gallatin/Project/Characterization
2012-10-04T01:29:49Z
<p>Sararobertson: Created page with "{{:Team:NYU_Gallatin/Templates/Styles}} <html><body> <div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-67 node-type-page" > <div i..."</p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-67 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail">Project</a><ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Project/Cloning" title="">Cloning</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff.">Transforming</a></li><br />
<li class="leaf active-trail"><a href="/Team:NYU_Gallatin/Project/Characterization" title="" class="active-trail active">Characterizing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Designing" title="">Designing</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Project/Socializing" title="">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Characterization</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-67" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p><b>Construction of pUC19 Nag1/Uap1 expression construct and characterization via protein expression in E.coli</b></p><br />
<h2>Enzymatic Digestions</h2><br />
<p>Digested 2 ug pUC19 with Xba1. 2 reactions, 2 ul (1ug) of plasmid with 2 ul Xba1, 2.5ul Buffer 4, 2.5 ul 10x BSA, 18ul dH20. Digested for 1 hour at 37deg. Heat inactivated for 20 minutes at 70deg. Ran through PCR cleanup column. Eluted with 50 ul TE buffer.<br /><br />
Digested nag1 and Uap1 inserts with Xba1 and Spe1. Used 18 ul of insert (low concentration) with 1 ul each enzyme, 2.5 ul buffer and 2.5ul 10x bsa. Digested for 1 hour, heat inactivated for 20 minutes at 70C. ran through clean up columns and eluted with 50 ul TE buffer.</p><br />
<h3>Gel Quantitation</h3><br />
<p><img src="http://farm9.staticflickr.com/8317/8052204789_90264dac73.jpg" class="border" /></p><br />
<h3>Phosphatase treatment and Ligations</h3><br />
<p>Treated digested puc19 with Antarctic phosphatase (NEB).<br /><br />
50ul of purified plasmid = ~20ug/ul<br /><br />
Used 9ul digested and purified plasmid /1 ul buffer/1ul phosphatase (10ul total reaction). Incubated for 15 minutes at 37degC and heat inactivated at 70 deg C for 5min.<br /><br />
Two different ligation reactions were performed, either 1ul or 2 ul of AP treated backbone was used, for either 17ul or 16ul of insert, respectively + 2ul buffer and 1 ul of T4 ligase (NEB) (20ul total reaction)<br /><br />
Incubated at room temp for 15 minutes.</p><br />
<h3>Transformations</h3><br />
<p>5 ul of reaction was used per transformation using JM109 E. coli made competent using the Transforaid kit from thermo scientific. 50 ul of cells were plated onto prewarmed LB-Amp plates and grown overnight.<br /><br />
Successful transformants of JM109. Negative control is phosphatase treated backbone alone with no insert added during ligations.<br /><br />
Since insert may be in either orientation (Xba1 and Spe1 have complementary sticky ended overhangs) Colonies will be tested for proper insertion via digestion.<br /><img src="http://farm9.staticflickr.com/8462/8052209286_fbe54beac8.jpg" class="border" /></p><br />
<h3>Protein expression</h3><br />
<p>The Novagen BugBuster Master Mix protein extraction reagent was used to extract total cell protein from transformed E. coli.<br /><br />
Cells were grown overnight in 5 mls of LB-AMP liquid media along with 0.5 mM IPTG for induction. Cells were then spun down at 4300 RPM at 4deg C for 15min.<br /><br />
Cell pellet was frozen and thawed at -20degC, resuspended in 1ml of BugBuster Master Mix and transferred into 1.5ml microfuge tubes which were then slowly shaken at room temperature on an orbital platform set to 90 rpm.<br /><br />
Lysed samples were then centrifuged for 20min at 4deg C.<br /><br />
25ul of supernatant was resuspended in an equal volume of 2X Laemmeli loading buffer containing beta-mercaptoethanol and heated to 100 deg C for 5 minutes.<br /><br />
20 ul of total denatured protein extracts of cells overexpressing either Nag1 or Uap1 protein were then loaded into a 12% polyacrylamide gel and run at 200 volts for 40 minutes.<br /><img src="http://farm9.staticflickr.com/8313/8052211080_6f7d022934.jpg" class="border" /><br /><br /><br />
Gels were then stained with Coomasie dye for 3 hours and then de-stained.<br /><br /><img src="http://farm9.staticflickr.com/8033/8052210018_05ae9604c7_z.jpg" class="border" /><br /><img src="http://farm9.staticflickr.com/8451/8052209594_43996c78cb_z.jpg" class="border" /></p><br />
<p>As can be seen from the gel data, it appears that the Nag1 protein is being overexpressed in approximately half of the transformed strains (lanes 4-8), as expected. The expected size is 27.5 kD. The Uap1 protein however does not appear to be overexpressed in the transformed strains. The band corresponding to the putative Nag1 protein has been excised from the gel and will be subjected to mass spectrometry for further confirmation.</p><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project
Team:NYU Gallatin/Project
2012-10-04T01:29:29Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-3 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307 active-trail active"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project." class="active-trail active">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail active">Project</a><ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Project/Cloning" title="">Cloning</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff.">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Characterization" title="">Characterizing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Designing" title="">Designing</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Project/Socializing" title="">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">The Project</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-3" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8038/8046110823_41af45f8c9_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p>Gen2Seat began as a vision; a vision of fully formed seats and chairs emerging from giant vats of colorful bioengineered bacterial cellulose. Acetobacter naturally produces mats of cellulose that can be used for a variety of purposes. We wanted to create a broader spectrum of materials, so we altered the properties of the cellulose mats by engineering Acetobacter to express enzymes that charge N-acetyl glucosamine, a subunit of chitin, with UDP which facilitates its uptake by cellulose synthetase. The result is a chitin-cellulose copolymer which may have unique properties. We have demonstrated its potential for use in modern architectural design, and plan to engineer other properties such as color, scent, etc. into the celluose as next steps.</p><br />
<h2><a href="/Team:NYU_Gallatin/Project/Cloning">Cloning</a></h2><br />
<p><a href="/Team:NYU_Gallatin/Project/Cloning"><img src="http://farm9.staticflickr.com/8171/8045977601_2d3a8ec6b5_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" class="border" /></a>Learn about our cloning techniques, primer designs, protocols, and exciting adventures along the way.</p><br />
<h2 style="clear: both"><a href="/Team:NYU_Gallatin/Project/Transforming">Transforming</a></h2><br />
<p><a href="/Team:NYU_Gallatin/Project/Transforming"><img src="http://farm9.staticflickr.com/8286/7864391816_63603f11a3_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" class="border" /></a>Learn about the protocols we used to insert engineered DNA into bacterial cells and observe its affects.</p><br />
<h2 style="clear: both"><a href="/Team:NYU_Gallatin/Project/Growing">Growing</a></h2><br />
<p><a href="/Team:NYU_Gallatin/Project/Growing"><img src="http://farm9.staticflickr.com/8174/8046009703_a23215d3ae_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" class="border" /></a>See how we learned to grow cellulose in Kombucha tea, and produced sheeting on a large scale.</p><br />
<h2 style="clear: both"><a href="/Team:NYU_Gallatin/Project/Designing">Designing</a></h2><br />
<p><a href="/Team:NYU_Gallatin/Project/Designing"><img src="http://farm9.staticflickr.com/8309/8046067033_6faa090603_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" class="border" /></a>Creating functional furniture out of completely organic materials takes creativity, flare, and a lot of awesome tools. See the conception of a bio-composite chair design and the novel fabrication methods necessary to produce it.</p><br />
<h2 style="clear: both"><a href="/Team:NYU_Gallatin/Project/Socializing">Human Practices</a></h2><br />
<p><a href="/Team:NYU_Gallatin/Project/Socializing"><img src="http://farm9.staticflickr.com/8451/8046060553_ec99ecffc9_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" class="border" /></a>Our human practices involved a 200+ response national survey on genetic engineering and a pop-up shop selling synthetic biology products at the Atlantic Antic street fair in Brooklyn, NY!</p><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Team
Team:NYU Gallatin/Team
2012-10-04T01:24:18Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in no-sidebars page-team" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388 active-trail active"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation." class="active-trail active">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Team}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Team</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div class="view view-team view-id-team view-display-id-page view-dom-id-cf6ea1e566bbed3e28f899be6a81e001"><br />
<div class="view-header"><br />
<p>Hosted at Genspace, the first-ever community biotechnology laboratory, and sponsored by the NYU Gallatin, undergraduate students from 5 different universities and 10 different majors spent their summer in a creative loft in Brooklyn trying to grow furniture.</p><br />
</div><br />
<br />
<br />
<br />
<div class="view-content"><br />
<h3>Students</h3><br />
<table class="views-view-grid cols-2"><br />
<tbody><br />
<tr class="row-1 row-first"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8169/8027494891_8d49639fbf_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Alex</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Westfield Senior High School</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">DIY Bio</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8182/8047647804_ede5cf61ab_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Alison</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Cooper Union for the Advancement of Science and Art</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Interdisciplinary Engineering (BSE)</div> </div> </td><br />
</tr><br />
<tr class="row-2"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8449/8027481756_69ef909a53_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Arthur</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">SUNY Albany</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Nanoscale Engineering & Nanobio Science</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8296/7868151874_4408cfacf0_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Daniel</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">City University of New York</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Synthetic Biology</div> </div> </td><br />
</tr><br />
<tr class="row-3"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8042/8044744559_3d908686ed_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">James</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Studio Art</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8041/8046077035_1fed79ea9d_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Jesse</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU Gallatin</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Architecture & Travel Writing</div> </div> </td><br />
</tr><br />
<tr class="row-4"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8038/8027486102_6a068ef1ce_n.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Josh</span></span> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8180/8049008265_23c7ecf4e2_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Josue</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU- Gallatin School of Individualized Study</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Narrative and Humanity</div> </div> </td><br />
</tr><br />
<tr class="row-5"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8311/8052260336_1b3e424952_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Justin</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU Gallatin</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Architecture/Design</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8171/8052102347_1875f86e63.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Min-Gyu</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Jericho High School</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Synthetic Biology</div> </div> </td><br />
</tr><br />
<tr class="row-6"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8460/8047411422_c5db56f670_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Robyn</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Massapequa High School</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8436/7869370860_365cc459b0_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Sara</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Columbia University</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Neuroscience & Behavior</div> </div> </td><br />
</tr><br />
<tr class="row-7"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8435/7868150876_78c57e5b87_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Sarah</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Université de Montréal</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Communication</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8315/8045833408_f763e97205_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Shruti</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Royal College of Art/ Imperial College London</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">MA and MSc Innovation Design Engineering</div> </div> </td><br />
</tr><br />
<tr class="row-8"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8462/8027764242_3a29fb95ec_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Steven</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Eugene Lang College The New School for Liberal Arts</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Interdisciplinary Science - Biology of Health track</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8309/8048756242_87cfe3fd5a_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Tania</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Swarthmore College '12, </div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Biology, Ethnobotanical Design</div> </div> </td><br />
</tr><br />
<tr class="row-9 row-last"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8452/8027489848_3e7917b5ce_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Will</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Bronx High School of Science</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Robotics</div> </div> </td><br />
<td class="col-2 col-last"><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<h3>Mentors</h3><br />
<table class="views-view-grid cols-2"><br />
<tbody><br />
<tr class="row-1 row-first"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8459/8027483888_6090a89620_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Anne</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Genspace</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Too Many Things</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8171/8052101270_c8a70787b1_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Corrie</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">MakerBot</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">3D Printing</div> </div> </td><br />
</tr><br />
<tr class="row-2"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8301/7868153360_dd1af48845_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Ellen</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Co-founder, Genspace NYC and Adjunct Assistant Prof. of pathology at New York Medical College</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Molecular Biology</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8312/8027604375_701c0d3a6a.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Julie</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Albert Einstein College of Medicine</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Molecular biology</div> </div> </td><br />
</tr><br />
<tr class="row-3"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Maria</span></span> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8170/8052239465_02d6045ef7_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Melanie</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Terreform ONE, Ecological Design Group for Urban Infrastructure, Building, Planning, and Art</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Director of Design Research</div> </div> </td><br />
</tr><br />
<tr class="row-4"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm8.staticflickr.com/7273/7869335184_53ac84cde5_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Mitch</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">New York University</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Ph.D., Associate Professor in Practice</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8180/8046097510_f9535ceed0_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Nurit</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Genspace</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Arts & Culture Program Director</div> </div> </td><br />
</tr><br />
<tr class="row-5 row-last"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8424/7868155546_d6e1aeb473_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Oliver</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Genspace Co-founder, Director of Scientific Programs</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Ph.D. at Harvard Medical School, in the Biomedical and Biological Sciences program</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Philip</span></span> </div> </td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
</div> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project
Team:NYU Gallatin/Project
2012-10-04T00:48:22Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-3 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307 active-trail active"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project." class="active-trail active">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail active">Project</a><ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Project/Cloning" title="">Cloning</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff.">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Designing" title="">Designing</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Project/Socializing" title="">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">The Project</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-3" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8038/8046110823_41af45f8c9_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p>Gen2Seat began as a vision; a vision of fully formed seats and chairs emerging from giant vats of colorful bioengineered bacterial cellulose. Acetobacter naturally produces mats of cellulose that can be used for a variety of purposes. We wanted to create a broader spectrum of materials, so we altered the properties of the cellulose mats by engineering Acetobacter to express enzymes that charge N-acetyl glucosamine, a subunit of chitin, with UDP which facilitates its uptake by cellulose synthetase. The result is a chitin-cellulose copolymer which may have unique properties. We have demonstrated its potential for use in modern architectural design, and plan to engineer other properties such as color, scent, etc. into the celluose as next steps.</p><br />
<h2><a href="/Team:NYU_Gallatin/Project/Cloning">Cloning</a></h2><br />
<p><a href="/Team:NYU_Gallatin/Project/Cloning"><img src="http://farm9.staticflickr.com/8171/8045977601_2d3a8ec6b5_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" class="border" /></a>Learn about our cloning techniques, primer designs, protocols, and exciting adventures along the way.</p><br />
<h2 style="clear: both"><a href="/Team:NYU_Gallatin/Project/Transforming">Transforming</a></h2><br />
<p><a href="/Team:NYU_Gallatin/Project/Transforming"><img src="http://farm9.staticflickr.com/8286/7864391816_63603f11a3_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" class="border" /></a>Learn about the protocols we used to insert engineered DNA into bacterial cells and observe its affects.</p><br />
<h2 style="clear: both"><a href="/Team:NYU_Gallatin/Project/Growing">Growing</a></h2><br />
<p><a href="/Team:NYU_Gallatin/Project/Growing"><img src="http://farm9.staticflickr.com/8174/8046009703_a23215d3ae_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" class="border" /></a>See how we learned to grow cellulose in Kombucha tea, and produced sheeting on a large scale.</p><br />
<h2 style="clear: both"><a href="/Team:NYU_Gallatin/Project/Designing">Designing</a></h2><br />
<p><a href="/Team:NYU_Gallatin/Project/Designing"><img src="http://farm9.staticflickr.com/8309/8046067033_6faa090603_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" class="border" /></a>Creating functional furniture out of completely organic materials takes creativity, flare, and a lot of awesome tools. See the conception of a bio-composite chair design and the novel fabrication methods necessary to produce it.</p><br />
<h2 style="clear: both"><a href="/Team:NYU_Gallatin/Project/Socializing">Human Practices</a></h2><br />
<p><a href="/Team:NYU_Gallatin/Project/Socializing"><img src="http://farm9.staticflickr.com/8451/8046060553_ec99ecffc9_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" class="border" /></a>Our human practices involved a 200+ response national survey on genetic engineering and a pop-up shop selling synthetic biology products at the Atlantic Antic street fair in Brooklyn, NY!</p><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Modeling
Team:NYU Gallatin/Modeling
2012-10-04T00:46:13Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-5 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310 active-trail active"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together." class="active-trail active">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Modeling}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-modeling-menu" class="block block-menu"><br />
<br />
<h2>Model It</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last leaf active-trail"><a href="/Team:NYU_Gallatin/Modeling" title="" class="active-trail active">Modeling</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Modeling</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-5" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p></p><center><img src="http://farm9.staticflickr.com/8175/8052145533_c321d3ac67_z.jpg" /></center><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project/Transforming
Team:NYU Gallatin/Project/Transforming
2012-10-04T00:43:54Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-35 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail">Project</a><ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Project/Cloning" title="">Cloning</a></li><br />
<li class="leaf active-trail"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff." class="active-trail active">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Designing" title="">Designing</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Project/Socializing" title="">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Transformation</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-35" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p><img src="http://farm9.staticflickr.com/8452/8052046690_74e9f03b01_n.jpg" class="border" style="float: left; margin-right: 20px; margin-bottom: 15px;" />With regard to transformation, electroporation is well-known for its higher cell wall penetration rate and its efficiency on higher-organism cells, mammalian cells in particular. We used electroporation on E. Coli cells, adapting and improving available electroporation protocols to optimize transformed colony yield. <img src="http://farm9.staticflickr.com/8454/8052039349_973bb2a2b1_m.jpg" class="border" style="float: right; margin-left: 20px; margin-bottom: 15px; margin-top: 20px;" /> We hypothesized that corrected voltage and cell preparation procedures would allow us to successfully transform. Acetobacter Xylinum through electroporation. Tests included E.Coli and Acetobacter Xylinum transformation for RFP and GFP expression. Pure Acetobacter Xylinum cultures were also grown in media for several weeks and a chart has been prepared to describe and detail growth patterns. Using a spectrophotometer, light absorbency readings were taken regularly to allow for the collection of daily data. Through this measurement technique, we also determined optimal growth phases for the preparation of Acetobacter Xylinum as an electro-competent cell. </p><br />
<p><img src="http://farm9.staticflickr.com/8317/8052051236_7e6f368694_n.jpg" class="border" style="clear: left" /> <img src="http://farm9.staticflickr.com/8182/8052044117_7b58cb9ea3_n.jpg" class="border" /></p><br />
<h1>Protocols</h1><br />
<h2>Modified E. Coli and Acetobacter Electroporation Protocol</h2><br />
<p>Protocol Adapted From Following Paper:<br /><a href="https://docs.google.com/a/brown.edu/folder/d/0B52k0YOxsn7EQk9kc2VxdlI0NTQ/edit?docId=0B9bdNJ3ouX7GSlFlQ0N5S2hBZW8">https://docs.google.com/a/brown.edu/folder/d/0B52k0YOxsn7EQk9kc2VxdlI0NTQ/edit?docId=0B9bdNJ3ouX7GSlFlQ0N5S2hBZW8</a></p><br />
<h3>Materials Needed:</h3><br />
<ul><li>Ice Cold sterile H20</li><br />
<li>Ice Cold 10% Glycerine</li><br />
<li>Plasmid</li><br />
<li>Bacterial Strain</li><br />
<li>Sterile LB Broth</li><br />
<li>Sterile SOC Broth</li><br />
<li>For Acetobacter: Sterile Acetobacter media. </li><br />
</ul><h3>Materials we used:</h3><br />
<ul><li>MM194 and JM109 E. Coli strains</li><br />
<li>PBR332 plasmid at 5ng/mL concentration</li><br />
</ul><h3>Equipment Used</h3><br />
<ul><li>Bio-Rad Gene-Pulser Electroporation Machine, Resistor, and Capacitance Extender</li><br />
<li>Refrigerated Centrifuge</li><br />
<li>Spectrophotometer</li><br />
</ul><h3>Electro-competent Cell Preparation (for 50 transformations)</h3><br />
<ol><li>Inoculate 5ml liquid LB culture for overnight incubation at 37 degrees with agitation at 225rpm. Use Acetobacter media for Acetobacter cultures instead of LB.</li><br />
<li>Next day, pour 27mL liquid LB into 4 separate 50mL tubes and pre-heat to 37degrees.</li><br />
<li>To each tube, add 1.25mL of overnight culture.</li><br />
<li>Incubate the 50mL tubes with agitation (225rpm 37degrees)</li><br />
<li>Incubate until an A600 absorbance reading of approximately 0.4 is reached, this should take approximately one hour. Acetobacter cultures, which have a much slower growth rate, may be incubated overnight if absorbance readings are not reached. </li><br />
<li>Once bacterial cultures reach desired density, take them out of incubation and put them in an ice bath for 30 minutes.</li><br />
<li>After cooling, spin the tubes in a refrigerated (4degC) centrifuge for 12min at 4100rpm.</li><br />
<li>Pour off supernatant, taking care not to disturb the pellet and re-suspend bacteria pellet in 25mL ice-cold sterile water. Use pipette to accomplish this; do not use a vortex machine.</li><br />
<li>Centrifuge again for 12 minutes at 4100 rpm and 4 degrees C temp</li><br />
<li>Pour off supernatant again, re-suspend pellet in 4mL ice-cold sterile water and transfer suspended mixture to 15mL tube.</li><br />
<li>Centrifuge again for 12 minutes at 4100 rpm and 4 degrees C</li><br />
<li>Pour off water and re-suspend pellet in 2mL ice cold 10% glycerin</li><br />
<li>Centrifuge for 12 Minutes at 4100 rpm and 4 degrees C</li><br />
<li>Aspirate as much supernatant as possible using a micro-pipette and re-suspend pellet in 2mL ice cold 10% glycerin.</li><br />
<li>Store samples on ice for immediate use or freeze down 40ul aliquots at -80degC.</li><br />
</ol><p>Note: Centrifuging has been tried at an extra 100rpm speed for 13 minutes successfully, supernatant was easier to discard. </p><br />
<h3>Electroporation Protocol</h3><br />
<ol><li>Use 40mL aliquots of the suspended bacteria for each transformation.</li><br />
<li>Add 2mL of plasmid (we used PBR322 at 5ng/mL) to 40mL of bacteria suspension and mix</li><br />
<li>Transfer sample to ice cold 1mm gap electroporation cuvette</li><br />
<li>Remove all moisture from outside of cuvette with kimwipe, this is important to prevent electrical arcing. Note: If an arc is observed, then your sample most likely did not successfully transform!</li><br />
<li>Set electroporation machine to 2.5kV current with 200W resistance and 25mF capacitance</li><br />
<li>Using Bio-Rad Gene Pulser: Insert cuvette into cuvette holder, making sure electrodes on the cuvette are touching those in the holder. Make sure cuvette holder is behind a Plexiglas safety shield.</li><br />
<li>Hold down the two red buttons on the gene pulser until you hear a beep, then release, this should indicate that a successful charge was dispersed</li><br />
<li>Using warm SOC media, quickly transfer contents of cuvette and place them into a sterile 15mL tubes, containing 1mL of warm SOC media.</li><br />
<li>Incubate the culture for 1 hour at 37 degrees with gentle agitation</li><br />
<li>After incubation, take 200mL of the sample and plate onto appropriate agar, use beads to spread the sample around the plate</li><br />
</ol></div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
<div id="block-views-lab-notes-block-1" class="block block-views"><br />
<br />
<h2>Transformation Lab Notes</h2><br />
<br />
<div class="content"><br />
<div class="view view-lab-notes view-id-lab_notes view-display-id-block_1 view-dom-id-4fe6a41e87e31e7deb84bcc2bc90e4ff"><br />
<br />
<br />
<br />
<div class="view-content"><br />
<table class="views-table cols-3" ><br />
<thead><br />
<tr><br />
<th class="views-field views-field-field-sub-team" ><br />
Team </th><br />
<th class="views-field views-field-created" ><br />
Date </th><br />
<th class="views-field views-field-body" ><br />
Note </th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr class="odd views-row-first"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/10/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8174/8048768673_d51ef329a3.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/07/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8313/8048773304_9ce0f49fd2.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/04/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8451/8048765553_1ffd507e36.jpg" /><br /><img src="http://farm9.staticflickr.com/8172/8048770556_2604c4a9b2.jpg" /><br /><img src="http://farm9.staticflickr.com/8316/8048765169_52ca13cda9_n.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/03/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8450/8048766095_c94a54efd5.jpg" /><br /><img src="http://farm9.staticflickr.com/8313/8048765937_f6fd019924.jpg" /><br /><img src="http://farm9.staticflickr.com/8180/8048770890_12ba62d1a7.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/02/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8318/8048766337_a5795fb13d.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/01/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8182/8048766707_9cb88da4d7.jpg" /><br /><img src="http://farm9.staticflickr.com/8171/8048771682_17e08a6f17.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/30/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8179/8048766867_8c6cc28dd4.jpg" /><br /><img src="http://farm9.staticflickr.com/8174/8048767007_9a47831e22.jpg" /><br /><img src="http://farm9.staticflickr.com/8455/8048772414_005410d2f1.jpg" /><br /><img src="http://farm9.staticflickr.com/8169/8048767529_8993906e3d.jpg" /><br /><img src="http://farm9.staticflickr.com/8318/8048767697_95e77a28af.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even views-row-last"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/20/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8033/8048772282_58fab176aa.jpg" /></p><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
</div> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project/Designing
Team:NYU Gallatin/Project/Designing
2012-10-04T00:28:22Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-23 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail">Project</a><ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Project/Cloning" title="">Cloning</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff.">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf active-trail"><a href="/Team:NYU_Gallatin/Project/Designing" title="" class="active-trail active">Designing</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Project/Socializing" title="">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Gen2Seat: Genetic Generation Seat</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-23" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8170/8045883113_7cbfdfe00a_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><h2>Designing the Chair</h2><br />
<p>It was always a chair, from the very first brainstorming session. Somehow it just seemed like it fit. What can we do with cellulose, bone, mycelium, and other squishy and hard and structural pieces found naturally in the world? The process was a whirlwind of sketches and attempts -- everything from fruit rollups to wood chips -- until a working model started to emerge.</p><br />
<p></p><center><img src="http://farm9.staticflickr.com/8038/8046110823_41af45f8c9_z.jpg" /></center><br />
<h2>About the Chair</h2><br />
<p><img src="http://farm9.staticflickr.com/8172/8045961128_d692068eda_m.jpg" style="float: left; margin-right: 20px; margin-bottom: 10px; " />The emergence of citizen biotech must be seen within the broader context of advanced technologies becoming ever more readily available to individuals and groups. With that availability, comes enhanced opportunities to develop new ideas. We have produced the first full-scale synthetic biological chair entitled; Genetic Generation Seat or Gen2Seat. At IGEM (International Genetically Engineered Machines) competition, we have genetically engineered the naturally occurring bacterium Acetobacter xylinum.<img src="http://farm9.staticflickr.com/8322/8046038775_9a0074005e_m.jpg" style="float: right; margin-top: 10px; margin-left: 20px; margin-bottom: 10px; " /> This bacterium secretes copious amounts of cellulose, which can then be harvested and used directly as a building material. Alternatively, our goal is to create a novel strain that can also secrete the biopolymer chitin, which is normally produced by arthropods, such as insects and crustaceans. In addition, we fused mycelium blocks with the modified acetobactor to create a new biopolymer. Applying the tools of synthetic biology, alongside other biological disciplines, such as microbiology and tissue engineering, will allow us to create products more organically, with minimal waste and energy expenditure.</p><br />
<ul><li>Media: biopolymer of acetobacter, chitin, mycelium.</li><br />
<li>Size: 20"x 21"x 14".</li><br />
<li>Support/ Consultation: Ecovative Design LLC, Suzanne Lee and BioCouture.</li><br />
<li>Sponsor: NYU Gallatin.</li><br />
</ul><h2>What's Inside</h2><br />
<p></p><center><img src="http://farm9.staticflickr.com/8034/8045955365_20a8c73fbc_b.jpg" /></center><br />
<h2>Previous Attempts</h2><br />
<p></p><center><img src="http://farm9.staticflickr.com/8042/8046147303_6d3ac1f74e_z.jpg" /></center><br /><center><img src="http://farm9.staticflickr.com/8317/8045909224_6b5012bcd4_b.jpg" width="650" class="border" /></center><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Team
Team:NYU Gallatin/Team
2012-10-04T00:27:22Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in no-sidebars page-team" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388 active-trail active"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation." class="active-trail active">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Team}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Team</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div class="view view-team view-id-team view-display-id-page view-dom-id-9fcfd3386eab24fa3e1930a409b975b8"><br />
<div class="view-header"><br />
<p>Hosted at Genspace, the first-ever community biotechnology laboratory, and sponsored by the NYU Gallatin, undergraduate students from 5 different universities and 10 different majors spent their summer in a creative loft in Brooklyn trying to grow furniture.</p><br />
</div><br />
<br />
<br />
<br />
<div class="view-content"><br />
<h3>Students</h3><br />
<table class="views-view-grid cols-2"><br />
<tbody><br />
<tr class="row-1 row-first"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8169/8027494891_8d49639fbf_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Alex</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Westfield Senior High School</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">DIY Bio</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8182/8047647804_ede5cf61ab_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Alison</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Cooper Union for the Advancement of Science and Art</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Interdisciplinary Engineering (BSE)</div> </div> </td><br />
</tr><br />
<tr class="row-2"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8449/8027481756_69ef909a53_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Arthur</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">SUNY Albany</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Nanoscale Engineering & Nanobio Science</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8296/7868151874_4408cfacf0_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Daniel</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">City University of New York</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Synthetic Biology</div> </div> </td><br />
</tr><br />
<tr class="row-3"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8042/8044744559_3d908686ed_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">James</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Studio Art</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8041/8046077035_1fed79ea9d_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Jesse</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU Gallatin</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Architecture & Travel Writing</div> </div> </td><br />
</tr><br />
<tr class="row-4"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8038/8027486102_6a068ef1ce_n.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Josh</span></span> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8180/8049008265_23c7ecf4e2_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Josue</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU- Gallatin School of Individualized Study</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Narrative and Humanity</div> </div> </td><br />
</tr><br />
<tr class="row-5"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Justin</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">NYU Gallatin</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Architecture/Design</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8171/8052102347_1875f86e63.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Min-Gyu</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Jericho High School</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Synthetic Biology</div> </div> </td><br />
</tr><br />
<tr class="row-6"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8460/8047411422_c5db56f670_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Robyn</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Massapequa High School</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8436/7869370860_365cc459b0_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Sara</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Columbia University</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Neuroscience & Behavior</div> </div> </td><br />
</tr><br />
<tr class="row-7"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8435/7868150876_78c57e5b87_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Sarah</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Université de Montréal</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Communication</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8315/8045833408_f763e97205_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Shruti</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Royal College of Art/ Imperial College London</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">MA and MSc Innovation Design Engineering</div> </div> </td><br />
</tr><br />
<tr class="row-8"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8462/8027764242_3a29fb95ec_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Steven</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Eugene Lang College The New School for Liberal Arts</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Interdisciplinary Science - Biology of Health track</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8309/8048756242_87cfe3fd5a_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Tania</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Swarthmore College '12, </div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Biology, Ethnobotanical Design</div> </div> </td><br />
</tr><br />
<tr class="row-9 row-last"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8452/8027489848_3e7917b5ce_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Will</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Bronx High School of Science</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Robotics</div> </div> </td><br />
<td class="col-2 col-last"><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<h3>Mentors</h3><br />
<table class="views-view-grid cols-2"><br />
<tbody><br />
<tr class="row-1 row-first"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8459/8027483888_6090a89620_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Anne</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Genspace</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Too Many Things</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8171/8052101270_c8a70787b1_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Corrie</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">MakerBot</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">3D Printing</div> </div> </td><br />
</tr><br />
<tr class="row-2"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8301/7868153360_dd1af48845_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Ellen</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Co-founder, Genspace NYC and Adjunct Assistant Prof. of pathology at New York Medical College</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Molecular Biology</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8312/8027604375_701c0d3a6a.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Julie</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Albert Einstein College of Medicine</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Molecular biology</div> </div> </td><br />
</tr><br />
<tr class="row-3"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Maria</span></span> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Melanie</span></span> </div> </td><br />
</tr><br />
<tr class="row-4"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm8.staticflickr.com/7273/7869335184_53ac84cde5_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Mitch</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">New York University</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Ph.D., Associate Professor in Practice</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8180/8046097510_f9535ceed0_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Nurit</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Genspace</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Arts & Culture Program Director</div> </div> </td><br />
</tr><br />
<tr class="row-5 row-last"><br />
<td class="col-1 col-first"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"><img src="http://farm9.staticflickr.com/8424/7868155546_d6e1aeb473_m.jpg" width="200"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Oliver</span></span> </div> <br />
<div class="views-field views-field-field-school"> <span class="views-label views-label-field-school">Affiliation</span> <div class="field-content">Genspace Co-founder, Director of Scientific Programs</div> </div> <br />
<div class="views-field views-field-field-major"> <span class="views-label views-label-field-major">Focus</span> <div class="field-content">Ph.D. at Harvard Medical School, in the Biomedical and Biological Sciences program</div> </div> </td><br />
<td class="col-2 col-last"><br />
<br />
<div class="views-field views-field-field-flickr-picture-url"> <div class="field-content"></div> </div> <br />
<div class="views-field views-field-name"> <span class="field-content"><span class="aseato">Philip</span></span> </div> </td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
</div> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin
Team:NYU Gallatin
2012-10-04T00:24:30Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html front not-logged-in no-sidebars page-node page-node- page-node-1 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first active"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter." class="active">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Default}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Cellulose Architecture</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-1" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p><img src="https://static.igem.org/mediawiki/2012/3/34/Aseatobacter-IMAGES-Chair_Diagrams.png" width="400" style="float: left; margin-right: 20px; margin-bottom: 20px;" /><span class="aseato">We grow chairs.</span><br /></p><p style="font-size: 22px;">In a world full of lifeless interiors and boxed pressed wood a miracle of biology is changing the way we create our surroundings.</p><br />
<div id="player"></div><br />
<script type="text/javascript"><br />
<!--//--><![CDATA[// ><!--<br />
<br />
<br />
(function() {<br />
function createPlayer(jqe, video, options) {<br />
var ifr = $('iframe', jqe);<br />
if (ifr.length === 0) {<br />
ifr = $('<iframe scrolling="no" frameborder="no">');<br />
ifr.addClass('player');<br />
if (options.playeropts)<br />
ifr.attr(options.playeropts);<br />
}<br />
var src = 'http://www.youtube.com/embed/' + video;<br />
if (options.playopts) {<br />
src += '?';<br />
for (var k in options.playopts) {<br />
src+= k + '=' + options.playopts[k] + '&';<br />
}<br />
}<br />
ifr.attr('src', src);<br />
jqe.append(ifr);<br />
}<br />
<br />
var defoptions = {<br />
autoplay: false,<br />
user: null,<br />
player: createPlayer,<br />
playeropts: {},<br />
loaded: function() {},<br />
playopts: {<br />
fs: 1,<br />
showinfo: 1,<br />
modestbranding: 1<br />
}<br />
};<br />
<br />
$.fn.extend({<br />
youTubeChannel: function(options) {<br />
var md = $(this);<br />
var allopts = $.extend(true, {}, defoptions, options);<br />
$.getJSON('http://gdata.youtube.com/feeds/api/users/' + allopts.user + '/uploads?alt=jsonc&v=2', null, function(data) {<br />
var videos = [];<br />
var playlist = '';<br />
$.each(data.data.items, function(i, item) {<br />
videos.push(item.id);<br />
if (i > 0)<br />
playlist += item.id + ',';<br />
});<br />
allopts.playopts.playlist = playlist;<br />
allopts.player(md, videos[0], allopts);<br />
});<br />
}<br />
});<br />
<br />
})();<br />
<br />
$(function() {<br />
$('#player').youTubeChannel({user:'aseatobacter', playeropts: { width: 400, height: 280 }});<br />
});<br />
<br />
<br />
//--><!]]><br />
</script></div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
<div id="block-block-4" class="block block-block"><br />
<br />
<h2>Latest News</h2><br />
<br />
<div class="content"><br />
<script type="text/javascript"><br />
<!--//--><![CDATA[// ><!--<br />
<br />
function tumblr(resp) {<br />
var months = ['Jan','Feb','Mar','Apr','May','Jun','Jul','Aug','Sep','Oct','Nov','Dec'];<br />
var posts = resp.posts;<br />
$('#blog .loading').replaceWith('<ul />');<br />
$ul = $('#blog ul');<br />
for (var i=0; i<posts.length; i++) {<br />
var p = posts[i];<br />
var title = p['regular-title'] || p['link-text'] || null;<br />
if (title) {<br />
var date = new Date(p['unix-timestamp']*1000);<br />
var dateMonth = months[date.getMonth()];<br />
var dateDay = date.getDate();<br />
var html = '<li><b class="homedate">'+dateMonth+'<\/b><span class="homedate">'+dateDay+'<\/span> <a href="'+p['url']+'" rel="lightframe">'+title+'<\/a><\/li>';<br />
$ul.append(html);<br />
}<br />
}<br />
}<br />
<br />
//--><!]]><br />
</script><p><br />
Keep up with the latest news from the Aseatobacter project.</p><br />
<!-- Where you want your tumblog --><div id="blog"><br />
<div class="loading">Loading...</div><br />
</div><br />
<!-- Bottom of the page, probably. Change host --><script src="http://aseatobacter.tumblr.com/api/read/json?callback=tumblr&num=10" type="text/javascript"></script> </div><br />
</div><br />
<div id="block-block-9" class="block block-block"><br />
<br />
<h2>Featured Photo</h2><br />
<br />
<div class="content"><br />
<div id="images"></div><br />
<p><a href="/Team:NYU_Gallatin/Notebook/Photos" class="more-link">More Photos</a></p><br />
<script type="text/javascript"><br />
<!--//--><![CDATA[// ><!--<br />
<br />
if($('#images').length != 0) {<br />
<br />
setTimeout(function() {$.getJSON(flickr_url, displayImages);},1500);<br />
function displayImages(data) {<br />
// Start putting together the HTML string<br />
var htmlString = "";<br />
<br />
// Now start cycling through our array of Flickr photo details<br />
var k=0;<br />
$.each(data.items, function(i,item){<br />
if(k == 0) {<br />
// I only want the ickle square thumbnails<br />
// var sourceSquare = (item.media.m).replace("_m.jpg", "_s.jpg");<br />
var sourceSquare = item.media.m;<br />
var l_sourceSquare = (item.media.m).replace("_m.jpg", "_b.jpg");<br />
<br />
// Here's where we piece together the HTML<br />
htmlString += '<li><a href="'+l_sourceSquare+'" rel="lightbox">';<br />
htmlString += '<img title="' + item.title + '" src="' + sourceSquare;<br />
htmlString += '" alt="'; htmlString += item.title + '" />';<br />
htmlString += '';<br />
k++;<br />
} <br />
});<br />
<br />
// Pop our HTML in the #images DIV<br />
$('#images').html(htmlString);<br />
}<br />
<br />
}<br />
<br />
//--><!]]><br />
</script> </div><br />
</div><br />
<div id="block-block-5" class="block block-block"><br />
<br />
<h2>Featured Video</h2><br />
<br />
<div class="content"><br />
<div id="featured_video"></div><br />
<p><a href="/Notebook/Videos" class="more-link">More Videos</a></p><br />
</div><br />
</div><br />
<div id="block-block-6" class="block block-block"><br />
<br />
<br />
<div class="content"><br />
<p><img src="https://static.igem.org/mediawiki/igem.org/5/52/Aseatobacter-IMAGES-Pipet.png" style="float: right; margin-left: 20px; margin-bottom: 10px;" width="350" /><span class="aseato">What we want.</span></p><br />
<p>Our project seeks to improve the characteristics of cellulose secreted by the gram negative bacterium Acetobacter xylinum. This naturally occurring "chassis" secretes large amounts of cellulose into solution and has been studied for many years. We wish to improve the material properties of this bacterial cellulose by genetically engineering the strain to incorporate color, improved tensile strength and increased hydrophobicity into the improved cellulose based material. After testing it's properties, we will use this material to build larger scale objects.</p><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project
Team:NYU Gallatin/Project
2012-10-04T00:14:28Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-3 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307 active-trail active"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project." class="active-trail active">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail active">Project</a><ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Project/Cloning" title="">Cloning</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff.">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Designing" title="">Designing</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Project/Socializing" title="">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">The Project</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-3" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8038/8046110823_41af45f8c9_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p>Gen2Seat began as a vision; a vision of fully formed seats and chairs emerging from giant vats of colorful bioengineered bacterial cellulose. Acetobacter naturally produces mats of cellulose that can be used for a variety of purposes. We wanted to create a broader spectrum of materials, so we altered the properties of the cellulose mats by engineering Acetobacter to express enzymes that charge N-acetyl glucosamine, a subunit of chitin, with UDP which facilitates its uptake by cellulose synthetase. The result is a chitin-cellulose copolymer which may have unique properties. We have demonstrated its potential for use in modern architectural design, and plan to engineer other properties such as color, scent, etc. into the celluose as next steps.</p><br />
<h2><a href="/Team:NYU_Gallatin/Project/Cloning">Cloning</a></h2><br />
<p><a href="/Team:NYU_Gallatin/Project/Cloning"><img src="http://farm9.staticflickr.com/8171/8045977601_2d3a8ec6b5_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" class="border" /></a>Learn about our cloning techniques, primer designs, protocols, and exciting adventures along the way.</p><br />
<h2 style="clear: both"><a href="/Team:NYU_Gallatin/Project/Transforming">Transforming</a></h2><br />
<p><a href="/Team:NYU_Gallatin/Project/Transforming"><img src="http://farm9.staticflickr.com/8286/7864391816_63603f11a3_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" class="border" /></a>Learn about our transformation protocols.</p><br />
<h2 style="clear: both"><a href="/Team:NYU_Gallatin/Project/Growing">Growing</a></h2><br />
<p><a href="/Team:NYU_Gallatin/Project/Growing"><img src="http://farm9.staticflickr.com/8174/8046009703_a23215d3ae_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" class="border" /></a>See how we learned to grow cellulose in Kombucha tea, and produced sheeting on a large scale.</p><br />
<h2 style="clear: both"><a href="/Team:NYU_Gallatin/Project/Designing">Designing</a></h2><br />
<p><a href="/Team:NYU_Gallatin/Project/Designing"><img src="http://farm9.staticflickr.com/8309/8046067033_6faa090603_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" class="border" /></a>Creating functional furniture out of completely organic materials takes creativity, flare, and a lot of awesome tools.</p><br />
<h2 style="clear: both"><a href="/Team:NYU_Gallatin/Project/Socializing">Human Practices</a></h2><br />
<p><a href="/Team:NYU_Gallatin/Project/Socializing"><img src="http://farm9.staticflickr.com/8451/8046060553_ec99ecffc9_m.jpg" style="float: left; margin-right: 10px; margin-bottom: 10px" class="border" /></a>Our human practices involved a 200+ response national survey on genetic engineering and a pop-up shop selling synthetic biology products at the Atlantic Antic street fair in Brooklyn, NY!</p><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Project/Transforming
Team:NYU Gallatin/Project/Transforming
2012-10-03T23:51:54Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-35 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Project}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-project-menu" class="block block-menu"><br />
<br />
<h2>The Project</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last expanded active-trail"><a href="/Team:NYU_Gallatin/Project" title="" class="active-trail">Project</a><ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Project/Cloning" title="">Cloning</a></li><br />
<li class="leaf active-trail"><a href="/Team:NYU_Gallatin/Project/Transforming" title="We transformed stuff." class="active-trail active">Transforming</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Growing" title="">Growing</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Project/Designing" title="">Designing</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Project/Socializing" title="">Socializing</a></li><br />
</ul></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Transformation</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-35" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p><img src="http://farm9.staticflickr.com/8454/8052039349_973bb2a2b1_m.jpg" class="border" /> <img src="http://farm9.staticflickr.com/8452/8052046690_74e9f03b01_n.jpg" class="border" /></p><br />
<p><img src="http://farm9.staticflickr.com/8317/8052051236_7e6f368694_n.jpg" class="border" /> <img src="http://farm9.staticflickr.com/8182/8052044117_7b58cb9ea3_n.jpg" class="border" /></p><br />
<h1>Protocols</h1><br />
<h2>Modified E. Coli and Acetobacter Electroporation Protocol</h2><br />
<p>Protocol Adapted From Following Paper:<br /><a href="https://docs.google.com/a/brown.edu/folder/d/0B52k0YOxsn7EQk9kc2VxdlI0NTQ/edit?docId=0B9bdNJ3ouX7GSlFlQ0N5S2hBZW8">https://docs.google.com/a/brown.edu/folder/d/0B52k0YOxsn7EQk9kc2VxdlI0NTQ/edit?docId=0B9bdNJ3ouX7GSlFlQ0N5S2hBZW8</a></p><br />
<h3>Materials Needed:</h3><br />
<ul><li>Ice Cold sterile H20</li><br />
<li>Ice Cold 10% Glycerine</li><br />
<li>Plasmid</li><br />
<li>Bacterial Strain</li><br />
<li>Sterile LB Broth</li><br />
<li>Sterile SOC Broth</li><br />
<li>For Acetobacter: Sterile Acetobacter media. </li><br />
</ul><h3>Materials we used:</h3><br />
<ul><li>MM194 and JM109 E. Coli strains</li><br />
<li>PBR332 plasmid at 5ng/mL concentration</li><br />
</ul><h3>Equipment Used</h3><br />
<ul><li>Bio-Rad Gene-Pulser Electroporation Machine, Resistor, and Capacitance Extender</li><br />
<li>Refrigerated Centrifuge</li><br />
<li>Spectrophotometer</li><br />
</ul><h3>Electro-competent Cell Preparation (for 50 transformations)</h3><br />
<ol><li>Inoculate 5ml liquid LB culture for overnight incubation at 37 degrees with agitation at 225rpm. Use Acetobacter media for Acetobacter cultures instead of LB.</li><br />
<li>Next day, pour 27mL liquid LB into 4 separate 50mL tubes and pre-heat to 37degrees.</li><br />
<li>To each tube, add 1.25mL of overnight culture.</li><br />
<li>Incubate the 50mL tubes with agitation (225rpm 37degrees)</li><br />
<li>Incubate until an A600 absorbance reading of approximately 0.4 is reached, this should take approximately one hour. Acetobacter cultures, which have a much slower growth rate, may be incubated overnight if absorbance readings are not reached. </li><br />
<li>Once bacterial cultures reach desired density, take them out of incubation and put them in an ice bath for 30 minutes.</li><br />
<li>After cooling, spin the tubes in a refrigerated (4degC) centrifuge for 12min at 4100rpm.</li><br />
<li>Pour off supernatant, taking care not to disturb the pellet and re-suspend bacteria pellet in 25mL ice-cold sterile water. Use pipette to accomplish this; do not use a vortex machine.</li><br />
<li>Centrifuge again for 12 minutes at 4100 rpm and 4 degrees C temp</li><br />
<li>Pour off supernatant again, re-suspend pellet in 4mL ice-cold sterile water and transfer suspended mixture to 15mL tube.</li><br />
<li>Centrifuge again for 12 minutes at 4100 rpm and 4 degrees C</li><br />
<li>Pour off water and re-suspend pellet in 2mL ice cold 10% glycerin</li><br />
<li>Centrifuge for 12 Minutes at 4100 rpm and 4 degrees C</li><br />
<li>Aspirate as much supernatant as possible using a micro-pipette and re-suspend pellet in 2mL ice cold 10% glycerin.</li><br />
<li>Store samples on ice for immediate use or freeze down 40ul aliquots at -80degC.</li><br />
</ol><p>Note: Centrifuging has been tried at an extra 100rpm speed for 13 minutes successfully, supernatant was easier to discard. </p><br />
<h3>Electroporation Protocol</h3><br />
<ol><li>Use 40mL aliquots of the suspended bacteria for each transformation.</li><br />
<li>Add 2mL of plasmid (we used PBR322 at 5ng/mL) to 40mL of bacteria suspension and mix</li><br />
<li>Transfer sample to ice cold 1mm gap electroporation cuvette</li><br />
<li>Remove all moisture from outside of cuvette with kimwipe, this is important to prevent electrical arcing. Note: If an arc is observed, then your sample most likely did not successfully transform!</li><br />
<li>Set electroporation machine to 2.5kV current with 200W resistance and 25mF capacitance</li><br />
<li>Using Bio-Rad Gene Pulser: Insert cuvette into cuvette holder, making sure electrodes on the cuvette are touching those in the holder. Make sure cuvette holder is behind a Plexiglas safety shield.</li><br />
<li>Hold down the two red buttons on the gene pulser until you hear a beep, then release, this should indicate that a successful charge was dispersed</li><br />
<li>Using warm SOC media, quickly transfer contents of cuvette and place them into a sterile 15mL tubes, containing 1mL of warm SOC media.</li><br />
<li>Incubate the culture for 1 hour at 37 degrees with gentle agitation</li><br />
<li>After incubation, take 200mL of the sample and plate onto appropriate agar, use beads to spread the sample around the plate</li><br />
</ol></div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
<div id="block-views-lab-notes-block-1" class="block block-views"><br />
<br />
<h2>Transformation Lab Notes</h2><br />
<br />
<div class="content"><br />
<div class="view view-lab-notes view-id-lab_notes view-display-id-block_1 view-dom-id-19ea12713919cded0fcca453e9d557ee"><br />
<br />
<br />
<br />
<div class="view-content"><br />
<table class="views-table cols-3" ><br />
<thead><br />
<tr><br />
<th class="views-field views-field-field-sub-team" ><br />
Team </th><br />
<th class="views-field views-field-created" ><br />
Date </th><br />
<th class="views-field views-field-body" ><br />
Note </th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr class="odd views-row-first"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/10/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8174/8048768673_d51ef329a3.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/07/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8313/8048773304_9ce0f49fd2.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/04/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8451/8048765553_1ffd507e36.jpg" /><br /><img src="http://farm9.staticflickr.com/8172/8048770556_2604c4a9b2.jpg" /><br /><img src="http://farm9.staticflickr.com/8316/8048765169_52ca13cda9_n.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/03/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8450/8048766095_c94a54efd5.jpg" /><br /><img src="http://farm9.staticflickr.com/8313/8048765937_f6fd019924.jpg" /><br /><img src="http://farm9.staticflickr.com/8180/8048770890_12ba62d1a7.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/02/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8318/8048766337_a5795fb13d.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/01/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8182/8048766707_9cb88da4d7.jpg" /><br /><img src="http://farm9.staticflickr.com/8171/8048771682_17e08a6f17.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/30/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8179/8048766867_8c6cc28dd4.jpg" /><br /><img src="http://farm9.staticflickr.com/8174/8048767007_9a47831e22.jpg" /><br /><img src="http://farm9.staticflickr.com/8455/8048772414_005410d2f1.jpg" /><br /><img src="http://farm9.staticflickr.com/8169/8048767529_8993906e3d.jpg" /><br /><img src="http://farm9.staticflickr.com/8318/8048767697_95e77a28af.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even views-row-last"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/20/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8033/8048772282_58fab176aa.jpg" /></p><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
</div> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Parts
Team:NYU Gallatin/Parts
2012-10-03T23:30:06Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-4 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308 active-trail active"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry." class="active-trail active">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Parts}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-parts-menu" class="block block-menu"><br />
<br />
<h2>Pick a Part</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first last leaf active-trail"><a href="/Team:NYU_Gallatin/Parts" title="" class="active-trail active">Parts</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Parts</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-4" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<center><img style="border: solid black 1px; margin-bottom: 20px;" src="http://farm9.staticflickr.com/8180/8045870937_7a040e1618_c.jpg" width=683 /></center><div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><p>Here are the parts we contributed to the Bio Bricks library this year.</p><br />
<table cellspacing="0" cellpadding="3" border="0"><tr><th></th><br />
<th></th><br />
<th>part number</th><br />
<th>description</th><br />
<th>type</th><br />
<th>designer</th><br />
</tr><tr><td style="color: red">♥</td><br />
<td></td><br />
<td><a href="http://partsregistry.org/Part:BBa_K850000" target="_new">Bba_K850000</a></td><br />
<td>AGM1 gene from candida albicans</td><br />
<td>coding</td><br />
<td>Min-Gyu Kim</td><br />
</tr><tr><td style="color: red">♥</td><br />
<td></td><br />
<td><a href="http://partsregistry.org/Part:BBa_K850001" target="_new">Bba_K850001</a></td><br />
<td>NAG1 gene from candida albicans</td><br />
<td>coding</td><br />
<td>Min-Gyu Kim</td><br />
</tr><tr><td style="color: red">♥</td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K850002" target="_new">Bba_K850002</a></td><br />
<td>UAP1 gene from candida albicans</td><br />
<td>coding</td><br />
<td>Min-Gyu Kim</td><br />
</tr></table></div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Notebook/Photos
Team:NYU Gallatin/Notebook/Photos
2012-10-03T05:58:41Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-node page-node- page-node-19 node-type-page" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos.">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Notebook}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-notebook" class="block block-menu"><br />
<br />
<h2>Take Notes</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first leaf"><a href="/Team:NYU_Gallatin/Notebook" title="">Notebook</a></li><br />
<li class="leaf active-trail"><a href="/Team:NYU_Gallatin/Notebook/Photos" title="" class="active-trail active">Photos</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Notebook/Videos" title="">Videos</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Photos</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div id="node-19" class="node node-page node-full clearfix"><br />
<br />
<br />
<br />
<div class="content clearfix"><br />
<div class="field field-name-body field-type-text-with-summary field-label-hidden"><div class="field-items"><div class="field-item even"><div id="flickr-images">Loading Images...</div><br />
<script type="text/javascript"><br />
<!--//--><![CDATA[// ><!--<br />
<br />
setTimeout(function() {$.getJSON(flickr_main_url, displayImages);},1500);<br />
function displayImages(data) {<br />
// Start putting together the HTML string<br />
var htmlString = "";<br />
<br />
// Now start cycling through our array of Flickr photo details<br />
$.each(data.items, function(i,item){<br />
// I only want the ickle square thumbnails<br />
var sourceSquare = (item.media.m).replace("_m.jpg", "_q.jpg");<br />
// var sourceSquare = item.media.m;<br />
var l_sourceSquare = (item.media.m).replace("_m.jpg", "_b.jpg");<br />
<br />
// Here's where we piece together the HTML<br />
htmlString += '<li><a href="'+l_sourceSquare+'" rel="lightbox">';<br />
htmlString += '<img title="' + item.title + '" src="' + sourceSquare;<br />
htmlString += '" alt="'; htmlString += item.title + '" />';<br />
htmlString += '';<br />
});<br />
<br />
// Pop our HTML in the #images DIV<br />
$('#flickr-images').html(htmlString);<br />
<br />
// Close down the JSON function call<br />
}<br />
<br />
//--><!]]><br />
</script><p><br />
<a href="http://www.flickr.com/photos/85815851@N04/" target="_new">Check out our Flickr to see all of our photos!</a></p><br />
</div></div></div> </div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Templates/Styles
Team:NYU Gallatin/Templates/Styles
2012-10-03T05:57:24Z
<p>Sararobertson: </p>
<hr />
<div><html><br />
<head><br />
<nowiki><style><br />
/* Styles for the Wiki site */<br />
<br />
/* Neuropol Fonts */<br />
@font-face {<br />
font-family: neuropol;<br />
/* src: url('http://igem.melodramatic.com/sites/default/themes/igem/fonts/NEUROPOL.ttf'); */<br />
src: url('https://static.igem.org/mediawiki/2012/e/e6/Aseatobacter-FONT_NEUROPOL.txt');<br />
}<br />
.view-team h3,<br />
.view-team .views-label,<br />
.view-team span.username,<br />
.aseato,<br />
#page-title,<br />
#main-menu-links a span b,<br />
#page .sidebar .block h2,<br />
#block-block-9 h2,<br />
#block-block-4 h2,<br />
#block-block-5 h2,<br />
#block-block-2 span.stat,<br />
#site-slogan,<br />
#site-name {<br />
font-family: neuropol, "Courier New" !important;<br />
}<br />
<br />
/* Hidden Elements */<br />
#p-logo,<br />
#catlinks,<br />
#top-section #p-logo img,<br />
div.front #page-title,<br />
h1.firstHeading,<br />
#top-section, <br />
#footer-box,<br />
html.js .js-hide,<br />
#bodyContent p,<br />
.element-hidden {<br />
display: none;<br />
}<br />
<br />
#content {<br />
padding-top: 0 !important;<br />
}<br />
#content {<br />
padding: 0;<br />
}<br />
#bodyContent {<br />
padding: 0;<br />
margin: 0;<br />
}<br />
#bodyContent #page-wrapper p {<br />
display: block;<br />
}<br />
#header {<br />
}<br />
#page {<br />
font-size: 75%;<br />
}<br />
<br />
/* ---------- Basic Layout Styles ----------- */<br />
<br />
html,<br />
body,<br />
#page {<br />
height: 100%;<br />
}<br />
#content {<br />
width: 100%;<br />
}<br />
#page-wrapper {<br />
min-height: 100%;<br />
min-width: 950px;<br />
}<br />
#header div.section,<br />
#featured div.section,<br />
#messages div.section,<br />
#main,<br />
#triptych,<br />
#footer-columns {<br />
width: 950px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
}<br />
#header div.section {<br />
position: relative;<br />
}<br />
.region-header {<br />
float: right; /* LTR */<br />
margin: 0 5px 10px;<br />
}<br />
.with-secondary-menu .region-header {<br />
margin-top: 3em;<br />
}<br />
.without-secondary-menu .region-header {<br />
margin-top: 15px;<br />
}<br />
#secondary-menu {<br />
position: absolute;<br />
right: 0; /* LTR */<br />
top: 0;<br />
width: 480px;<br />
}<br />
#igem-content,<br />
#sidebar-first,<br />
#sidebar-second {<br />
display: inline;<br />
float: left; /* LTR */<br />
position: relative;<br />
}<br />
.one-sidebar #igem-content {<br />
width: 710px;<br />
}<br />
.two-sidebars #igem-content {<br />
width: 480px;<br />
}<br />
.no-sidebars #igem-content {<br />
width: 950px;<br />
float: none;<br />
}<br />
#sidebar-first,<br />
#sidebar-second {<br />
width: 210px;<br />
}<br />
#main-wrapper {<br />
min-height: 300px;<br />
}<br />
#igem-content .section,<br />
.sidebar .section {<br />
padding: 0 15px;<br />
}<br />
#footer-wrapper {<br />
padding: 0px 5px 0px;<br />
}<br />
.region-footer-firstcolumn,<br />
.region-footer-secondcolumn,<br />
.region-footer-thirdcolumn,<br />
.region-footer-fourthcolumn {<br />
padding: 0 10px;<br />
width: 220px;<br />
}<br />
<br />
#globalWrapper {<br />
z-index: 1;<br />
padding: 0px !important;<br />
}<br />
#contentSub {<br />
border: solid black 1px;<br />
}<br />
#canvas {<br />
position: fixed !important;<br />
top: 0 !important;<br />
left: 0 !important;<br />
}<br />
<br />
<br />
/**<br />
* Inline items.<br />
*/<br />
.container-inline div,<br />
.container-inline label {<br />
display: inline;<br />
}<br />
.container-inline .fieldset-wrapper {<br />
display: block;<br />
}<br />
.nowrap {<br />
white-space: nowrap;<br />
}<br />
<br />
.element-invisible {<br />
position: absolute !important;<br />
clip: rect(1px 1px 1px 1px); /* IE6, IE7 */<br />
clip: rect(1px, 1px, 1px, 1px);<br />
}<br />
.element-invisible.element-focusable:active,<br />
.element-invisible.element-focusable:focus {<br />
position: static !important;<br />
clip: auto;<br />
}<br />
<br />
/**<br />
* Markup free clearing.<br />
*<br />
* @see http://perishablepress.com/press/2009/12/06/new-clearfix-hack<br />
*/<br />
.clearfix:after {<br />
content: ".";<br />
display: block;<br />
height: 0;<br />
clear: both;<br />
visibility: hidden;<br />
}<br />
/* IE6 */<br />
* html .clearfix {<br />
height: 1%;<br />
}<br />
/* IE7 */<br />
*:first-child + html .clearfix {<br />
min-height: 1%;<br />
}<br />
<br />
<br />
/* ---------- Overall Specifications ---------- */<br />
<br />
body {<br />
line-height: 1.5;<br />
font-size: 100%;<br />
word-wrap: break-word;<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
outline: 0;<br />
font-family: "Helvetica";<br />
}<br />
#page, #main {<br />
font-family: "Helvetica";<br />
}<br />
a:link,<br />
a:visited {<br />
text-decoration: none;<br />
}<br />
a:hover,<br />
a:active,<br />
a:focus {<br />
text-decoration: underline;<br />
}<br />
tr.odd {<br />
background-color: #e8e9dc;<br />
}<br />
img {<br />
outline: 0;<br />
}<br />
<br />
/* ------------------ Fonts ------------------ */<br />
<br />
#header,<br />
#footer-wrapper,<br />
ul.contextual-links,<br />
ul.links,<br />
ul.primary,<br />
.item-list .pager,<br />
div.field-type-taxonomy-term-reference,<br />
div.messages,<br />
div.meta,<br />
p.comment-time,<br />
table,<br />
.breadcrumb {<br />
font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
}<br />
input,<br />
textarea,<br />
select,<br />
a.button {<br />
font-family: "Lucida Grande", "Lucida Sans Unicode", Verdana, sans-serif;<br />
}<br />
<br />
<br />
/* ------------------ Table Styles ------------------ */<br />
<br />
table {<br />
border: 0;<br />
border-spacing: 0;<br />
font-size: 0.7em;<br />
margin: 10px 0;<br />
width: 100%;<br />
border: solid #909268 1px;<br />
border-right: none;<br />
border-top: none;<br />
}<br />
table table {<br />
font-size: 1em;<br />
}<br />
#footer-wrapper table {<br />
font-size: 1em;<br />
}<br />
table tr th {<br />
background: #53561d;<br />
color: #fff;<br />
border-bottom-style: none;<br />
}<br />
table tr th,<br />
table tr th a,<br />
table tr th a:hover {<br />
color: #FFF;<br />
font-weight: bold;<br />
font-size: 0.9em;<br />
}<br />
table tbody tr th {<br />
vertical-align: top;<br />
}<br />
tr td,<br />
tr th {<br />
padding: 4px 9px;<br />
border: solid #909268 1px;<br />
border-left: none;<br />
border-bottom: none;<br />
text-align: left; /* LTR */<br />
vertical-align: top;<br />
}<br />
<br />
tr td.last,<br />
tr th {<br />
<br />
}<br />
#footer-wrapper tr td,<br />
#footer-wrapper tr th {<br />
border-color: #555;<br />
border-color: rgba(255, 255, 255, 0.18);<br />
}<br />
table ul.links {<br />
margin: 0;<br />
padding: 0;<br />
font-size: 1em;<br />
}<br />
table ul.links li {<br />
padding: 0 1em 0 0;<br />
}<br />
<br />
/* ------------------ List Styles ------------------ */<br />
<br />
.block ol,<br />
.block ul {<br />
margin: 0;<br />
padding: 0 0 0.25em 1em; /* LTR */<br />
}<br />
.contextual-links-wrapper {<br />
font-size: small !important;<br />
}<br />
ul.contextual-links {<br />
font-size: 0.923em;<br />
}<br />
.contextual-links-wrapper a {<br />
text-shadow: 0 0 0 !important;<br />
}<br />
.item-list .pager {<br />
font-size: 0.929em;<br />
}<br />
ul.menu li {<br />
margin: 0;<br />
list-style: none;<br />
}<br />
.region-content ul,<br />
.region-content ol {<br />
margin: 1em 0;<br />
padding: 0 0 0.25em 2.5em; /* LTR */<br />
}<br />
.item-list ul li {<br />
margin: 0;<br />
padding: 0.2em 0.5em 0 0; /* LTR */<br />
}<br />
ul.tips {<br />
padding: 0 0 0 1.25em; /* LTR */<br />
}<br />
#sidebar-first li a {<br />
color: black;<br />
}<br />
#sidebar-first li a:hover,<br />
#sidebar-first li a.active {<br />
color: #757418;<br />
text-decoration: underline;<br />
}<br />
<br />
/* ------------------ Header ------------------ */<br />
#logo {<br />
float: left; /* LTR */<br />
padding: 15px 15px 15px 10px; /* LTR */<br />
}<br />
#name-and-slogan {<br />
padding-top: 34px;<br />
margin: 0 0 10px 15px; /* LTR */<br />
}<br />
#site-name {<br />
color: #686868;<br />
font-size: 50px;<br />
text-align: center;<br />
margin: 10px 0 0 0;<br />
}<br />
h1#site-name {<br />
margin: 0;<br />
}<br />
#site-name a {<br />
font-weight: normal;<br />
}<br />
#site-slogan {<br />
font-size: 1.0;<br />
margin: 0;<br />
padding: 0;<br />
word-spacing: 0.1em;<br />
border: 0;<br />
text-align: center;<br />
}<br />
<br />
/* ------------------- Main ------------------- */<br />
<br />
#main {<br />
margin-top: 20px;<br />
margin-bottom: 0px;<br />
}<br />
<br />
/* ----------------- Content ------------------ */<br />
<br />
.content {<br />
margin-top: 10px;<br />
}<br />
h1#page-title {<br />
font-size: 2em;<br />
line-height: 1;<br />
margin-top: 0;<br />
}<br />
#igem-content h2 {<br />
margin-bottom: 2px;<br />
font-size: 1.429em;<br />
line-height: 1.4;<br />
}<br />
.igem-section,<br />
.one-sidebar #igem-content {<br />
padding: 13px;<br />
}<br />
#page .node .content,<br />
#page .view {<br />
font-size: 1.3em;<br />
}<br />
.node .content p,<br />
#page .view p,<br />
.front .block p {<br />
line-height: 1.1em;<br />
}<br />
.meta {<br />
font-size: 0.857em;<br />
color: #68696b;<br />
margin-bottom: -5px;<br />
}<br />
.submitted .user-picture img {<br />
float: left; /* LTR */<br />
height: 20px;<br />
margin: 1px 5px 0 0; /* LTR */<br />
}<br />
.link-wrapper {<br />
text-align: right;<br />
}<br />
.field-type-image img,<br />
.user-picture img {<br />
margin: 0 0 1em;<br />
}<br />
ul.links {<br />
color: #68696b;<br />
font-size: 0.821em;<br />
}<br />
.node-unpublished {<br />
margin: -20px -15px 0;<br />
padding: 20px 15px 0;<br />
}<br />
/* ------------------ Sidebar ----------------- */<br />
.sidebar .block {<br />
padding: 15px 20px;<br />
margin: 0 0 20px;<br />
}<br />
.sidebar h2 {<br />
margin: 0 0 0.5em;<br />
border-bottom: 1px solid #d6d6d6;<br />
padding-bottom: 5px;<br />
text-shadow: 0 1px 0 #fff;<br />
font-size: 1.071em;<br />
line-height: 1.2;<br />
}<br />
.sidebar .block .content {<br />
font-size: 0.914em;<br />
line-height: 1.4;<br />
}<br />
.sidebar tbody {<br />
border: none;<br />
}<br />
.sidebar tr.even,<br />
.sidebar tr.odd {<br />
background: none;<br />
border-bottom: 1px solid #d6d6d6;<br />
}<br />
<br />
/* ------------------ Footer ------------------ */<br />
<br />
#footer-wrapper {<br />
color: #c0c0c0;<br />
color: rgba(255, 255, 255, 0.65);<br />
font-size: 0.857em;<br />
background-color: #c0c0c0;<br />
}<br />
#footer-wrapper a {<br />
color: #fcfcfc;<br />
color: rgba(255, 255, 255, 0.8);<br />
}<br />
#footer-wrapper a:hover,<br />
#footer-wrapper a:focus {<br />
color: #fefefe;<br />
color: rgba(255, 255, 255, 0.95);<br />
text-decoration: underline;<br />
}<br />
#footer-wrapper .block {<br />
margin: 0;<br />
}<br />
#footer-columns .block-menu,<br />
#igem-footer .block {<br />
margin: 0;<br />
padding: 0;<br />
border: none;<br />
}<br />
#igem-footer .block .content {<br />
margin-top: 0;<br />
padding: 0;<br />
}<br />
#igem-footer .block h2 {<br />
margin: 0;<br />
}<br />
<br />
/* iGem Styles */<br />
#page-title {<br />
padding: 0;<br />
margin: 0;<br />
font-family: Helvetica;<br />
}<br />
<br />
#main-menu a {<br />
color: #707070;<br />
}<br />
#canvas {<br />
position: absolute;<br />
top: 0;<br />
left: 0;<br />
}<br />
<br />
.lightbox2-alt-layout #imageData #bottomNav, .lightbox2-alt-layout-data #bottomNav {<br />
margin-bottom: 0;<br />
}<br />
<br />
/* Bacteria & iGEMs Blocks */<br />
#page #block-block-2, #page #block-block-3 {<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
background: black;<br />
opacity:0.3;<br />
filter:alpha(opacity=30); /* For IE8 and earlier */<br />
position: absolute;<br />
z-index: 9999;<br />
}<br />
#block-block-2 .content,<br />
#block-block-3 .content p {<br />
padding: 10px;<br />
margin: 0;<br />
font-size: 10px;<br />
}<br />
#block-block-2 h2,<br />
#block-block-3 h2 {<br />
color: white;<br />
font-size: 12px;<br />
line-height: 12px;<br />
padding: 10px 10px 0 10px;<br />
margin: 0;<br />
border: 0;<br />
}<br />
<br />
/* Bacteria Stats Block */<br />
#block-block-2 {<br />
right: 150px;<br />
top: -150px;<br />
}<br />
#page #block-block-2:hover {<br />
top: 0;<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
#block-block-2 #bacteria {<br />
text-align: center;<br />
text-transform: uppercase;<br />
font-weight: bold;<br />
}<br />
#block-block-2 span.stat {<br />
display: block;<br />
margin: 0;<br />
padding: 0;<br />
font-size: 24px;<br />
font-weight: bold;<br />
}<br />
<br />
/* iGEM Block */<br />
#block-block-3 {<br />
right: 20px;<br />
top: -175px;<br />
width: 120px;<br />
}<br />
#block-block-3 img {<br />
width: 100px;<br />
}<br />
#page #block-block-3:hover {<br />
top: 10px;<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
<br />
<br />
/* Front page styles */<br />
<br />
div.front #main-inner {<br />
padding: 0;<br />
margin: 0;<br />
}<br />
div.front #main-inner .block {<br />
padding: 20px 20px 10px 20px;<br />
margin-bottom: 15px;<br />
}<br />
div.front #main-inner #block-block-6 {<br />
margin-bottom: 0;<br />
}<br />
#block-block-7 div.content {<br />
padding: 0;<br />
}<br />
<br />
#block-block-9,<br />
#block-block-4,<br />
#block-block-5 {<br />
width: 257px;<br />
margin-right: 10px;<br />
float: left;<br />
height: 270px;<br />
}<br />
#block-block-5 {<br />
margin-right: 0;<br />
clear: right;<br />
}<br />
#block-block-9 h2,<br />
#block-block-4 h2,<br />
#block-block-5 h2 {<br />
border: 0;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#block-block-6 {<br />
clear: both;<br />
font-size: 1.3em;<br />
margin-bottom: 0;<br />
}<br />
<br />
#block-block-9 li {<br />
list-style: none;<br />
text-align: center;<br />
}<br />
#block-block-9 img {<br />
border: solid black 1px;<br />
}<br />
<br />
#block-block-9 .more-link,<br />
#block-block-6 .more-link,<br />
#block-block-4 .more-link,<br />
#block-block-5 .more-link {<br />
font-size: 12px;<br />
padding: 5px 5px;<br />
margin: 0;<br />
margin-top: 10px;<br />
line-height: 14px;<br />
}<br />
<br />
<br />
/* News Block */<br />
span.homedate {<br />
background: black;<br />
color: white;<br />
display: block;<br />
-moz-border-radius: 0px 5px 5px 0px;<br />
border-radius: 0px 5px 5px 0px;<br />
margin: 0;<br />
padding: 0;<br />
height: 20px;<br />
text-align: center;<br />
font-size: 20px;<br />
font-weight: bold;<br />
float: left;<br />
padding: 5px;<br />
margin-right: 10px;<br />
}<br />
b.homedate {<br />
background-color: #757418;<br />
color: white;<br />
display: block;<br />
-moz-border-radius: 5px 5px 0px 0px;<br />
border-radius: 5px 5px 0px 0px;<br />
width: 30px;<br />
text-align: center;<br />
font-weight: normal;<br />
font-size: 11px;<br />
padding: 0;<br />
float: left;<br />
margin-top: 4px;<br />
margin-right: -4px;<br />
<br />
/* Safari */<br />
-webkit-transform: rotate(-90deg);<br />
<br />
/* Firefox */<br />
-moz-transform: rotate(-90deg);<br />
<br />
/* IE */<br />
-ms-transform: rotate(-90deg);<br />
<br />
/* Opera */<br />
-o-transform: rotate(-90deg);<br />
<br />
/* Internet Explorer */<br />
filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=3);<br />
}<br />
#block-block-4 li {<br />
list-style: none;<br />
clear: both;<br />
margin-bottom: 15px;<br />
vertical-align: center;<br />
font-size: 13px;<br />
}<br />
#block-block-4 li a,<br />
#block-block-4 li {<br />
color: #757418;<br />
text-decoration: underline;<br />
}<br />
#block-block-4 ul {<br />
padding: 0;<br />
}<br />
<br />
div.social {<br />
/* background: url('../images/trans-bg-white.png'); */<br />
/* border: solid black 2px; */<br />
background: white;<br />
border: solid black 2px;<br />
color: black;<br />
display: inline-block;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
padding: 15px; <br />
text-align: center;<br />
width: 152px;<br />
margin-right: 0px;<br />
/*<br />
opacity:0.5;<br />
filter:alpha(opacity=50); */<br />
-webkit-transition: all 0.5s ease; <br />
-moz-transition: all 0.5s ease; <br />
-ms-transition: all 0.5s ease; <br />
-o-transition: all 0.5s ease; <br />
transition: all 0.5s ease;<br />
height: 300px;<br />
margin-top: -25px;<br />
}<br />
div.social:hover {<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
div.social.last {<br />
margin-right: 0;<br />
}<br />
#block-block-7 p {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
div.social div.social-icon {<br />
<br />
}<br />
div.social div.social-icon img {<br />
width: 150px;<br />
height: 150px;<br />
margin-top: 5px;<br />
margin-bottom: 15px;<br />
opacity:0;<br />
filter:alpha(opacity=0); /* For IE8 and earlier */<br />
-webkit-transition: all 0.5s ease; <br />
-moz-transition: all 0.5s ease; <br />
-ms-transition: all 0.5s ease; <br />
-o-transition: all 0.5s ease; <br />
transition: all 0.5s ease;<br />
}<br />
div.social div.social-icon img:hover {<br />
opacity:.50;<br />
filter:alpha(opacity=50); /* For IE8 and earlier */<br />
}<br />
div.social#social-facebook {<br />
background: #fff url('../images/social/dark-face.png') center 20px no-repeat;<br />
}<br />
div.social#social-flikr {<br />
background: #fff url('../images/social/dark-flikr.png') center 20px no-repeat;<br />
}<br />
div.social#social-twitter {<br />
background: #fff url('../images/social/dark-twitter.png') center 20px no-repeat;<br />
}<br />
div.social#social-youtube {<br />
background: #fff url('../images/social/dark-youtube.png') center 20px no-repeat;<br />
}<br />
div.social#social-rss {<br />
background: #fff url('../images/social/dark-rss.png') center 20px no-repeat;<br />
}<br />
<br />
/* Nav Styles */<br />
<br />
/* --------------- Main Menu ------------ */<br />
<br />
#main-menu {<br />
height: 80px;<br />
overflow: hidden;<br />
padding: 0;<br />
text-align: center;<br />
width: 970px;<br />
z-index: 9999;<br />
}<br />
#main-menu-links {<br />
font-size: 0.929em;<br />
}<br />
#main-menu-links li {<br />
display: inline-block;<br />
list-style: none;<br />
padding: 0;<br />
margin: 0;<br />
text-align: left;<br />
}<br />
<br />
#main-menu-links a {<br />
opacity:0.1;<br />
filter:alpha(opacity=10); /* For IE8 and earlier */<br />
color: #333;<br />
float: left; /* LTR */<br />
width: 76px;<br />
overflow: hidden;<br />
height: 76px;<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
}<br />
#main-menu-links a span {<br />
margin-left: 80px;<br />
display: block;<br />
font-size: 11px;<br />
line-height: 12px;<br />
-moz-border-radius: 10px;<br />
border-radius: 10px;<br />
width: 88px;<br />
text-align: left;<br />
padding: 8px;<br />
height: 55px;<br />
}<br />
#main-menu-links a b {<br />
display: block;<br />
}<br />
#main-menu-links a:hover,<br />
#main-menu-links a:focus,<br />
#main-menu-links a.active {<br />
opacity:1.0;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
width: 190px;<br />
text-decoration: none;<br />
}<br />
#main-menu-links a:active,<br />
#main-menu-links a.active {<br />
opacity:1.0;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
<br />
/* Home */<br />
#main-menu-links li.menu-218 a {<br />
background: url('https://static.igem.org/mediawiki/2012/5/56/Aseatobacter-NAV-Home.png') left center no-repeat;<br />
}<br />
/* Team */<br />
#main-menu-links li.menu-388 a {<br />
background: url('https://static.igem.org/mediawiki/2012/7/73/Aseatobacter-NAV-Team.png') left center no-repeat;<br />
}<br />
/* Project */<br />
#main-menu-links li.menu-307 a {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d2/Aseatobacter-NAV-Project.png') left center no-repeat;<br />
}<br />
/* Parts */<br />
#main-menu-links li.menu-308 a {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Parts.png') left center no-repeat;<br />
}<br />
/* Modeling */<br />
#main-menu-links li.menu-310 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/ed/Aseatobacter-NAV-Modeling.png') left center no-repeat;<br />
}<br />
/* Notebook */<br />
#main-menu-links li.menu-584 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/e8/Aseatobacter-NAV-Notebook.png') left center no-repeat;<br />
}<br />
/* Safety */<br />
#main-menu-links li.menu-312 a {<br />
background: url('https://static.igem.org/mediawiki/2012/5/5f/Aseatobacter-NAV-Safety.png') left center no-repeat;<br />
}<br />
/* Attributions */<br />
#main-menu-links li.menu-313 a {<br />
background: url('https://static.igem.org/mediawiki/2012/c/c9/Aseatobacter-NAV-Attributions.png') left center no-repeat;<br />
}<br />
/* Profile */<br />
#main-menu-links li.menu-306 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/ea/Aseatobacter-NAV-Profile.png') left center no-repeat;<br />
}<br />
<br />
/* Page titles */<br />
div.page-team #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Small-Safety.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-5 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d5/Aseatobacter-NAV-Small-Modeling.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
/* Project */<br />
div.page-node-3 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/41/Aseatobacter-NAV-Small-Home.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-4 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/e/ea/Aseatobacter-NAV-Small-Parts.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-6 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/b/b7/Aseatobacter-NAV-Small-Notebook.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-7 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Small-Safety.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
/* Attributions */<br />
div.page-node-8 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/41/Aseatobacter-NAV-Small-Home.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
<br />
<br />
/* ---------- Color Module Styles ----------- */<br />
<br />
body,<br />
body.overlay {<br />
color: #C4C487;<br />
/* background-color: #9c9f7f; */<br />
background-color: #98986c;<br />
}<br />
.comment .comment-arrow {<br />
border-color: #393a2d;<br />
}<br />
#page,<br />
#main-wrapper {<br />
background: transparent;<br />
}<br />
<br />
.no-sidebars #main-inner,<br />
.one-sidebar #igem-content,<br />
div.front #main-inner .block {<br />
background: transparent url('https://static.igem.org/mediawiki/2012/c/cf/Aseatobacter-IMAGES-trans-bg.png');<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
border: solid black 2px;<br />
}<br />
<br />
div.front #main-inner #block-block-9,<br />
div.front #main-inner #block-block-4,<br />
div.front #main-inner #block-block-5 {<br />
/* background: transparent url('../images/trans-bg-white.png'); */<br />
background: white;<br />
color: black;<br />
}<br />
div.front #main-inner #block-block-9 a,<br />
div.front #main-inner #block-block-4 a,<br />
div.front #main-inner #block-block-5 a,<br />
#block-block-2 span.stat {<br />
color: #757418;<br />
}<br />
<br />
div.front.no-sidebars #main-inner {<br />
background: none;<br />
border: none;<br />
}<br />
#page .sidebar .block {<br />
background: #fff;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
border: solid black 2px;<br />
}<br />
<br />
#page .sidebar .block h2 {<br />
margin: 0;<br />
border: 0;<br />
padding: 0;<br />
font-size: 20px;<br />
}<br />
.no-sidebars #main-inner {<br />
padding: 0 20px;<br />
border: solid black 2px;<br />
}<br />
.igem-section {<br />
color: #e9e9c8;<br />
}<br />
.tabs ul.primary li a.active {<br />
background-color: #ffffff;<br />
}<br />
.tabs ul.primary li.active a {<br />
background-color: #ffffff;<br />
border-bottom: 1px solid #ffffff;<br />
}<br />
a, a:visited, a:active {<br />
color: #C4C487;<br />
}<br />
a:hover,<br />
a:focus {<br />
color: #fff;<br />
}<br />
a:active {<br />
color: #55540d;<br />
}<br />
<br />
#main-menu-links a span {<br />
border: solid black 2px;<br />
background: transparent url('https://static.igem.org/mediawiki/2012/c/cf/Aseatobacter-IMAGES-trans-bg.png');<br />
color: black;<br />
}<br />
<br />
#main-menu-links a span b {<br />
color: white;<br />
padding-bottom: 5px;<br />
font-size: 10px;<br />
}<br />
<br />
#page-wrapper,<br />
#footer-wrapper {<br />
background-color: transparent;<br />
}<br />
.region-header,<br />
.region-header a,<br />
.region-header li a.active,<br />
#name-and-slogan,<br />
#name-and-slogan a,<br />
#secondary-menu-links li a {<br />
color: #fffeff;<br />
}<br />
<br />
/* iGEMs Colors */<br />
#top-section #p-logo {<br />
background: transparent;<br />
color: #9c9f7f;<br />
border: none;<br />
}<br />
#top-section #menubar.right-menu a {<br />
background: none;<br />
color: #535445;<br />
}<br />
#top-section #menubar.right-menu a:hover {<br />
color: black;<br />
}<br />
#top-section #search-controls input {<br />
color: #535445;<br />
}<br />
#top-section #menubar.left-menu a {<br />
color: #535445;<br />
}<br />
#top-section #menubar.left-menu:hover {<br />
background: none;<br />
}<br />
#content {<br />
background: transparent;<br />
}<br />
#footer-box {<br />
background: #393a2d;<br />
border: solid #393a2d 1px;<br />
border-top: 0;<br />
}<br />
#footer-box a {<br />
color: #9c9f7f;<br />
}<br />
#page-title {<br />
color: #000;<br />
border: none;<br />
}<br />
#site-name a {<br />
color: black;<br />
}<br />
#site-name a:hover {<br />
text-decoration: none;<br />
}<br />
#site-slogan {<br />
color: #fff;<br />
}<br />
<br />
.field-name-field-photo img {<br />
border: solid black 1px;<br />
}<br />
#main .views-view-grid img.default-pic,<br />
.field-name-field-photo img.default-pic {<br />
border: none;<br />
}<br />
#main .views-view-grid td,<br />
#main .views-view-grid tr td,<br />
#main .views-view-grid tr th,<br />
#main table.views-view-grid {<br />
background: transparent;<br />
border: 0;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
}<br />
#main .views-view-grid img,<br />
#main .view-header img {<br />
border: solid black 1px;<br />
float: left;<br />
margin: 0 15px 15px 0;<br />
}<br />
.view-team h3 {<br />
color: black;<br />
}<br />
.view-team .views-label {<br />
font-size: 1.4em;<br />
color: #C4C487;<br />
}<br />
.view-team a.username {<br />
font-size: 22pt;<br />
color: white;<br />
}<br />
#main .view-team div.field-content {<br />
padding: 0;<br />
margin: 0;<br />
line-height: 20px;<br />
}<br />
.view-team td {<br />
width: 50%;<br />
height: 150px;<br />
vertical-align: top;<br />
}<br />
.aseato {<br />
color: black;<br />
font-size: 1.4em;<br />
}<br />
<br />
#top-main-menu {<br />
width: 100%;<br />
height: 30px;<br />
text-align: center;<br />
position: absolute;<br />
top: 0;<br />
left: 0;<br />
margin: 0;<br />
background: black;<br />
font-size: 15px;<br />
z-index: 10;<br />
}<br />
#top-main-menu li {<br />
display: inline-block;<br />
padding-right: 15px;<br />
}<br />
#top-main-menu li a {<br />
color: white;<br />
}<br />
#top-main-menu a:hover,<br />
#top-main-menu a.active {<br />
color: #757418;<br />
}<br />
<br />
#flickr-images li {<br />
list-style: none;<br />
display: inline-block;<br />
padding: 7px 9px;<br />
}<br />
#flickr-images li img {<br />
border: solid black 1px;<br />
}<br />
<br />
table a:link, table a:visited, table a:active {<br />
color: black;<br />
text-decoration: underline;<br />
}<br />
table a:hover {<br />
color: black;<br />
text-decoration: underline;<br />
}<br />
<br />
li {<br />
list-style-image: none;<br />
list-style-type: square;<br />
}<br />
<br />
li li {<br />
list-style-image: none;<br />
list-style-type: circle;<br />
}<br />
<br />
img.border {<br />
border: solid black 1px;<br />
}<br />
</style></nowiki><br />
</head><br />
</html></div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Templates/Styles
Team:NYU Gallatin/Templates/Styles
2012-10-03T05:56:46Z
<p>Sararobertson: </p>
<hr />
<div><html><br />
<head><br />
<nowiki><style><br />
/* Styles for the Wiki site */<br />
<br />
/* Neuropol Fonts */<br />
@font-face {<br />
font-family: neuropol;<br />
/* src: url('http://igem.melodramatic.com/sites/default/themes/igem/fonts/NEUROPOL.ttf'); */<br />
src: url('https://static.igem.org/mediawiki/2012/e/e6/Aseatobacter-FONT_NEUROPOL.txt');<br />
}<br />
.view-team h3,<br />
.view-team .views-label,<br />
.view-team span.username,<br />
.aseato,<br />
#page-title,<br />
#main-menu-links a span b,<br />
#page .sidebar .block h2,<br />
#block-block-9 h2,<br />
#block-block-4 h2,<br />
#block-block-5 h2,<br />
#block-block-2 span.stat,<br />
#site-slogan,<br />
#site-name {<br />
font-family: neuropol, "Courier New" !important;<br />
}<br />
<br />
/* Hidden Elements */<br />
#p-logo,<br />
#catlinks,<br />
#top-section #p-logo img,<br />
div.front #page-title,<br />
h1.firstHeading,<br />
#top-section, <br />
#footer-box,<br />
html.js .js-hide,<br />
#bodyContent p,<br />
.element-hidden {<br />
display: none;<br />
}<br />
<br />
#content {<br />
padding-top: 0 !important;<br />
}<br />
#content {<br />
padding: 0;<br />
}<br />
#bodyContent {<br />
padding: 0;<br />
margin: 0;<br />
}<br />
#bodyContent #page-wrapper p {<br />
display: block;<br />
}<br />
#header {<br />
}<br />
#page {<br />
font-size: 75%;<br />
}<br />
<br />
/* ---------- Basic Layout Styles ----------- */<br />
<br />
html,<br />
body,<br />
#page {<br />
height: 100%;<br />
}<br />
#content {<br />
width: 100%;<br />
}<br />
#page-wrapper {<br />
min-height: 100%;<br />
min-width: 950px;<br />
}<br />
#header div.section,<br />
#featured div.section,<br />
#messages div.section,<br />
#main,<br />
#triptych,<br />
#footer-columns {<br />
width: 950px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
}<br />
#header div.section {<br />
position: relative;<br />
}<br />
.region-header {<br />
float: right; /* LTR */<br />
margin: 0 5px 10px;<br />
}<br />
.with-secondary-menu .region-header {<br />
margin-top: 3em;<br />
}<br />
.without-secondary-menu .region-header {<br />
margin-top: 15px;<br />
}<br />
#secondary-menu {<br />
position: absolute;<br />
right: 0; /* LTR */<br />
top: 0;<br />
width: 480px;<br />
}<br />
#igem-content,<br />
#sidebar-first,<br />
#sidebar-second {<br />
display: inline;<br />
float: left; /* LTR */<br />
position: relative;<br />
}<br />
.one-sidebar #igem-content {<br />
width: 710px;<br />
}<br />
.two-sidebars #igem-content {<br />
width: 480px;<br />
}<br />
.no-sidebars #igem-content {<br />
width: 950px;<br />
float: none;<br />
}<br />
#sidebar-first,<br />
#sidebar-second {<br />
width: 210px;<br />
}<br />
#main-wrapper {<br />
min-height: 300px;<br />
}<br />
#igem-content .section,<br />
.sidebar .section {<br />
padding: 0 15px;<br />
}<br />
#footer-wrapper {<br />
padding: 0px 5px 0px;<br />
}<br />
.region-footer-firstcolumn,<br />
.region-footer-secondcolumn,<br />
.region-footer-thirdcolumn,<br />
.region-footer-fourthcolumn {<br />
padding: 0 10px;<br />
width: 220px;<br />
}<br />
<br />
#globalWrapper {<br />
z-index: 1;<br />
padding: 0px !important;<br />
}<br />
#contentSub {<br />
border: solid black 1px;<br />
}<br />
#canvas {<br />
position: fixed !important;<br />
top: 0 !important;<br />
left: 0 !important;<br />
}<br />
<br />
<br />
/**<br />
* Inline items.<br />
*/<br />
.container-inline div,<br />
.container-inline label {<br />
display: inline;<br />
}<br />
.container-inline .fieldset-wrapper {<br />
display: block;<br />
}<br />
.nowrap {<br />
white-space: nowrap;<br />
}<br />
<br />
.element-invisible {<br />
position: absolute !important;<br />
clip: rect(1px 1px 1px 1px); /* IE6, IE7 */<br />
clip: rect(1px, 1px, 1px, 1px);<br />
}<br />
.element-invisible.element-focusable:active,<br />
.element-invisible.element-focusable:focus {<br />
position: static !important;<br />
clip: auto;<br />
}<br />
<br />
/**<br />
* Markup free clearing.<br />
*<br />
* @see http://perishablepress.com/press/2009/12/06/new-clearfix-hack<br />
*/<br />
.clearfix:after {<br />
content: ".";<br />
display: block;<br />
height: 0;<br />
clear: both;<br />
visibility: hidden;<br />
}<br />
/* IE6 */<br />
* html .clearfix {<br />
height: 1%;<br />
}<br />
/* IE7 */<br />
*:first-child + html .clearfix {<br />
min-height: 1%;<br />
}<br />
<br />
<br />
/* ---------- Overall Specifications ---------- */<br />
<br />
body {<br />
line-height: 1.5;<br />
font-size: 100%;<br />
word-wrap: break-word;<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
outline: 0;<br />
font-family: "Helvetica";<br />
}<br />
#page, #main {<br />
font-family: "Helvetica";<br />
}<br />
a:link,<br />
a:visited {<br />
text-decoration: none;<br />
}<br />
a:hover,<br />
a:active,<br />
a:focus {<br />
text-decoration: underline;<br />
}<br />
tr.odd {<br />
background-color: #e8e9dc;<br />
}<br />
img {<br />
outline: 0;<br />
}<br />
<br />
/* ------------------ Fonts ------------------ */<br />
<br />
#header,<br />
#footer-wrapper,<br />
ul.contextual-links,<br />
ul.links,<br />
ul.primary,<br />
.item-list .pager,<br />
div.field-type-taxonomy-term-reference,<br />
div.messages,<br />
div.meta,<br />
p.comment-time,<br />
table,<br />
.breadcrumb {<br />
font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
}<br />
input,<br />
textarea,<br />
select,<br />
a.button {<br />
font-family: "Lucida Grande", "Lucida Sans Unicode", Verdana, sans-serif;<br />
}<br />
<br />
<br />
/* ------------------ Table Styles ------------------ */<br />
<br />
table {<br />
border: 0;<br />
border-spacing: 0;<br />
font-size: 0.7em;<br />
margin: 10px 0;<br />
width: 100%;<br />
border: solid #909268 1px;<br />
border-right: none;<br />
border-top: none;<br />
}<br />
table table {<br />
font-size: 1em;<br />
}<br />
#footer-wrapper table {<br />
font-size: 1em;<br />
}<br />
table tr th {<br />
background: #53561d;<br />
color: #fff;<br />
border-bottom-style: none;<br />
}<br />
table tr th,<br />
table tr th a,<br />
table tr th a:hover {<br />
color: #FFF;<br />
font-weight: bold;<br />
font-size: 0.9em;<br />
}<br />
table tbody tr th {<br />
vertical-align: top;<br />
}<br />
tr td,<br />
tr th {<br />
padding: 4px 9px;<br />
border: solid #909268 1px;<br />
border-left: none;<br />
border-bottom: none;<br />
text-align: left; /* LTR */<br />
vertical-align: top;<br />
}<br />
<br />
tr td.last,<br />
tr th {<br />
<br />
}<br />
#footer-wrapper tr td,<br />
#footer-wrapper tr th {<br />
border-color: #555;<br />
border-color: rgba(255, 255, 255, 0.18);<br />
}<br />
table ul.links {<br />
margin: 0;<br />
padding: 0;<br />
font-size: 1em;<br />
}<br />
table ul.links li {<br />
padding: 0 1em 0 0;<br />
}<br />
<br />
/* ------------------ List Styles ------------------ */<br />
<br />
.block ol,<br />
.block ul {<br />
margin: 0;<br />
padding: 0 0 0.25em 1em; /* LTR */<br />
}<br />
.contextual-links-wrapper {<br />
font-size: small !important;<br />
}<br />
ul.contextual-links {<br />
font-size: 0.923em;<br />
}<br />
.contextual-links-wrapper a {<br />
text-shadow: 0 0 0 !important;<br />
}<br />
.item-list .pager {<br />
font-size: 0.929em;<br />
}<br />
ul.menu li {<br />
margin: 0;<br />
list-style: none;<br />
}<br />
.region-content ul,<br />
.region-content ol {<br />
margin: 1em 0;<br />
padding: 0 0 0.25em 2.5em; /* LTR */<br />
}<br />
.item-list ul li {<br />
margin: 0;<br />
padding: 0.2em 0.5em 0 0; /* LTR */<br />
}<br />
ul.tips {<br />
padding: 0 0 0 1.25em; /* LTR */<br />
}<br />
#sidebar-first li a {<br />
color: black;<br />
}<br />
#sidebar-first li a:hover,<br />
#sidebar-first li a.active {<br />
color: #757418;<br />
text-decoration: underline;<br />
}<br />
<br />
/* ------------------ Header ------------------ */<br />
#logo {<br />
float: left; /* LTR */<br />
padding: 15px 15px 15px 10px; /* LTR */<br />
}<br />
#name-and-slogan {<br />
padding-top: 34px;<br />
margin: 0 0 10px 15px; /* LTR */<br />
}<br />
#site-name {<br />
color: #686868;<br />
font-size: 50px;<br />
text-align: center;<br />
margin: 10px 0 0 0;<br />
}<br />
h1#site-name {<br />
margin: 0;<br />
}<br />
#site-name a {<br />
font-weight: normal;<br />
}<br />
#site-slogan {<br />
font-size: 1.0;<br />
margin: 0;<br />
padding: 0;<br />
word-spacing: 0.1em;<br />
border: 0;<br />
text-align: center;<br />
}<br />
<br />
/* ------------------- Main ------------------- */<br />
<br />
#main {<br />
margin-top: 20px;<br />
margin-bottom: 0px;<br />
}<br />
<br />
/* ----------------- Content ------------------ */<br />
<br />
.content {<br />
margin-top: 10px;<br />
}<br />
h1#page-title {<br />
font-size: 2em;<br />
line-height: 1;<br />
margin-top: 0;<br />
}<br />
#igem-content h2 {<br />
margin-bottom: 2px;<br />
font-size: 1.429em;<br />
line-height: 1.4;<br />
}<br />
.igem-section,<br />
.one-sidebar #igem-content {<br />
padding: 13px;<br />
}<br />
#page .node .content,<br />
#page .view {<br />
font-size: 1.3em;<br />
}<br />
.node .content p,<br />
#page .view p,<br />
.front .block p {<br />
line-height: 1.1em;<br />
}<br />
.meta {<br />
font-size: 0.857em;<br />
color: #68696b;<br />
margin-bottom: -5px;<br />
}<br />
.submitted .user-picture img {<br />
float: left; /* LTR */<br />
height: 20px;<br />
margin: 1px 5px 0 0; /* LTR */<br />
}<br />
.link-wrapper {<br />
text-align: right;<br />
}<br />
.field-type-image img,<br />
.user-picture img {<br />
margin: 0 0 1em;<br />
}<br />
ul.links {<br />
color: #68696b;<br />
font-size: 0.821em;<br />
}<br />
.node-unpublished {<br />
margin: -20px -15px 0;<br />
padding: 20px 15px 0;<br />
}<br />
/* ------------------ Sidebar ----------------- */<br />
.sidebar .block {<br />
padding: 15px 20px;<br />
margin: 0 0 20px;<br />
}<br />
.sidebar h2 {<br />
margin: 0 0 0.5em;<br />
border-bottom: 1px solid #d6d6d6;<br />
padding-bottom: 5px;<br />
text-shadow: 0 1px 0 #fff;<br />
font-size: 1.071em;<br />
line-height: 1.2;<br />
}<br />
.sidebar .block .content {<br />
font-size: 0.914em;<br />
line-height: 1.4;<br />
}<br />
.sidebar tbody {<br />
border: none;<br />
}<br />
.sidebar tr.even,<br />
.sidebar tr.odd {<br />
background: none;<br />
border-bottom: 1px solid #d6d6d6;<br />
}<br />
<br />
/* ------------------ Footer ------------------ */<br />
<br />
#footer-wrapper {<br />
color: #c0c0c0;<br />
color: rgba(255, 255, 255, 0.65);<br />
font-size: 0.857em;<br />
background-color: #c0c0c0;<br />
}<br />
#footer-wrapper a {<br />
color: #fcfcfc;<br />
color: rgba(255, 255, 255, 0.8);<br />
}<br />
#footer-wrapper a:hover,<br />
#footer-wrapper a:focus {<br />
color: #fefefe;<br />
color: rgba(255, 255, 255, 0.95);<br />
text-decoration: underline;<br />
}<br />
#footer-wrapper .block {<br />
margin: 0;<br />
}<br />
#footer-columns .block-menu,<br />
#igem-footer .block {<br />
margin: 0;<br />
padding: 0;<br />
border: none;<br />
}<br />
#igem-footer .block .content {<br />
margin-top: 0;<br />
padding: 0;<br />
}<br />
#igem-footer .block h2 {<br />
margin: 0;<br />
}<br />
<br />
/* iGem Styles */<br />
#page-title {<br />
padding: 0;<br />
margin: 0;<br />
font-family: Helvetica;<br />
}<br />
<br />
#main-menu a {<br />
color: #707070;<br />
}<br />
#canvas {<br />
position: absolute;<br />
top: 0;<br />
left: 0;<br />
}<br />
<br />
.lightbox2-alt-layout #imageData #bottomNav, .lightbox2-alt-layout-data #bottomNav {<br />
margin-bottom: 0;<br />
}<br />
<br />
/* Bacteria & iGEMs Blocks */<br />
#page #block-block-2, #page #block-block-3 {<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
background: black;<br />
opacity:0.3;<br />
filter:alpha(opacity=30); /* For IE8 and earlier */<br />
position: absolute;<br />
z-index: 9999;<br />
}<br />
#block-block-2 .content,<br />
#block-block-3 .content p {<br />
padding: 10px;<br />
margin: 0;<br />
font-size: 10px;<br />
}<br />
#block-block-2 h2,<br />
#block-block-3 h2 {<br />
color: white;<br />
font-size: 12px;<br />
line-height: 12px;<br />
padding: 10px 10px 0 10px;<br />
margin: 0;<br />
border: 0;<br />
}<br />
<br />
/* Bacteria Stats Block */<br />
#block-block-2 {<br />
right: 150px;<br />
top: -150px;<br />
}<br />
#page #block-block-2:hover {<br />
top: 0;<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
#block-block-2 #bacteria {<br />
text-align: center;<br />
text-transform: uppercase;<br />
font-weight: bold;<br />
}<br />
#block-block-2 span.stat {<br />
display: block;<br />
margin: 0;<br />
padding: 0;<br />
font-size: 24px;<br />
font-weight: bold;<br />
}<br />
<br />
/* iGEM Block */<br />
#block-block-3 {<br />
right: 20px;<br />
top: -175px;<br />
width: 120px;<br />
}<br />
#block-block-3 img {<br />
width: 100px;<br />
}<br />
#page #block-block-3:hover {<br />
top: 10px;<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
<br />
<br />
/* Front page styles */<br />
<br />
div.front #main-inner {<br />
padding: 0;<br />
margin: 0;<br />
}<br />
div.front #main-inner .block {<br />
padding: 20px 20px 10px 20px;<br />
margin-bottom: 15px;<br />
}<br />
div.front #main-inner #block-block-6 {<br />
margin-bottom: 0;<br />
}<br />
#block-block-7 div.content {<br />
padding: 0;<br />
}<br />
<br />
#block-block-9,<br />
#block-block-4,<br />
#block-block-5 {<br />
width: 257px;<br />
margin-right: 10px;<br />
float: left;<br />
height: 270px;<br />
}<br />
#block-block-5 {<br />
margin-right: 0;<br />
clear: right;<br />
}<br />
#block-block-9 h2,<br />
#block-block-4 h2,<br />
#block-block-5 h2 {<br />
border: 0;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#block-block-6 {<br />
clear: both;<br />
font-size: 1.3em;<br />
margin-bottom: 0;<br />
}<br />
<br />
#block-block-9 li {<br />
list-style: none;<br />
text-align: center;<br />
}<br />
#block-block-9 img {<br />
border: solid black 1px;<br />
}<br />
<br />
#block-block-9 .more-link,<br />
#block-block-6 .more-link,<br />
#block-block-4 .more-link,<br />
#block-block-5 .more-link {<br />
font-size: 12px;<br />
padding: 5px 5px;<br />
margin: 0;<br />
margin-top: 10px;<br />
line-height: 14px;<br />
}<br />
<br />
<br />
/* News Block */<br />
span.homedate {<br />
background: black;<br />
color: white;<br />
display: block;<br />
-moz-border-radius: 0px 5px 5px 0px;<br />
border-radius: 0px 5px 5px 0px;<br />
margin: 0;<br />
padding: 0;<br />
height: 20px;<br />
text-align: center;<br />
font-size: 20px;<br />
font-weight: bold;<br />
float: left;<br />
padding: 5px;<br />
margin-right: 10px;<br />
}<br />
b.homedate {<br />
background-color: #757418;<br />
color: white;<br />
display: block;<br />
-moz-border-radius: 5px 5px 0px 0px;<br />
border-radius: 5px 5px 0px 0px;<br />
width: 30px;<br />
text-align: center;<br />
font-weight: normal;<br />
font-size: 11px;<br />
padding: 0;<br />
float: left;<br />
margin-top: 4px;<br />
margin-right: -4px;<br />
<br />
/* Safari */<br />
-webkit-transform: rotate(-90deg);<br />
<br />
/* Firefox */<br />
-moz-transform: rotate(-90deg);<br />
<br />
/* IE */<br />
-ms-transform: rotate(-90deg);<br />
<br />
/* Opera */<br />
-o-transform: rotate(-90deg);<br />
<br />
/* Internet Explorer */<br />
filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=3);<br />
}<br />
#block-block-4 li {<br />
list-style: none;<br />
clear: both;<br />
margin-bottom: 15px;<br />
vertical-align: center;<br />
font-size: 13px;<br />
}<br />
#block-block-4 li a,<br />
#block-block-4 li {<br />
color: #757418;<br />
text-decoration: underline;<br />
}<br />
#block-block-4 ul {<br />
padding: 0;<br />
}<br />
<br />
div.social {<br />
/* background: url('../images/trans-bg-white.png'); */<br />
/* border: solid black 2px; */<br />
background: white;<br />
border: solid black 2px;<br />
color: black;<br />
display: inline-block;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
padding: 15px; <br />
text-align: center;<br />
width: 152px;<br />
margin-right: 0px;<br />
/*<br />
opacity:0.5;<br />
filter:alpha(opacity=50); */<br />
-webkit-transition: all 0.5s ease; <br />
-moz-transition: all 0.5s ease; <br />
-ms-transition: all 0.5s ease; <br />
-o-transition: all 0.5s ease; <br />
transition: all 0.5s ease;<br />
height: 300px;<br />
margin-top: -25px;<br />
}<br />
div.social:hover {<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
div.social.last {<br />
margin-right: 0;<br />
}<br />
#block-block-7 p {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
div.social div.social-icon {<br />
<br />
}<br />
div.social div.social-icon img {<br />
width: 150px;<br />
height: 150px;<br />
margin-top: 5px;<br />
margin-bottom: 15px;<br />
opacity:0;<br />
filter:alpha(opacity=0); /* For IE8 and earlier */<br />
-webkit-transition: all 0.5s ease; <br />
-moz-transition: all 0.5s ease; <br />
-ms-transition: all 0.5s ease; <br />
-o-transition: all 0.5s ease; <br />
transition: all 0.5s ease;<br />
}<br />
div.social div.social-icon img:hover {<br />
opacity:.50;<br />
filter:alpha(opacity=50); /* For IE8 and earlier */<br />
}<br />
div.social#social-facebook {<br />
background: #fff url('../images/social/dark-face.png') center 20px no-repeat;<br />
}<br />
div.social#social-flikr {<br />
background: #fff url('../images/social/dark-flikr.png') center 20px no-repeat;<br />
}<br />
div.social#social-twitter {<br />
background: #fff url('../images/social/dark-twitter.png') center 20px no-repeat;<br />
}<br />
div.social#social-youtube {<br />
background: #fff url('../images/social/dark-youtube.png') center 20px no-repeat;<br />
}<br />
div.social#social-rss {<br />
background: #fff url('../images/social/dark-rss.png') center 20px no-repeat;<br />
}<br />
<br />
/* Nav Styles */<br />
<br />
/* --------------- Main Menu ------------ */<br />
<br />
#main-menu {<br />
height: 80px;<br />
overflow: hidden;<br />
padding: 0;<br />
text-align: center;<br />
width: 980px;<br />
z-index: 9999;<br />
}<br />
#main-menu-links {<br />
font-size: 0.929em;<br />
}<br />
#main-menu-links li {<br />
display: inline-block;<br />
list-style: none;<br />
padding: 0;<br />
margin: 0;<br />
text-align: left;<br />
}<br />
<br />
#main-menu-links a {<br />
opacity:0.1;<br />
filter:alpha(opacity=10); /* For IE8 and earlier */<br />
color: #333;<br />
float: left; /* LTR */<br />
width: 76px;<br />
overflow: hidden;<br />
height: 76px;<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
}<br />
#main-menu-links a span {<br />
margin-left: 80px;<br />
display: block;<br />
font-size: 11px;<br />
line-height: 12px;<br />
-moz-border-radius: 10px;<br />
border-radius: 10px;<br />
width: 88px;<br />
text-align: left;<br />
padding: 8px;<br />
height: 55px;<br />
}<br />
#main-menu-links a b {<br />
display: block;<br />
}<br />
#main-menu-links a:hover,<br />
#main-menu-links a:focus,<br />
#main-menu-links a.active {<br />
opacity:1.0;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
width: 190px;<br />
text-decoration: none;<br />
}<br />
#main-menu-links a:active,<br />
#main-menu-links a.active {<br />
opacity:1.0;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
<br />
/* Home */<br />
#main-menu-links li.menu-218 a {<br />
background: url('https://static.igem.org/mediawiki/2012/5/56/Aseatobacter-NAV-Home.png') left center no-repeat;<br />
}<br />
/* Team */<br />
#main-menu-links li.menu-388 a {<br />
background: url('https://static.igem.org/mediawiki/2012/7/73/Aseatobacter-NAV-Team.png') left center no-repeat;<br />
}<br />
/* Project */<br />
#main-menu-links li.menu-307 a {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d2/Aseatobacter-NAV-Project.png') left center no-repeat;<br />
}<br />
/* Parts */<br />
#main-menu-links li.menu-308 a {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Parts.png') left center no-repeat;<br />
}<br />
/* Modeling */<br />
#main-menu-links li.menu-310 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/ed/Aseatobacter-NAV-Modeling.png') left center no-repeat;<br />
}<br />
/* Notebook */<br />
#main-menu-links li.menu-584 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/e8/Aseatobacter-NAV-Notebook.png') left center no-repeat;<br />
}<br />
/* Safety */<br />
#main-menu-links li.menu-312 a {<br />
background: url('https://static.igem.org/mediawiki/2012/5/5f/Aseatobacter-NAV-Safety.png') left center no-repeat;<br />
}<br />
/* Attributions */<br />
#main-menu-links li.menu-313 a {<br />
background: url('https://static.igem.org/mediawiki/2012/c/c9/Aseatobacter-NAV-Attributions.png') left center no-repeat;<br />
}<br />
/* Profile */<br />
#main-menu-links li.menu-306 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/ea/Aseatobacter-NAV-Profile.png') left center no-repeat;<br />
}<br />
<br />
/* Page titles */<br />
div.page-team #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Small-Safety.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-5 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d5/Aseatobacter-NAV-Small-Modeling.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
/* Project */<br />
div.page-node-3 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/41/Aseatobacter-NAV-Small-Home.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-4 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/e/ea/Aseatobacter-NAV-Small-Parts.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-6 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/b/b7/Aseatobacter-NAV-Small-Notebook.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-7 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Small-Safety.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
/* Attributions */<br />
div.page-node-8 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/41/Aseatobacter-NAV-Small-Home.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
<br />
<br />
/* ---------- Color Module Styles ----------- */<br />
<br />
body,<br />
body.overlay {<br />
color: #C4C487;<br />
/* background-color: #9c9f7f; */<br />
background-color: #98986c;<br />
}<br />
.comment .comment-arrow {<br />
border-color: #393a2d;<br />
}<br />
#page,<br />
#main-wrapper {<br />
background: transparent;<br />
}<br />
<br />
.no-sidebars #main-inner,<br />
.one-sidebar #igem-content,<br />
div.front #main-inner .block {<br />
background: transparent url('https://static.igem.org/mediawiki/2012/c/cf/Aseatobacter-IMAGES-trans-bg.png');<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
border: solid black 2px;<br />
}<br />
<br />
div.front #main-inner #block-block-9,<br />
div.front #main-inner #block-block-4,<br />
div.front #main-inner #block-block-5 {<br />
/* background: transparent url('../images/trans-bg-white.png'); */<br />
background: white;<br />
color: black;<br />
}<br />
div.front #main-inner #block-block-9 a,<br />
div.front #main-inner #block-block-4 a,<br />
div.front #main-inner #block-block-5 a,<br />
#block-block-2 span.stat {<br />
color: #757418;<br />
}<br />
<br />
div.front.no-sidebars #main-inner {<br />
background: none;<br />
border: none;<br />
}<br />
#page .sidebar .block {<br />
background: #fff;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
border: solid black 2px;<br />
}<br />
<br />
#page .sidebar .block h2 {<br />
margin: 0;<br />
border: 0;<br />
padding: 0;<br />
font-size: 20px;<br />
}<br />
.no-sidebars #main-inner {<br />
padding: 0 20px;<br />
border: solid black 2px;<br />
}<br />
.igem-section {<br />
color: #e9e9c8;<br />
}<br />
.tabs ul.primary li a.active {<br />
background-color: #ffffff;<br />
}<br />
.tabs ul.primary li.active a {<br />
background-color: #ffffff;<br />
border-bottom: 1px solid #ffffff;<br />
}<br />
a, a:visited, a:active {<br />
color: #C4C487;<br />
}<br />
a:hover,<br />
a:focus {<br />
color: #fff;<br />
}<br />
a:active {<br />
color: #55540d;<br />
}<br />
<br />
#main-menu-links a span {<br />
border: solid black 2px;<br />
background: transparent url('https://static.igem.org/mediawiki/2012/c/cf/Aseatobacter-IMAGES-trans-bg.png');<br />
color: black;<br />
}<br />
<br />
#main-menu-links a span b {<br />
color: white;<br />
padding-bottom: 5px;<br />
font-size: 10px;<br />
}<br />
<br />
#page-wrapper,<br />
#footer-wrapper {<br />
background-color: transparent;<br />
}<br />
.region-header,<br />
.region-header a,<br />
.region-header li a.active,<br />
#name-and-slogan,<br />
#name-and-slogan a,<br />
#secondary-menu-links li a {<br />
color: #fffeff;<br />
}<br />
<br />
/* iGEMs Colors */<br />
#top-section #p-logo {<br />
background: transparent;<br />
color: #9c9f7f;<br />
border: none;<br />
}<br />
#top-section #menubar.right-menu a {<br />
background: none;<br />
color: #535445;<br />
}<br />
#top-section #menubar.right-menu a:hover {<br />
color: black;<br />
}<br />
#top-section #search-controls input {<br />
color: #535445;<br />
}<br />
#top-section #menubar.left-menu a {<br />
color: #535445;<br />
}<br />
#top-section #menubar.left-menu:hover {<br />
background: none;<br />
}<br />
#content {<br />
background: transparent;<br />
}<br />
#footer-box {<br />
background: #393a2d;<br />
border: solid #393a2d 1px;<br />
border-top: 0;<br />
}<br />
#footer-box a {<br />
color: #9c9f7f;<br />
}<br />
#page-title {<br />
color: #000;<br />
border: none;<br />
}<br />
#site-name a {<br />
color: black;<br />
}<br />
#site-name a:hover {<br />
text-decoration: none;<br />
}<br />
#site-slogan {<br />
color: #fff;<br />
}<br />
<br />
.field-name-field-photo img {<br />
border: solid black 1px;<br />
}<br />
#main .views-view-grid img.default-pic,<br />
.field-name-field-photo img.default-pic {<br />
border: none;<br />
}<br />
#main .views-view-grid td,<br />
#main .views-view-grid tr td,<br />
#main .views-view-grid tr th,<br />
#main table.views-view-grid {<br />
background: transparent;<br />
border: 0;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
}<br />
#main .views-view-grid img,<br />
#main .view-header img {<br />
border: solid black 1px;<br />
float: left;<br />
margin: 0 15px 15px 0;<br />
}<br />
.view-team h3 {<br />
color: black;<br />
}<br />
.view-team .views-label {<br />
font-size: 1.4em;<br />
color: #C4C487;<br />
}<br />
.view-team a.username {<br />
font-size: 22pt;<br />
color: white;<br />
}<br />
#main .view-team div.field-content {<br />
padding: 0;<br />
margin: 0;<br />
line-height: 20px;<br />
}<br />
.view-team td {<br />
width: 50%;<br />
height: 150px;<br />
vertical-align: top;<br />
}<br />
.aseato {<br />
color: black;<br />
font-size: 1.4em;<br />
}<br />
<br />
#top-main-menu {<br />
width: 100%;<br />
height: 30px;<br />
text-align: center;<br />
position: absolute;<br />
top: 0;<br />
left: 0;<br />
margin: 0;<br />
background: black;<br />
font-size: 15px;<br />
z-index: 10;<br />
}<br />
#top-main-menu li {<br />
display: inline-block;<br />
padding-right: 15px;<br />
}<br />
#top-main-menu li a {<br />
color: white;<br />
}<br />
#top-main-menu a:hover,<br />
#top-main-menu a.active {<br />
color: #757418;<br />
}<br />
<br />
#flickr-images li {<br />
list-style: none;<br />
display: inline-block;<br />
padding: 7px 9px;<br />
}<br />
#flickr-images li img {<br />
border: solid black 1px;<br />
}<br />
<br />
table a:link, table a:visited, table a:active {<br />
color: black;<br />
text-decoration: underline;<br />
}<br />
table a:hover {<br />
color: black;<br />
text-decoration: underline;<br />
}<br />
<br />
li {<br />
list-style-image: none;<br />
list-style-type: square;<br />
}<br />
<br />
li li {<br />
list-style-image: none;<br />
list-style-type: circle;<br />
}<br />
<br />
img.border {<br />
border: solid black 1px;<br />
}<br />
</style></nowiki><br />
</head><br />
</html></div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Templates/Styles
Team:NYU Gallatin/Templates/Styles
2012-10-03T05:55:53Z
<p>Sararobertson: </p>
<hr />
<div><html><br />
<head><br />
<nowiki><style><br />
/* Styles for the Wiki site */<br />
<br />
/* Neuropol Fonts */<br />
@font-face {<br />
font-family: neuropol;<br />
/* src: url('http://igem.melodramatic.com/sites/default/themes/igem/fonts/NEUROPOL.ttf'); */<br />
src: url('https://static.igem.org/mediawiki/2012/e/e6/Aseatobacter-FONT_NEUROPOL.txt');<br />
}<br />
.view-team h3,<br />
.view-team .views-label,<br />
.view-team span.username,<br />
.aseato,<br />
#page-title,<br />
#main-menu-links a span b,<br />
#page .sidebar .block h2,<br />
#block-block-9 h2,<br />
#block-block-4 h2,<br />
#block-block-5 h2,<br />
#block-block-2 span.stat,<br />
#site-slogan,<br />
#site-name {<br />
font-family: neuropol, "Courier New" !important;<br />
}<br />
<br />
/* Hidden Elements */<br />
#p-logo,<br />
#catlinks,<br />
#top-section #p-logo img,<br />
div.front #page-title,<br />
h1.firstHeading,<br />
#top-section, <br />
#footer-box,<br />
html.js .js-hide,<br />
#bodyContent p,<br />
.element-hidden {<br />
display: none;<br />
}<br />
<br />
#content {<br />
padding-top: 0 !important;<br />
}<br />
#content {<br />
padding: 0;<br />
}<br />
#bodyContent {<br />
padding: 0;<br />
margin: 0;<br />
}<br />
#bodyContent #page-wrapper p {<br />
display: block;<br />
}<br />
#header {<br />
}<br />
#page {<br />
font-size: 75%;<br />
}<br />
<br />
/* ---------- Basic Layout Styles ----------- */<br />
<br />
html,<br />
body,<br />
#page {<br />
height: 100%;<br />
}<br />
#content {<br />
width: 100%;<br />
}<br />
#page-wrapper {<br />
min-height: 100%;<br />
min-width: 950px;<br />
}<br />
#header div.section,<br />
#featured div.section,<br />
#messages div.section,<br />
#main,<br />
#triptych,<br />
#footer-columns {<br />
width: 950px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
}<br />
#header div.section {<br />
position: relative;<br />
}<br />
.region-header {<br />
float: right; /* LTR */<br />
margin: 0 5px 10px;<br />
}<br />
.with-secondary-menu .region-header {<br />
margin-top: 3em;<br />
}<br />
.without-secondary-menu .region-header {<br />
margin-top: 15px;<br />
}<br />
#secondary-menu {<br />
position: absolute;<br />
right: 0; /* LTR */<br />
top: 0;<br />
width: 480px;<br />
}<br />
#igem-content,<br />
#sidebar-first,<br />
#sidebar-second {<br />
display: inline;<br />
float: left; /* LTR */<br />
position: relative;<br />
}<br />
.one-sidebar #igem-content {<br />
width: 710px;<br />
}<br />
.two-sidebars #igem-content {<br />
width: 480px;<br />
}<br />
.no-sidebars #igem-content {<br />
width: 950px;<br />
float: none;<br />
}<br />
#sidebar-first,<br />
#sidebar-second {<br />
width: 210px;<br />
}<br />
#main-wrapper {<br />
min-height: 300px;<br />
}<br />
#igem-content .section,<br />
.sidebar .section {<br />
padding: 0 15px;<br />
}<br />
#footer-wrapper {<br />
padding: 0px 5px 0px;<br />
}<br />
.region-footer-firstcolumn,<br />
.region-footer-secondcolumn,<br />
.region-footer-thirdcolumn,<br />
.region-footer-fourthcolumn {<br />
padding: 0 10px;<br />
width: 220px;<br />
}<br />
<br />
#globalWrapper {<br />
z-index: 1;<br />
padding: 0px !important;<br />
}<br />
#contentSub {<br />
border: solid black 1px;<br />
}<br />
#canvas {<br />
position: fixed !important;<br />
top: 0 !important;<br />
left: 0 !important;<br />
}<br />
<br />
<br />
/**<br />
* Inline items.<br />
*/<br />
.container-inline div,<br />
.container-inline label {<br />
display: inline;<br />
}<br />
.container-inline .fieldset-wrapper {<br />
display: block;<br />
}<br />
.nowrap {<br />
white-space: nowrap;<br />
}<br />
<br />
.element-invisible {<br />
position: absolute !important;<br />
clip: rect(1px 1px 1px 1px); /* IE6, IE7 */<br />
clip: rect(1px, 1px, 1px, 1px);<br />
}<br />
.element-invisible.element-focusable:active,<br />
.element-invisible.element-focusable:focus {<br />
position: static !important;<br />
clip: auto;<br />
}<br />
<br />
/**<br />
* Markup free clearing.<br />
*<br />
* @see http://perishablepress.com/press/2009/12/06/new-clearfix-hack<br />
*/<br />
.clearfix:after {<br />
content: ".";<br />
display: block;<br />
height: 0;<br />
clear: both;<br />
visibility: hidden;<br />
}<br />
/* IE6 */<br />
* html .clearfix {<br />
height: 1%;<br />
}<br />
/* IE7 */<br />
*:first-child + html .clearfix {<br />
min-height: 1%;<br />
}<br />
<br />
<br />
/* ---------- Overall Specifications ---------- */<br />
<br />
body {<br />
line-height: 1.5;<br />
font-size: 100%;<br />
word-wrap: break-word;<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
outline: 0;<br />
font-family: "Helvetica";<br />
}<br />
#page, #main {<br />
font-family: "Helvetica";<br />
}<br />
a:link,<br />
a:visited {<br />
text-decoration: none;<br />
}<br />
a:hover,<br />
a:active,<br />
a:focus {<br />
text-decoration: underline;<br />
}<br />
tr.odd {<br />
background-color: #e8e9dc;<br />
}<br />
img {<br />
outline: 0;<br />
}<br />
<br />
/* ------------------ Fonts ------------------ */<br />
<br />
#header,<br />
#footer-wrapper,<br />
ul.contextual-links,<br />
ul.links,<br />
ul.primary,<br />
.item-list .pager,<br />
div.field-type-taxonomy-term-reference,<br />
div.messages,<br />
div.meta,<br />
p.comment-time,<br />
table,<br />
.breadcrumb {<br />
font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
}<br />
input,<br />
textarea,<br />
select,<br />
a.button {<br />
font-family: "Lucida Grande", "Lucida Sans Unicode", Verdana, sans-serif;<br />
}<br />
<br />
<br />
/* ------------------ Table Styles ------------------ */<br />
<br />
table {<br />
border: 0;<br />
border-spacing: 0;<br />
font-size: 0.7em;<br />
margin: 10px 0;<br />
width: 100%;<br />
border: solid #909268 1px;<br />
border-right: none;<br />
border-top: none;<br />
}<br />
table table {<br />
font-size: 1em;<br />
}<br />
#footer-wrapper table {<br />
font-size: 1em;<br />
}<br />
table tr th {<br />
background: #53561d;<br />
color: #fff;<br />
border-bottom-style: none;<br />
}<br />
table tr th,<br />
table tr th a,<br />
table tr th a:hover {<br />
color: #FFF;<br />
font-weight: bold;<br />
font-size: 0.9em;<br />
}<br />
table tbody tr th {<br />
vertical-align: top;<br />
}<br />
tr td,<br />
tr th {<br />
padding: 4px 9px;<br />
border: solid #909268 1px;<br />
border-left: none;<br />
border-bottom: none;<br />
text-align: left; /* LTR */<br />
vertical-align: top;<br />
}<br />
<br />
tr td.last,<br />
tr th {<br />
<br />
}<br />
#footer-wrapper tr td,<br />
#footer-wrapper tr th {<br />
border-color: #555;<br />
border-color: rgba(255, 255, 255, 0.18);<br />
}<br />
table ul.links {<br />
margin: 0;<br />
padding: 0;<br />
font-size: 1em;<br />
}<br />
table ul.links li {<br />
padding: 0 1em 0 0;<br />
}<br />
<br />
/* ------------------ List Styles ------------------ */<br />
<br />
.block ol,<br />
.block ul {<br />
margin: 0;<br />
padding: 0 0 0.25em 1em; /* LTR */<br />
}<br />
.contextual-links-wrapper {<br />
font-size: small !important;<br />
}<br />
ul.contextual-links {<br />
font-size: 0.923em;<br />
}<br />
.contextual-links-wrapper a {<br />
text-shadow: 0 0 0 !important;<br />
}<br />
.item-list .pager {<br />
font-size: 0.929em;<br />
}<br />
ul.menu li {<br />
margin: 0;<br />
list-style: none;<br />
}<br />
.region-content ul,<br />
.region-content ol {<br />
margin: 1em 0;<br />
padding: 0 0 0.25em 2.5em; /* LTR */<br />
}<br />
.item-list ul li {<br />
margin: 0;<br />
padding: 0.2em 0.5em 0 0; /* LTR */<br />
}<br />
ul.tips {<br />
padding: 0 0 0 1.25em; /* LTR */<br />
}<br />
#sidebar-first li a {<br />
color: black;<br />
}<br />
#sidebar-first li a:hover,<br />
#sidebar-first li a.active {<br />
color: #757418;<br />
text-decoration: underline;<br />
}<br />
<br />
/* ------------------ Header ------------------ */<br />
#logo {<br />
float: left; /* LTR */<br />
padding: 15px 15px 15px 10px; /* LTR */<br />
}<br />
#name-and-slogan {<br />
padding-top: 34px;<br />
margin: 0 0 10px 15px; /* LTR */<br />
}<br />
#site-name {<br />
color: #686868;<br />
font-size: 50px;<br />
text-align: center;<br />
margin: 10px 0 0 0;<br />
}<br />
h1#site-name {<br />
margin: 0;<br />
}<br />
#site-name a {<br />
font-weight: normal;<br />
}<br />
#site-slogan {<br />
font-size: 1.0;<br />
margin: 0;<br />
padding: 0;<br />
word-spacing: 0.1em;<br />
border: 0;<br />
text-align: center;<br />
}<br />
<br />
/* ------------------- Main ------------------- */<br />
<br />
#main {<br />
margin-top: 20px;<br />
margin-bottom: 0px;<br />
}<br />
<br />
/* ----------------- Content ------------------ */<br />
<br />
.content {<br />
margin-top: 10px;<br />
}<br />
h1#page-title {<br />
font-size: 2em;<br />
line-height: 1;<br />
margin-top: 0;<br />
}<br />
#igem-content h2 {<br />
margin-bottom: 2px;<br />
font-size: 1.429em;<br />
line-height: 1.4;<br />
}<br />
.igem-section,<br />
.one-sidebar #igem-content {<br />
padding: 13px;<br />
}<br />
#page .node .content,<br />
#page .view {<br />
font-size: 1.3em;<br />
}<br />
.node .content p,<br />
#page .view p,<br />
.front .block p {<br />
line-height: 1.1em;<br />
}<br />
.meta {<br />
font-size: 0.857em;<br />
color: #68696b;<br />
margin-bottom: -5px;<br />
}<br />
.submitted .user-picture img {<br />
float: left; /* LTR */<br />
height: 20px;<br />
margin: 1px 5px 0 0; /* LTR */<br />
}<br />
.link-wrapper {<br />
text-align: right;<br />
}<br />
.field-type-image img,<br />
.user-picture img {<br />
margin: 0 0 1em;<br />
}<br />
ul.links {<br />
color: #68696b;<br />
font-size: 0.821em;<br />
}<br />
.node-unpublished {<br />
margin: -20px -15px 0;<br />
padding: 20px 15px 0;<br />
}<br />
/* ------------------ Sidebar ----------------- */<br />
.sidebar .block {<br />
padding: 15px 20px;<br />
margin: 0 0 20px;<br />
}<br />
.sidebar h2 {<br />
margin: 0 0 0.5em;<br />
border-bottom: 1px solid #d6d6d6;<br />
padding-bottom: 5px;<br />
text-shadow: 0 1px 0 #fff;<br />
font-size: 1.071em;<br />
line-height: 1.2;<br />
}<br />
.sidebar .block .content {<br />
font-size: 0.914em;<br />
line-height: 1.4;<br />
}<br />
.sidebar tbody {<br />
border: none;<br />
}<br />
.sidebar tr.even,<br />
.sidebar tr.odd {<br />
background: none;<br />
border-bottom: 1px solid #d6d6d6;<br />
}<br />
<br />
/* ------------------ Footer ------------------ */<br />
<br />
#footer-wrapper {<br />
color: #c0c0c0;<br />
color: rgba(255, 255, 255, 0.65);<br />
font-size: 0.857em;<br />
background-color: #c0c0c0;<br />
}<br />
#footer-wrapper a {<br />
color: #fcfcfc;<br />
color: rgba(255, 255, 255, 0.8);<br />
}<br />
#footer-wrapper a:hover,<br />
#footer-wrapper a:focus {<br />
color: #fefefe;<br />
color: rgba(255, 255, 255, 0.95);<br />
text-decoration: underline;<br />
}<br />
#footer-wrapper .block {<br />
margin: 0;<br />
}<br />
#footer-columns .block-menu,<br />
#igem-footer .block {<br />
margin: 0;<br />
padding: 0;<br />
border: none;<br />
}<br />
#igem-footer .block .content {<br />
margin-top: 0;<br />
padding: 0;<br />
}<br />
#igem-footer .block h2 {<br />
margin: 0;<br />
}<br />
<br />
/* iGem Styles */<br />
#page-title {<br />
padding: 0;<br />
margin: 0;<br />
font-family: Helvetica;<br />
}<br />
<br />
#main-menu a {<br />
color: #707070;<br />
}<br />
#canvas {<br />
position: absolute;<br />
top: 0;<br />
left: 0;<br />
}<br />
<br />
.lightbox2-alt-layout #imageData #bottomNav, .lightbox2-alt-layout-data #bottomNav {<br />
margin-bottom: 0;<br />
}<br />
<br />
/* Bacteria & iGEMs Blocks */<br />
#page #block-block-2, #page #block-block-3 {<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
background: black;<br />
opacity:0.3;<br />
filter:alpha(opacity=30); /* For IE8 and earlier */<br />
position: absolute;<br />
z-index: 9999;<br />
}<br />
#block-block-2 .content,<br />
#block-block-3 .content p {<br />
padding: 10px;<br />
margin: 0;<br />
font-size: 10px;<br />
}<br />
#block-block-2 h2,<br />
#block-block-3 h2 {<br />
color: white;<br />
font-size: 12px;<br />
line-height: 12px;<br />
padding: 10px 10px 0 10px;<br />
margin: 0;<br />
border: 0;<br />
}<br />
<br />
/* Bacteria Stats Block */<br />
#block-block-2 {<br />
right: 150px;<br />
top: -150px;<br />
}<br />
#page #block-block-2:hover {<br />
top: 0;<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
#block-block-2 #bacteria {<br />
text-align: center;<br />
text-transform: uppercase;<br />
font-weight: bold;<br />
}<br />
#block-block-2 span.stat {<br />
display: block;<br />
margin: 0;<br />
padding: 0;<br />
font-size: 24px;<br />
font-weight: bold;<br />
}<br />
<br />
/* iGEM Block */<br />
#block-block-3 {<br />
right: 20px;<br />
top: -175px;<br />
width: 120px;<br />
}<br />
#block-block-3 img {<br />
width: 100px;<br />
}<br />
#page #block-block-3:hover {<br />
top: 10px;<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
<br />
<br />
/* Front page styles */<br />
<br />
div.front #main-inner {<br />
padding: 0;<br />
margin: 0;<br />
}<br />
div.front #main-inner .block {<br />
padding: 20px 20px 10px 20px;<br />
margin-bottom: 15px;<br />
}<br />
div.front #main-inner #block-block-6 {<br />
margin-bottom: 0;<br />
}<br />
#block-block-7 div.content {<br />
padding: 0;<br />
}<br />
<br />
#block-block-9,<br />
#block-block-4,<br />
#block-block-5 {<br />
width: 257px;<br />
margin-right: 10px;<br />
float: left;<br />
height: 270px;<br />
}<br />
#block-block-5 {<br />
margin-right: 0;<br />
clear: right;<br />
}<br />
#block-block-9 h2,<br />
#block-block-4 h2,<br />
#block-block-5 h2 {<br />
border: 0;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#block-block-6 {<br />
clear: both;<br />
font-size: 1.3em;<br />
margin-bottom: 0;<br />
}<br />
<br />
#block-block-9 li {<br />
list-style: none;<br />
text-align: center;<br />
}<br />
#block-block-9 img {<br />
border: solid black 1px;<br />
}<br />
<br />
#block-block-9 .more-link,<br />
#block-block-6 .more-link,<br />
#block-block-4 .more-link,<br />
#block-block-5 .more-link {<br />
font-size: 12px;<br />
padding: 5px 5px;<br />
margin: 0;<br />
margin-top: 10px;<br />
line-height: 14px;<br />
}<br />
<br />
<br />
/* News Block */<br />
span.homedate {<br />
background: black;<br />
color: white;<br />
display: block;<br />
-moz-border-radius: 0px 5px 5px 0px;<br />
border-radius: 0px 5px 5px 0px;<br />
margin: 0;<br />
padding: 0;<br />
height: 20px;<br />
text-align: center;<br />
font-size: 20px;<br />
font-weight: bold;<br />
float: left;<br />
padding: 5px;<br />
margin-right: 10px;<br />
}<br />
b.homedate {<br />
background-color: #757418;<br />
color: white;<br />
display: block;<br />
-moz-border-radius: 5px 5px 0px 0px;<br />
border-radius: 5px 5px 0px 0px;<br />
width: 30px;<br />
text-align: center;<br />
font-weight: normal;<br />
font-size: 11px;<br />
padding: 0;<br />
float: left;<br />
margin-top: 4px;<br />
margin-right: -4px;<br />
<br />
/* Safari */<br />
-webkit-transform: rotate(-90deg);<br />
<br />
/* Firefox */<br />
-moz-transform: rotate(-90deg);<br />
<br />
/* IE */<br />
-ms-transform: rotate(-90deg);<br />
<br />
/* Opera */<br />
-o-transform: rotate(-90deg);<br />
<br />
/* Internet Explorer */<br />
filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=3);<br />
}<br />
#block-block-4 li {<br />
list-style: none;<br />
clear: both;<br />
margin-bottom: 15px;<br />
vertical-align: center;<br />
font-size: 13px;<br />
}<br />
#block-block-4 li a,<br />
#block-block-4 li {<br />
color: #757418;<br />
text-decoration: underline;<br />
}<br />
#block-block-4 ul {<br />
padding: 0;<br />
}<br />
<br />
div.social {<br />
/* background: url('../images/trans-bg-white.png'); */<br />
/* border: solid black 2px; */<br />
background: white;<br />
border: solid black 2px;<br />
color: black;<br />
display: inline-block;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
padding: 15px; <br />
text-align: center;<br />
width: 152px;<br />
margin-right: 0px;<br />
/*<br />
opacity:0.5;<br />
filter:alpha(opacity=50); */<br />
-webkit-transition: all 0.5s ease; <br />
-moz-transition: all 0.5s ease; <br />
-ms-transition: all 0.5s ease; <br />
-o-transition: all 0.5s ease; <br />
transition: all 0.5s ease;<br />
height: 300px;<br />
margin-top: -25px;<br />
}<br />
div.social:hover {<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
div.social.last {<br />
margin-right: 0;<br />
}<br />
#block-block-7 p {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
div.social div.social-icon {<br />
<br />
}<br />
div.social div.social-icon img {<br />
width: 150px;<br />
height: 150px;<br />
margin-top: 5px;<br />
margin-bottom: 15px;<br />
opacity:0;<br />
filter:alpha(opacity=0); /* For IE8 and earlier */<br />
-webkit-transition: all 0.5s ease; <br />
-moz-transition: all 0.5s ease; <br />
-ms-transition: all 0.5s ease; <br />
-o-transition: all 0.5s ease; <br />
transition: all 0.5s ease;<br />
}<br />
div.social div.social-icon img:hover {<br />
opacity:.50;<br />
filter:alpha(opacity=50); /* For IE8 and earlier */<br />
}<br />
div.social#social-facebook {<br />
background: #fff url('../images/social/dark-face.png') center 20px no-repeat;<br />
}<br />
div.social#social-flikr {<br />
background: #fff url('../images/social/dark-flikr.png') center 20px no-repeat;<br />
}<br />
div.social#social-twitter {<br />
background: #fff url('../images/social/dark-twitter.png') center 20px no-repeat;<br />
}<br />
div.social#social-youtube {<br />
background: #fff url('../images/social/dark-youtube.png') center 20px no-repeat;<br />
}<br />
div.social#social-rss {<br />
background: #fff url('../images/social/dark-rss.png') center 20px no-repeat;<br />
}<br />
<br />
/* Nav Styles */<br />
<br />
/* --------------- Main Menu ------------ */<br />
<br />
#main-menu {<br />
height: 80px;<br />
overflow: hidden;<br />
padding: 0;<br />
text-align: center;<br />
width: 1000px;<br />
z-index: 9999;<br />
}<br />
#main-menu-links {<br />
font-size: 0.929em;<br />
}<br />
#main-menu-links li {<br />
display: inline-block;<br />
list-style: none;<br />
padding: 0;<br />
margin: 0;<br />
text-align: left;<br />
}<br />
<br />
#main-menu-links a {<br />
opacity:0.1;<br />
filter:alpha(opacity=10); /* For IE8 and earlier */<br />
color: #333;<br />
float: left; /* LTR */<br />
width: 76px;<br />
overflow: hidden;<br />
height: 76px;<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
}<br />
#main-menu-links a span {<br />
margin-left: 80px;<br />
display: block;<br />
font-size: 11px;<br />
line-height: 12px;<br />
-moz-border-radius: 10px;<br />
border-radius: 10px;<br />
width: 88px;<br />
text-align: left;<br />
padding: 8px;<br />
height: 55px;<br />
}<br />
#main-menu-links a b {<br />
display: block;<br />
}<br />
#main-menu-links a:hover,<br />
#main-menu-links a:focus,<br />
#main-menu-links a.active {<br />
opacity:1.0;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
width: 190px;<br />
text-decoration: none;<br />
}<br />
#main-menu-links a:active,<br />
#main-menu-links a.active {<br />
opacity:1.0;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
<br />
/* Home */<br />
#main-menu-links li.menu-218 a {<br />
background: url('https://static.igem.org/mediawiki/2012/5/56/Aseatobacter-NAV-Home.png') left center no-repeat;<br />
}<br />
/* Team */<br />
#main-menu-links li.menu-388 a {<br />
background: url('https://static.igem.org/mediawiki/2012/7/73/Aseatobacter-NAV-Team.png') left center no-repeat;<br />
}<br />
/* Project */<br />
#main-menu-links li.menu-307 a {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d2/Aseatobacter-NAV-Project.png') left center no-repeat;<br />
}<br />
/* Parts */<br />
#main-menu-links li.menu-308 a {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Parts.png') left center no-repeat;<br />
}<br />
/* Modeling */<br />
#main-menu-links li.menu-310 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/ed/Aseatobacter-NAV-Modeling.png') left center no-repeat;<br />
}<br />
/* Notebook */<br />
#main-menu-links li.menu-584 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/e8/Aseatobacter-NAV-Notebook.png') left center no-repeat;<br />
}<br />
/* Safety */<br />
#main-menu-links li.menu-312 a {<br />
background: url('https://static.igem.org/mediawiki/2012/5/5f/Aseatobacter-NAV-Safety.png') left center no-repeat;<br />
}<br />
/* Attributions */<br />
#main-menu-links li.menu-313 a {<br />
background: url('https://static.igem.org/mediawiki/2012/c/c9/Aseatobacter-NAV-Attributions.png') left center no-repeat;<br />
}<br />
/* Profile */<br />
#main-menu-links li.menu-306 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/ea/Aseatobacter-NAV-Profile.png') left center no-repeat;<br />
}<br />
<br />
/* Page titles */<br />
div.page-team #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Small-Safety.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-5 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d5/Aseatobacter-NAV-Small-Modeling.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
/* Project */<br />
div.page-node-3 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/41/Aseatobacter-NAV-Small-Home.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-4 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/e/ea/Aseatobacter-NAV-Small-Parts.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-6 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/b/b7/Aseatobacter-NAV-Small-Notebook.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-7 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Small-Safety.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
/* Attributions */<br />
div.page-node-8 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/41/Aseatobacter-NAV-Small-Home.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
<br />
<br />
/* ---------- Color Module Styles ----------- */<br />
<br />
body,<br />
body.overlay {<br />
color: #C4C487;<br />
/* background-color: #9c9f7f; */<br />
background-color: #98986c;<br />
}<br />
.comment .comment-arrow {<br />
border-color: #393a2d;<br />
}<br />
#page,<br />
#main-wrapper {<br />
background: transparent;<br />
}<br />
<br />
.no-sidebars #main-inner,<br />
.one-sidebar #igem-content,<br />
div.front #main-inner .block {<br />
background: transparent url('https://static.igem.org/mediawiki/2012/c/cf/Aseatobacter-IMAGES-trans-bg.png');<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
border: solid black 2px;<br />
}<br />
<br />
div.front #main-inner #block-block-9,<br />
div.front #main-inner #block-block-4,<br />
div.front #main-inner #block-block-5 {<br />
/* background: transparent url('../images/trans-bg-white.png'); */<br />
background: white;<br />
color: black;<br />
}<br />
div.front #main-inner #block-block-9 a,<br />
div.front #main-inner #block-block-4 a,<br />
div.front #main-inner #block-block-5 a,<br />
#block-block-2 span.stat {<br />
color: #757418;<br />
}<br />
<br />
div.front.no-sidebars #main-inner {<br />
background: none;<br />
border: none;<br />
}<br />
#page .sidebar .block {<br />
background: #fff;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
border: solid black 2px;<br />
}<br />
<br />
#page .sidebar .block h2 {<br />
margin: 0;<br />
border: 0;<br />
padding: 0;<br />
font-size: 20px;<br />
}<br />
.no-sidebars #main-inner {<br />
padding: 0 20px;<br />
border: solid black 2px;<br />
}<br />
.igem-section {<br />
color: #e9e9c8;<br />
}<br />
.tabs ul.primary li a.active {<br />
background-color: #ffffff;<br />
}<br />
.tabs ul.primary li.active a {<br />
background-color: #ffffff;<br />
border-bottom: 1px solid #ffffff;<br />
}<br />
a, a:visited, a:active {<br />
color: #C4C487;<br />
}<br />
a:hover,<br />
a:focus {<br />
color: #fff;<br />
}<br />
a:active {<br />
color: #55540d;<br />
}<br />
<br />
#main-menu-links a span {<br />
border: solid black 2px;<br />
background: transparent url('https://static.igem.org/mediawiki/2012/c/cf/Aseatobacter-IMAGES-trans-bg.png');<br />
color: black;<br />
}<br />
<br />
#main-menu-links a span b {<br />
color: white;<br />
padding-bottom: 5px;<br />
font-size: 10px;<br />
}<br />
<br />
#page-wrapper,<br />
#footer-wrapper {<br />
background-color: transparent;<br />
}<br />
.region-header,<br />
.region-header a,<br />
.region-header li a.active,<br />
#name-and-slogan,<br />
#name-and-slogan a,<br />
#secondary-menu-links li a {<br />
color: #fffeff;<br />
}<br />
<br />
/* iGEMs Colors */<br />
#top-section #p-logo {<br />
background: transparent;<br />
color: #9c9f7f;<br />
border: none;<br />
}<br />
#top-section #menubar.right-menu a {<br />
background: none;<br />
color: #535445;<br />
}<br />
#top-section #menubar.right-menu a:hover {<br />
color: black;<br />
}<br />
#top-section #search-controls input {<br />
color: #535445;<br />
}<br />
#top-section #menubar.left-menu a {<br />
color: #535445;<br />
}<br />
#top-section #menubar.left-menu:hover {<br />
background: none;<br />
}<br />
#content {<br />
background: transparent;<br />
}<br />
#footer-box {<br />
background: #393a2d;<br />
border: solid #393a2d 1px;<br />
border-top: 0;<br />
}<br />
#footer-box a {<br />
color: #9c9f7f;<br />
}<br />
#page-title {<br />
color: #000;<br />
border: none;<br />
}<br />
#site-name a {<br />
color: black;<br />
}<br />
#site-name a:hover {<br />
text-decoration: none;<br />
}<br />
#site-slogan {<br />
color: #fff;<br />
}<br />
<br />
.field-name-field-photo img {<br />
border: solid black 1px;<br />
}<br />
#main .views-view-grid img.default-pic,<br />
.field-name-field-photo img.default-pic {<br />
border: none;<br />
}<br />
#main .views-view-grid td,<br />
#main .views-view-grid tr td,<br />
#main .views-view-grid tr th,<br />
#main table.views-view-grid {<br />
background: transparent;<br />
border: 0;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
}<br />
#main .views-view-grid img,<br />
#main .view-header img {<br />
border: solid black 1px;<br />
float: left;<br />
margin: 0 15px 15px 0;<br />
}<br />
.view-team h3 {<br />
color: black;<br />
}<br />
.view-team .views-label {<br />
font-size: 1.4em;<br />
color: #C4C487;<br />
}<br />
.view-team a.username {<br />
font-size: 22pt;<br />
color: white;<br />
}<br />
#main .view-team div.field-content {<br />
padding: 0;<br />
margin: 0;<br />
line-height: 20px;<br />
}<br />
.view-team td {<br />
width: 50%;<br />
height: 150px;<br />
vertical-align: top;<br />
}<br />
.aseato {<br />
color: black;<br />
font-size: 1.4em;<br />
}<br />
<br />
#top-main-menu {<br />
width: 100%;<br />
height: 30px;<br />
text-align: center;<br />
position: absolute;<br />
top: 0;<br />
left: 0;<br />
margin: 0;<br />
background: black;<br />
font-size: 15px;<br />
z-index: 10;<br />
}<br />
#top-main-menu li {<br />
display: inline-block;<br />
padding-right: 15px;<br />
}<br />
#top-main-menu li a {<br />
color: white;<br />
}<br />
#top-main-menu a:hover,<br />
#top-main-menu a.active {<br />
color: #757418;<br />
}<br />
<br />
#flickr-images li {<br />
list-style: none;<br />
display: inline-block;<br />
padding: 7px 9px;<br />
}<br />
#flickr-images li img {<br />
border: solid black 1px;<br />
}<br />
<br />
table a:link, table a:visited, table a:active {<br />
color: black;<br />
text-decoration: underline;<br />
}<br />
table a:hover {<br />
color: black;<br />
text-decoration: underline;<br />
}<br />
<br />
li {<br />
list-style-image: none;<br />
list-style-type: square;<br />
}<br />
<br />
li li {<br />
list-style-image: none;<br />
list-style-type: circle;<br />
}<br />
<br />
img.border {<br />
border: solid black 1px;<br />
}<br />
</style></nowiki><br />
</head><br />
</html></div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Templates/Styles
Team:NYU Gallatin/Templates/Styles
2012-10-03T05:55:17Z
<p>Sararobertson: </p>
<hr />
<div><html><br />
<head><br />
<nowiki><style><br />
/* Styles for the Wiki site */<br />
<br />
/* Neuropol Fonts */<br />
@font-face {<br />
font-family: neuropol;<br />
/* src: url('http://igem.melodramatic.com/sites/default/themes/igem/fonts/NEUROPOL.ttf'); */<br />
src: url('https://static.igem.org/mediawiki/2012/e/e6/Aseatobacter-FONT_NEUROPOL.txt');<br />
}<br />
.view-team h3,<br />
.view-team .views-label,<br />
.view-team span.username,<br />
.aseato,<br />
#page-title,<br />
#main-menu-links a span b,<br />
#page .sidebar .block h2,<br />
#block-block-9 h2,<br />
#block-block-4 h2,<br />
#block-block-5 h2,<br />
#block-block-2 span.stat,<br />
#site-slogan,<br />
#site-name {<br />
font-family: neuropol, "Courier New" !important;<br />
}<br />
<br />
/* Hidden Elements */<br />
#p-logo,<br />
#catlinks,<br />
#top-section #p-logo img,<br />
div.front #page-title,<br />
h1.firstHeading,<br />
#top-section, <br />
#footer-box,<br />
html.js .js-hide,<br />
#bodyContent p,<br />
.element-hidden {<br />
display: none;<br />
}<br />
<br />
#content {<br />
padding-top: 0 !important;<br />
}<br />
#content {<br />
padding: 0;<br />
}<br />
#bodyContent {<br />
padding: 0;<br />
margin: 0;<br />
}<br />
#bodyContent #page-wrapper p {<br />
display: block;<br />
}<br />
#header {<br />
}<br />
#page {<br />
font-size: 75%;<br />
}<br />
<br />
/* ---------- Basic Layout Styles ----------- */<br />
<br />
html,<br />
body,<br />
#page {<br />
height: 100%;<br />
}<br />
#content {<br />
width: 100%;<br />
}<br />
#page-wrapper {<br />
min-height: 100%;<br />
min-width: 950px;<br />
}<br />
#header div.section,<br />
#featured div.section,<br />
#messages div.section,<br />
#main,<br />
#triptych,<br />
#footer-columns {<br />
width: 950px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
}<br />
#header div.section {<br />
position: relative;<br />
}<br />
.region-header {<br />
float: right; /* LTR */<br />
margin: 0 5px 10px;<br />
}<br />
.with-secondary-menu .region-header {<br />
margin-top: 3em;<br />
}<br />
.without-secondary-menu .region-header {<br />
margin-top: 15px;<br />
}<br />
#secondary-menu {<br />
position: absolute;<br />
right: 0; /* LTR */<br />
top: 0;<br />
width: 480px;<br />
}<br />
#igem-content,<br />
#sidebar-first,<br />
#sidebar-second {<br />
display: inline;<br />
float: left; /* LTR */<br />
position: relative;<br />
}<br />
.one-sidebar #igem-content {<br />
width: 710px;<br />
}<br />
.two-sidebars #igem-content {<br />
width: 480px;<br />
}<br />
.no-sidebars #igem-content {<br />
width: 950px;<br />
float: none;<br />
}<br />
#sidebar-first,<br />
#sidebar-second {<br />
width: 210px;<br />
}<br />
#main-wrapper {<br />
min-height: 300px;<br />
}<br />
#igem-content .section,<br />
.sidebar .section {<br />
padding: 0 15px;<br />
}<br />
#footer-wrapper {<br />
padding: 0px 5px 0px;<br />
}<br />
.region-footer-firstcolumn,<br />
.region-footer-secondcolumn,<br />
.region-footer-thirdcolumn,<br />
.region-footer-fourthcolumn {<br />
padding: 0 10px;<br />
width: 220px;<br />
}<br />
<br />
#globalWrapper {<br />
z-index: 1;<br />
padding: 0px !important;<br />
}<br />
#contentSub {<br />
border: solid black 1px;<br />
}<br />
#canvas {<br />
position: fixed !important;<br />
top: 0 !important;<br />
left: 0 !important;<br />
}<br />
<br />
<br />
/**<br />
* Inline items.<br />
*/<br />
.container-inline div,<br />
.container-inline label {<br />
display: inline;<br />
}<br />
.container-inline .fieldset-wrapper {<br />
display: block;<br />
}<br />
.nowrap {<br />
white-space: nowrap;<br />
}<br />
<br />
.element-invisible {<br />
position: absolute !important;<br />
clip: rect(1px 1px 1px 1px); /* IE6, IE7 */<br />
clip: rect(1px, 1px, 1px, 1px);<br />
}<br />
.element-invisible.element-focusable:active,<br />
.element-invisible.element-focusable:focus {<br />
position: static !important;<br />
clip: auto;<br />
}<br />
<br />
/**<br />
* Markup free clearing.<br />
*<br />
* @see http://perishablepress.com/press/2009/12/06/new-clearfix-hack<br />
*/<br />
.clearfix:after {<br />
content: ".";<br />
display: block;<br />
height: 0;<br />
clear: both;<br />
visibility: hidden;<br />
}<br />
/* IE6 */<br />
* html .clearfix {<br />
height: 1%;<br />
}<br />
/* IE7 */<br />
*:first-child + html .clearfix {<br />
min-height: 1%;<br />
}<br />
<br />
<br />
/* ---------- Overall Specifications ---------- */<br />
<br />
body {<br />
line-height: 1.5;<br />
font-size: 100%;<br />
word-wrap: break-word;<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
outline: 0;<br />
font-family: "Helvetica";<br />
}<br />
#page, #main {<br />
font-family: "Helvetica";<br />
}<br />
a:link,<br />
a:visited {<br />
text-decoration: none;<br />
}<br />
a:hover,<br />
a:active,<br />
a:focus {<br />
text-decoration: underline;<br />
}<br />
tr.odd {<br />
background-color: #e8e9dc;<br />
}<br />
img {<br />
outline: 0;<br />
}<br />
<br />
/* ------------------ Fonts ------------------ */<br />
<br />
#header,<br />
#footer-wrapper,<br />
ul.contextual-links,<br />
ul.links,<br />
ul.primary,<br />
.item-list .pager,<br />
div.field-type-taxonomy-term-reference,<br />
div.messages,<br />
div.meta,<br />
p.comment-time,<br />
table,<br />
.breadcrumb {<br />
font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
}<br />
input,<br />
textarea,<br />
select,<br />
a.button {<br />
font-family: "Lucida Grande", "Lucida Sans Unicode", Verdana, sans-serif;<br />
}<br />
<br />
<br />
/* ------------------ Table Styles ------------------ */<br />
<br />
table {<br />
border: 0;<br />
border-spacing: 0;<br />
font-size: 0.7em;<br />
margin: 10px 0;<br />
width: 100%;<br />
border: solid #909268 1px;<br />
border-right: none;<br />
border-top: none;<br />
}<br />
table table {<br />
font-size: 1em;<br />
}<br />
#footer-wrapper table {<br />
font-size: 1em;<br />
}<br />
table tr th {<br />
background: #53561d;<br />
color: #fff;<br />
border-bottom-style: none;<br />
}<br />
table tr th,<br />
table tr th a,<br />
table tr th a:hover {<br />
color: #FFF;<br />
font-weight: bold;<br />
font-size: 0.9em;<br />
}<br />
table tbody tr th {<br />
vertical-align: top;<br />
}<br />
tr td,<br />
tr th {<br />
padding: 4px 9px;<br />
border: solid #909268 1px;<br />
border-left: none;<br />
border-bottom: none;<br />
text-align: left; /* LTR */<br />
vertical-align: top;<br />
}<br />
<br />
tr td.last,<br />
tr th {<br />
<br />
}<br />
#footer-wrapper tr td,<br />
#footer-wrapper tr th {<br />
border-color: #555;<br />
border-color: rgba(255, 255, 255, 0.18);<br />
}<br />
table ul.links {<br />
margin: 0;<br />
padding: 0;<br />
font-size: 1em;<br />
}<br />
table ul.links li {<br />
padding: 0 1em 0 0;<br />
}<br />
<br />
/* ------------------ List Styles ------------------ */<br />
<br />
.block ol,<br />
.block ul {<br />
margin: 0;<br />
padding: 0 0 0.25em 1em; /* LTR */<br />
}<br />
.contextual-links-wrapper {<br />
font-size: small !important;<br />
}<br />
ul.contextual-links {<br />
font-size: 0.923em;<br />
}<br />
.contextual-links-wrapper a {<br />
text-shadow: 0 0 0 !important;<br />
}<br />
.item-list .pager {<br />
font-size: 0.929em;<br />
}<br />
ul.menu li {<br />
margin: 0;<br />
list-style: none;<br />
}<br />
.region-content ul,<br />
.region-content ol {<br />
margin: 1em 0;<br />
padding: 0 0 0.25em 2.5em; /* LTR */<br />
}<br />
.item-list ul li {<br />
margin: 0;<br />
padding: 0.2em 0.5em 0 0; /* LTR */<br />
}<br />
ul.tips {<br />
padding: 0 0 0 1.25em; /* LTR */<br />
}<br />
#sidebar-first li a {<br />
color: black;<br />
}<br />
#sidebar-first li a:hover,<br />
#sidebar-first li a.active {<br />
color: #757418;<br />
text-decoration: underline;<br />
}<br />
<br />
/* ------------------ Header ------------------ */<br />
#logo {<br />
float: left; /* LTR */<br />
padding: 15px 15px 15px 10px; /* LTR */<br />
}<br />
#name-and-slogan {<br />
padding-top: 34px;<br />
margin: 0 0 10px 15px; /* LTR */<br />
}<br />
#site-name {<br />
color: #686868;<br />
font-size: 50px;<br />
text-align: center;<br />
margin: 10px 0 0 0;<br />
}<br />
h1#site-name {<br />
margin: 0;<br />
}<br />
#site-name a {<br />
font-weight: normal;<br />
}<br />
#site-slogan {<br />
font-size: 1.0;<br />
margin: 0;<br />
padding: 0;<br />
word-spacing: 0.1em;<br />
border: 0;<br />
text-align: center;<br />
}<br />
<br />
/* ------------------- Main ------------------- */<br />
<br />
#main {<br />
margin-top: 20px;<br />
margin-bottom: 0px;<br />
}<br />
<br />
/* ----------------- Content ------------------ */<br />
<br />
.content {<br />
margin-top: 10px;<br />
}<br />
h1#page-title {<br />
font-size: 2em;<br />
line-height: 1;<br />
margin-top: 0;<br />
}<br />
#igem-content h2 {<br />
margin-bottom: 2px;<br />
font-size: 1.429em;<br />
line-height: 1.4;<br />
}<br />
.igem-section,<br />
.one-sidebar #igem-content {<br />
padding: 13px;<br />
}<br />
#page .node .content,<br />
#page .view {<br />
font-size: 1.3em;<br />
}<br />
.node .content p,<br />
#page .view p,<br />
.front .block p {<br />
line-height: 1.1em;<br />
}<br />
.meta {<br />
font-size: 0.857em;<br />
color: #68696b;<br />
margin-bottom: -5px;<br />
}<br />
.submitted .user-picture img {<br />
float: left; /* LTR */<br />
height: 20px;<br />
margin: 1px 5px 0 0; /* LTR */<br />
}<br />
.link-wrapper {<br />
text-align: right;<br />
}<br />
.field-type-image img,<br />
.user-picture img {<br />
margin: 0 0 1em;<br />
}<br />
ul.links {<br />
color: #68696b;<br />
font-size: 0.821em;<br />
}<br />
.node-unpublished {<br />
margin: -20px -15px 0;<br />
padding: 20px 15px 0;<br />
}<br />
/* ------------------ Sidebar ----------------- */<br />
.sidebar .block {<br />
padding: 15px 20px;<br />
margin: 0 0 20px;<br />
}<br />
.sidebar h2 {<br />
margin: 0 0 0.5em;<br />
border-bottom: 1px solid #d6d6d6;<br />
padding-bottom: 5px;<br />
text-shadow: 0 1px 0 #fff;<br />
font-size: 1.071em;<br />
line-height: 1.2;<br />
}<br />
.sidebar .block .content {<br />
font-size: 0.914em;<br />
line-height: 1.4;<br />
}<br />
.sidebar tbody {<br />
border: none;<br />
}<br />
.sidebar tr.even,<br />
.sidebar tr.odd {<br />
background: none;<br />
border-bottom: 1px solid #d6d6d6;<br />
}<br />
<br />
/* ------------------ Footer ------------------ */<br />
<br />
#footer-wrapper {<br />
color: #c0c0c0;<br />
color: rgba(255, 255, 255, 0.65);<br />
font-size: 0.857em;<br />
background-color: #c0c0c0;<br />
}<br />
#footer-wrapper a {<br />
color: #fcfcfc;<br />
color: rgba(255, 255, 255, 0.8);<br />
}<br />
#footer-wrapper a:hover,<br />
#footer-wrapper a:focus {<br />
color: #fefefe;<br />
color: rgba(255, 255, 255, 0.95);<br />
text-decoration: underline;<br />
}<br />
#footer-wrapper .block {<br />
margin: 0;<br />
}<br />
#footer-columns .block-menu,<br />
#igem-footer .block {<br />
margin: 0;<br />
padding: 0;<br />
border: none;<br />
}<br />
#igem-footer .block .content {<br />
margin-top: 0;<br />
padding: 0;<br />
}<br />
#igem-footer .block h2 {<br />
margin: 0;<br />
}<br />
<br />
/* iGem Styles */<br />
#page-title {<br />
padding: 0;<br />
margin: 0;<br />
font-family: Helvetica;<br />
}<br />
<br />
#main-menu a {<br />
color: #707070;<br />
}<br />
#canvas {<br />
position: absolute;<br />
top: 0;<br />
left: 0;<br />
}<br />
<br />
.lightbox2-alt-layout #imageData #bottomNav, .lightbox2-alt-layout-data #bottomNav {<br />
margin-bottom: 0;<br />
}<br />
<br />
/* Bacteria & iGEMs Blocks */<br />
#page #block-block-2, #page #block-block-3 {<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
background: black;<br />
opacity:0.3;<br />
filter:alpha(opacity=30); /* For IE8 and earlier */<br />
position: absolute;<br />
z-index: 9999;<br />
}<br />
#block-block-2 .content,<br />
#block-block-3 .content p {<br />
padding: 10px;<br />
margin: 0;<br />
font-size: 10px;<br />
}<br />
#block-block-2 h2,<br />
#block-block-3 h2 {<br />
color: white;<br />
font-size: 12px;<br />
line-height: 12px;<br />
padding: 10px 10px 0 10px;<br />
margin: 0;<br />
border: 0;<br />
}<br />
<br />
/* Bacteria Stats Block */<br />
#block-block-2 {<br />
right: 150px;<br />
top: -150px;<br />
}<br />
#page #block-block-2:hover {<br />
top: 0;<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
#block-block-2 #bacteria {<br />
text-align: center;<br />
text-transform: uppercase;<br />
font-weight: bold;<br />
}<br />
#block-block-2 span.stat {<br />
display: block;<br />
margin: 0;<br />
padding: 0;<br />
font-size: 24px;<br />
font-weight: bold;<br />
}<br />
<br />
/* iGEM Block */<br />
#block-block-3 {<br />
right: 20px;<br />
top: -175px;<br />
width: 120px;<br />
}<br />
#block-block-3 img {<br />
width: 100px;<br />
}<br />
#page #block-block-3:hover {<br />
top: 10px;<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
<br />
<br />
/* Front page styles */<br />
<br />
div.front #main-inner {<br />
padding: 0;<br />
margin: 0;<br />
}<br />
div.front #main-inner .block {<br />
padding: 20px 20px 10px 20px;<br />
margin-bottom: 15px;<br />
}<br />
div.front #main-inner #block-block-6 {<br />
margin-bottom: 0;<br />
}<br />
#block-block-7 div.content {<br />
padding: 0;<br />
}<br />
<br />
#block-block-9,<br />
#block-block-4,<br />
#block-block-5 {<br />
width: 257px;<br />
margin-right: 10px;<br />
float: left;<br />
height: 270px;<br />
}<br />
#block-block-5 {<br />
margin-right: 0;<br />
clear: right;<br />
}<br />
#block-block-9 h2,<br />
#block-block-4 h2,<br />
#block-block-5 h2 {<br />
border: 0;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#block-block-6 {<br />
clear: both;<br />
font-size: 1.3em;<br />
margin-bottom: 0;<br />
}<br />
<br />
#block-block-9 li {<br />
list-style: none;<br />
text-align: center;<br />
}<br />
#block-block-9 img {<br />
border: solid black 1px;<br />
}<br />
<br />
#block-block-9 .more-link,<br />
#block-block-6 .more-link,<br />
#block-block-4 .more-link,<br />
#block-block-5 .more-link {<br />
font-size: 12px;<br />
padding: 5px 5px;<br />
margin: 0;<br />
margin-top: 10px;<br />
line-height: 14px;<br />
}<br />
<br />
<br />
/* News Block */<br />
span.homedate {<br />
background: black;<br />
color: white;<br />
display: block;<br />
-moz-border-radius: 0px 5px 5px 0px;<br />
border-radius: 0px 5px 5px 0px;<br />
margin: 0;<br />
padding: 0;<br />
height: 20px;<br />
text-align: center;<br />
font-size: 20px;<br />
font-weight: bold;<br />
float: left;<br />
padding: 5px;<br />
margin-right: 10px;<br />
}<br />
b.homedate {<br />
background-color: #757418;<br />
color: white;<br />
display: block;<br />
-moz-border-radius: 5px 5px 0px 0px;<br />
border-radius: 5px 5px 0px 0px;<br />
width: 30px;<br />
text-align: center;<br />
font-weight: normal;<br />
font-size: 11px;<br />
padding: 0;<br />
float: left;<br />
margin-top: 4px;<br />
margin-right: -4px;<br />
<br />
/* Safari */<br />
-webkit-transform: rotate(-90deg);<br />
<br />
/* Firefox */<br />
-moz-transform: rotate(-90deg);<br />
<br />
/* IE */<br />
-ms-transform: rotate(-90deg);<br />
<br />
/* Opera */<br />
-o-transform: rotate(-90deg);<br />
<br />
/* Internet Explorer */<br />
filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=3);<br />
}<br />
#block-block-4 li {<br />
list-style: none;<br />
clear: both;<br />
margin-bottom: 15px;<br />
vertical-align: center;<br />
font-size: 13px;<br />
}<br />
#block-block-4 li a,<br />
#block-block-4 li {<br />
color: #757418;<br />
text-decoration: underline;<br />
}<br />
#block-block-4 ul {<br />
padding: 0;<br />
}<br />
<br />
div.social {<br />
/* background: url('../images/trans-bg-white.png'); */<br />
/* border: solid black 2px; */<br />
background: white;<br />
border: solid black 2px;<br />
color: black;<br />
display: inline-block;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
padding: 15px; <br />
text-align: center;<br />
width: 152px;<br />
margin-right: 0px;<br />
/*<br />
opacity:0.5;<br />
filter:alpha(opacity=50); */<br />
-webkit-transition: all 0.5s ease; <br />
-moz-transition: all 0.5s ease; <br />
-ms-transition: all 0.5s ease; <br />
-o-transition: all 0.5s ease; <br />
transition: all 0.5s ease;<br />
height: 300px;<br />
margin-top: -25px;<br />
}<br />
div.social:hover {<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
div.social.last {<br />
margin-right: 0;<br />
}<br />
#block-block-7 p {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
div.social div.social-icon {<br />
<br />
}<br />
div.social div.social-icon img {<br />
width: 150px;<br />
height: 150px;<br />
margin-top: 5px;<br />
margin-bottom: 15px;<br />
opacity:0;<br />
filter:alpha(opacity=0); /* For IE8 and earlier */<br />
-webkit-transition: all 0.5s ease; <br />
-moz-transition: all 0.5s ease; <br />
-ms-transition: all 0.5s ease; <br />
-o-transition: all 0.5s ease; <br />
transition: all 0.5s ease;<br />
}<br />
div.social div.social-icon img:hover {<br />
opacity:.50;<br />
filter:alpha(opacity=50); /* For IE8 and earlier */<br />
}<br />
div.social#social-facebook {<br />
background: #fff url('../images/social/dark-face.png') center 20px no-repeat;<br />
}<br />
div.social#social-flikr {<br />
background: #fff url('../images/social/dark-flikr.png') center 20px no-repeat;<br />
}<br />
div.social#social-twitter {<br />
background: #fff url('../images/social/dark-twitter.png') center 20px no-repeat;<br />
}<br />
div.social#social-youtube {<br />
background: #fff url('../images/social/dark-youtube.png') center 20px no-repeat;<br />
}<br />
div.social#social-rss {<br />
background: #fff url('../images/social/dark-rss.png') center 20px no-repeat;<br />
}<br />
<br />
/* Nav Styles */<br />
<br />
/* --------------- Main Menu ------------ */<br />
<br />
#main-menu {<br />
height: 80px;<br />
overflow: hidden;<br />
padding: 0;<br />
text-align: center;<br />
width: 960px;<br />
z-index: 9999;<br />
}<br />
#main-menu-links {<br />
font-size: 0.929em;<br />
}<br />
#main-menu-links li {<br />
display: inline-block;<br />
list-style: none;<br />
padding: 0;<br />
margin: 0;<br />
text-align: left;<br />
}<br />
<br />
#main-menu-links a {<br />
opacity:0.1;<br />
filter:alpha(opacity=10); /* For IE8 and earlier */<br />
color: #333;<br />
float: left; /* LTR */<br />
width: 76px;<br />
overflow: hidden;<br />
height: 76px;<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
}<br />
#main-menu-links a span {<br />
margin-left: 80px;<br />
display: block;<br />
font-size: 11px;<br />
line-height: 12px;<br />
-moz-border-radius: 10px;<br />
border-radius: 10px;<br />
width: 88px;<br />
text-align: left;<br />
padding: 8px;<br />
height: 55px;<br />
}<br />
#main-menu-links a b {<br />
display: block;<br />
}<br />
#main-menu-links a:hover,<br />
#main-menu-links a:focus,<br />
#main-menu-links a.active {<br />
opacity:1.0;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
width: 190px;<br />
text-decoration: none;<br />
}<br />
#main-menu-links a:active,<br />
#main-menu-links a.active {<br />
opacity:1.0;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
<br />
/* Home */<br />
#main-menu-links li.menu-218 a {<br />
background: url('https://static.igem.org/mediawiki/2012/5/56/Aseatobacter-NAV-Home.png') left center no-repeat;<br />
}<br />
/* Team */<br />
#main-menu-links li.menu-388 a {<br />
background: url('https://static.igem.org/mediawiki/2012/7/73/Aseatobacter-NAV-Team.png') left center no-repeat;<br />
}<br />
/* Project */<br />
#main-menu-links li.menu-307 a {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d2/Aseatobacter-NAV-Project.png') left center no-repeat;<br />
}<br />
/* Parts */<br />
#main-menu-links li.menu-308 a {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Parts.png') left center no-repeat;<br />
}<br />
/* Modeling */<br />
#main-menu-links li.menu-310 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/ed/Aseatobacter-NAV-Modeling.png') left center no-repeat;<br />
}<br />
/* Notebook */<br />
#main-menu-links li.menu-584 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/e8/Aseatobacter-NAV-Notebook.png') left center no-repeat;<br />
}<br />
/* Safety */<br />
#main-menu-links li.menu-312 a {<br />
background: url('https://static.igem.org/mediawiki/2012/5/5f/Aseatobacter-NAV-Safety.png') left center no-repeat;<br />
}<br />
/* Attributions */<br />
#main-menu-links li.menu-313 a {<br />
background: url('https://static.igem.org/mediawiki/2012/c/c9/Aseatobacter-NAV-Attributions.png') left center no-repeat;<br />
}<br />
/* Profile */<br />
#main-menu-links li.menu-306 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/ea/Aseatobacter-NAV-Profile.png') left center no-repeat;<br />
}<br />
<br />
/* Page titles */<br />
div.page-team #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Small-Safety.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-5 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d5/Aseatobacter-NAV-Small-Modeling.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
/* Project */<br />
div.page-node-3 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/41/Aseatobacter-NAV-Small-Home.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-4 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/e/ea/Aseatobacter-NAV-Small-Parts.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-6 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/b/b7/Aseatobacter-NAV-Small-Notebook.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-7 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Small-Safety.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
/* Attributions */<br />
div.page-node-8 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/41/Aseatobacter-NAV-Small-Home.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
<br />
<br />
/* ---------- Color Module Styles ----------- */<br />
<br />
body,<br />
body.overlay {<br />
color: #C4C487;<br />
/* background-color: #9c9f7f; */<br />
background-color: #98986c;<br />
}<br />
.comment .comment-arrow {<br />
border-color: #393a2d;<br />
}<br />
#page,<br />
#main-wrapper {<br />
background: transparent;<br />
}<br />
<br />
.no-sidebars #main-inner,<br />
.one-sidebar #igem-content,<br />
div.front #main-inner .block {<br />
background: transparent url('https://static.igem.org/mediawiki/2012/c/cf/Aseatobacter-IMAGES-trans-bg.png');<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
border: solid black 2px;<br />
}<br />
<br />
div.front #main-inner #block-block-9,<br />
div.front #main-inner #block-block-4,<br />
div.front #main-inner #block-block-5 {<br />
/* background: transparent url('../images/trans-bg-white.png'); */<br />
background: white;<br />
color: black;<br />
}<br />
div.front #main-inner #block-block-9 a,<br />
div.front #main-inner #block-block-4 a,<br />
div.front #main-inner #block-block-5 a,<br />
#block-block-2 span.stat {<br />
color: #757418;<br />
}<br />
<br />
div.front.no-sidebars #main-inner {<br />
background: none;<br />
border: none;<br />
}<br />
#page .sidebar .block {<br />
background: #fff;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
border: solid black 2px;<br />
}<br />
<br />
#page .sidebar .block h2 {<br />
margin: 0;<br />
border: 0;<br />
padding: 0;<br />
font-size: 20px;<br />
}<br />
.no-sidebars #main-inner {<br />
padding: 0 20px;<br />
border: solid black 2px;<br />
}<br />
.igem-section {<br />
color: #e9e9c8;<br />
}<br />
.tabs ul.primary li a.active {<br />
background-color: #ffffff;<br />
}<br />
.tabs ul.primary li.active a {<br />
background-color: #ffffff;<br />
border-bottom: 1px solid #ffffff;<br />
}<br />
a, a:visited, a:active {<br />
color: #C4C487;<br />
}<br />
a:hover,<br />
a:focus {<br />
color: #fff;<br />
}<br />
a:active {<br />
color: #55540d;<br />
}<br />
<br />
#main-menu-links a span {<br />
border: solid black 2px;<br />
background: transparent url('https://static.igem.org/mediawiki/2012/c/cf/Aseatobacter-IMAGES-trans-bg.png');<br />
color: black;<br />
}<br />
<br />
#main-menu-links a span b {<br />
color: white;<br />
padding-bottom: 5px;<br />
font-size: 10px;<br />
}<br />
<br />
#page-wrapper,<br />
#footer-wrapper {<br />
background-color: transparent;<br />
}<br />
.region-header,<br />
.region-header a,<br />
.region-header li a.active,<br />
#name-and-slogan,<br />
#name-and-slogan a,<br />
#secondary-menu-links li a {<br />
color: #fffeff;<br />
}<br />
<br />
/* iGEMs Colors */<br />
#top-section #p-logo {<br />
background: transparent;<br />
color: #9c9f7f;<br />
border: none;<br />
}<br />
#top-section #menubar.right-menu a {<br />
background: none;<br />
color: #535445;<br />
}<br />
#top-section #menubar.right-menu a:hover {<br />
color: black;<br />
}<br />
#top-section #search-controls input {<br />
color: #535445;<br />
}<br />
#top-section #menubar.left-menu a {<br />
color: #535445;<br />
}<br />
#top-section #menubar.left-menu:hover {<br />
background: none;<br />
}<br />
#content {<br />
background: transparent;<br />
}<br />
#footer-box {<br />
background: #393a2d;<br />
border: solid #393a2d 1px;<br />
border-top: 0;<br />
}<br />
#footer-box a {<br />
color: #9c9f7f;<br />
}<br />
#page-title {<br />
color: #000;<br />
border: none;<br />
}<br />
#site-name a {<br />
color: black;<br />
}<br />
#site-name a:hover {<br />
text-decoration: none;<br />
}<br />
#site-slogan {<br />
color: #fff;<br />
}<br />
<br />
.field-name-field-photo img {<br />
border: solid black 1px;<br />
}<br />
#main .views-view-grid img.default-pic,<br />
.field-name-field-photo img.default-pic {<br />
border: none;<br />
}<br />
#main .views-view-grid td,<br />
#main .views-view-grid tr td,<br />
#main .views-view-grid tr th,<br />
#main table.views-view-grid {<br />
background: transparent;<br />
border: 0;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
}<br />
#main .views-view-grid img,<br />
#main .view-header img {<br />
border: solid black 1px;<br />
float: left;<br />
margin: 0 15px 15px 0;<br />
}<br />
.view-team h3 {<br />
color: black;<br />
}<br />
.view-team .views-label {<br />
font-size: 1.4em;<br />
color: #C4C487;<br />
}<br />
.view-team a.username {<br />
font-size: 22pt;<br />
color: white;<br />
}<br />
#main .view-team div.field-content {<br />
padding: 0;<br />
margin: 0;<br />
line-height: 20px;<br />
}<br />
.view-team td {<br />
width: 50%;<br />
height: 150px;<br />
vertical-align: top;<br />
}<br />
.aseato {<br />
color: black;<br />
font-size: 1.4em;<br />
}<br />
<br />
#top-main-menu {<br />
width: 100%;<br />
height: 30px;<br />
text-align: center;<br />
position: absolute;<br />
top: 0;<br />
left: 0;<br />
margin: 0;<br />
background: black;<br />
font-size: 15px;<br />
z-index: 10;<br />
}<br />
#top-main-menu li {<br />
display: inline-block;<br />
padding-right: 15px;<br />
}<br />
#top-main-menu li a {<br />
color: white;<br />
}<br />
#top-main-menu a:hover,<br />
#top-main-menu a.active {<br />
color: #757418;<br />
}<br />
<br />
#flickr-images li {<br />
list-style: none;<br />
display: inline-block;<br />
padding: 7px 9px;<br />
}<br />
#flickr-images li img {<br />
border: solid black 1px;<br />
}<br />
<br />
table a:link, table a:visited, table a:active {<br />
color: black;<br />
text-decoration: underline;<br />
}<br />
table a:hover {<br />
color: black;<br />
text-decoration: underline;<br />
}<br />
<br />
li {<br />
list-style-image: none;<br />
list-style-type: square;<br />
}<br />
<br />
li li {<br />
list-style-image: none;<br />
list-style-type: circle;<br />
}<br />
<br />
img.border {<br />
border: solid black 1px;<br />
}<br />
</style></nowiki><br />
</head><br />
</html></div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Notebook
Team:NYU Gallatin/Notebook
2012-10-03T05:54:03Z
<p>Sararobertson: </p>
<hr />
<div>{{:Team:NYU_Gallatin/Templates/Styles}}<br />
<html><body><br />
<div class="html not-front not-logged-in one-sidebar sidebar-first page-notebook" ><br />
<div id="top-main-menu" class="navigation"><br />
<h2 class="element-invisible">Main menu</h2><ul id="top-main-menu-links" class="links clearfix"><li class="menu-218 first"><a href="/Team:NYU_Gallatin/" title="Home of Aseatobacter.">Home</a></li><br />
<li class="menu-388"><a href="/Team:NYU_Gallatin/Team" title="The brains of the operation.">Team</a></li><br />
<li class="menu-307"><a href="/Team:NYU_Gallatin/Project" title="Learn more about our project.">Project</a></li><br />
<li class="menu-308"><a href="/Team:NYU_Gallatin/Parts" title="Our work with the parts registry.">Parts</a></li><br />
<li class="menu-310"><a href="/Team:NYU_Gallatin/Modeling" title="How we put it all together.">Modeling</a></li><br />
<li class="menu-584 active-trail active"><a href="/Team:NYU_Gallatin/Notebook" title="Lab notebooks, news, and photos." class="active-trail active">Notebook</a></li><br />
<li class="menu-312"><a href="/Team:NYU_Gallatin/Safety" title="Our commitment to safety.">Safety</a></li><br />
<li class="menu-313"><a href="/Team:NYU_Gallatin/Attributions" title="Give credit where credit is due.">Attributions</a></li><br />
<li class="menu-306 last"><a href="https://igem.org/Team.cgi?year=2012&team_name=NYU_Gallatin" title="Official iGEM 2012 profile.">Profile</a></li><br />
</ul></div> <!-- /#main-menu --><br />
<div id="page-wrapper"><div id="page"><br />
<br />
</html><br />
{{:Team:NYU_Gallatin/Templates/Header_Notebook}}<br />
<html><nowiki><br />
<br />
<div id="main-wrapper" class="clearfix"><div id="main" class="clearfix"><div id="main-inner"><br />
<div id="sidebar-first" class="column sidebar"><div class="section"><br />
<div class="region region-sidebar-first"><br />
<div id="block-menu-menu-notebook" class="block block-menu"><br />
<br />
<h2>Take Notes</h2><br />
<br />
<div class="content"><br />
<ul class="menu clearfix"><li class="first leaf active-trail"><a href="/Team:NYU_Gallatin/Notebook" title="" class="active-trail active">Notebook</a></li><br />
<li class="leaf"><a href="/Team:NYU_Gallatin/Notebook/Photos" title="">Photos</a></li><br />
<li class="last leaf"><a href="/Team:NYU_Gallatin/Notebook/Videos" title="">Videos</a></li><br />
</ul> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#sidebar-first --><br />
<div id="igem-content" class="column"><div class="igem-section"><br />
<h1 class="title" id="page-title">Lab Notes</h1><br />
<div class="tabs"></div><br />
<div class="region region-content"><br />
<div id="block-system-main" class="block block-system"><br />
<br />
<br />
<div class="content"><br />
<div class="view view-lab-notes view-id-lab_notes view-display-id-page view-dom-id-db3537decea2494a256d1a48b671dd2d"><br />
<br />
<br />
<br />
<div class="view-content"><br />
<table class="views-table cols-3" ><br />
<thead><br />
<tr><br />
<th class="views-field views-field-field-sub-team" ><br />
Team </th><br />
<th class="views-field views-field-created" ><br />
Date </th><br />
<th class="views-field views-field-body" ><br />
Note </th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr class="odd views-row-first"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/26/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Biobrick cloning:</p><br />
<p>I used the purified DNA pieces from 8.22.12 that Steven and Min purified (they’ve been at -20C so they should be okay). </p><br />
<p>Alkaline phosphatase the A-backbone:</p><br />
<p>10 uL DNA<br /><br />
4 uL sterile H2O<br /><br />
4 uL 10x buffer<br /><br />
2 ul alk phos enzyme<br /><br />
20 ul total</p><br />
<p>3’ overhangs require 15 min incubation at 37C (5’ overhangs require 60 min). SpeI leaves 3’ overhangs. Incubate 15 min at 37C...actually 45 min because the water bath isn’t up to inactivation temp.<br /><br />
Heat inactivate the enzyme 5 min at 65C.</p><br />
<p>Ligate: </p><br />
<p>2 uL A-pSC1C3<br /><br />
4 uL N<br /><br />
2 uL H2O<br /><br />
1 uL 10X ligase buffer<br /><br />
1 uL ligase<br /><br />
10 uL total</p><br />
<p>Also set up one ligation without insert (no N). Make up the volume with water so total is still 10 uL.</p><br />
<p>Incubate 1 h at RT. </p><br />
<p>Transform by heat shock transformation protocol into commercially competent DH5alpha cells. 2 transformation: one with 2 ul ligation, one with 8 ul ligation. Plate on LB-chlor plates. Incubate at 37C overnight.</p><br />
<p>During this time, we purified the DNA digested yesterday. We will ligate tomorrow using this DNA if today’s transformation is unsuccessful.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Alex<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/25/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The following PCR conditions did not work:</p><br />
<p>Reducing the primer:template ratio 10x<br /><br />
Increasing the primer:template ratio 10x<br /><br />
Setting the annealing temp to 57C or 60C<br /><br />
Lowering the annealing temp to 45C for 2 cycles and 50C for the remaining 30 cycles.<br /><br />
The primers are probably not good. </p><br />
<p>More NAG1 and UAP1 DNA inserts were liberated with SpeI and PstI. Plasmid containing A was linearized with SpeI. </p><br />
<p><img src="http://farm9.staticflickr.com/8033/8049412231_f44c508082_n.jpg" /></p><br />
<p>The correct pieces of DNA (circled) were cut out and put in the freezer, to be purified later</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/19/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>We filled 2 more molds, 10R and unknown. Our biggest problem so far is cracks and holes; its unknown the best way to do it, as the tape might be the reason for contamination. Temp: 29.5</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Jesse<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/19/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Restriction Enzyme Digest #2 (re-run):<br /><br />
Increasing amount of DNA from 10ul to 15ul</p><br />
<p>15ul DNA<br /><br />
2ul NEBuffer 2<br /><br />
1ul BSA<br /><br />
1ul EcoRI<br /><br />
1ul PstI<br /><br />
20ul Total</p><br />
<p>Reaction ran for 30+ minutes.</p><br />
<p>Gel Electrophoresis:<br /><br />
For loading dye, using only bromophenol blue (runs at 500bp)<br /><br />
Running on 7% gel: 1.05g agarose for 150ml volume TAE</p><br />
<p>2ul of 10x Bromophenol Blue loading dye<br /><br />
20ul of DNA<br /><br />
mix, total in each lane = 20ul<br /><br />
Set to run for 30 minutes.</p><br />
<p>Same results as yesterday.</p><br />
<p>Made 4ml cultures of new colonies: clones #16-22 are in the incubator at 11:40pm along with a neg. growth control tube..</p><br />
<p>PCR with A gene is running.</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/18/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>No growth in colonies 3, 4, 7, and negative control for growth.<br /><br />
Ellen did plasmid minipreps of colonies 1, 2, 5, 6, 8 - 15.</p><br />
<p>Restriction Digest (12 plasmid preps total) with EcoR1 and Pst1 was run at 37*C at 9:45pm for 30 minutes.</p><br />
<p>Master Cocktail (13):<br /><br />
52ul H2O<br /><br />
13ul PstI<br /><br />
13ul EcoRI-HF<br /><br />
26ul 10x NEBuffer 2<br /><br />
26ul 10x BSA<br /><br />
TOTAL = 130ul</p><br />
<p>10ul of cocktail mix and 10ul of DNA were combined.</p><br />
<p>RE digest products were run on a 1% gel for 40 minutes to see if an insert of 4kb comes out of the 2kb pSB1C3:</p><br />
<p>20ul DNA digest product<br /><br />
2ul of 10x bromophenol blue + xylene cyanol dye.<br /><br />
Mixed and loaded 20ul in each lane.</p><br />
<p>Lane 1: 10ul 1kb PLUS ladder<br /><br />
Lane 2: 20ul of colony 1<br /><br />
Lane 3: 20ul of colony 2<br /><br />
Lane 4: 20ul of colony 5<br /><br />
Lane 5: 20ul of colony 6<br /><br />
Lane 6: 20ul of colony 8<br /><br />
Lane 7: 20ul of colony 9<br /><br />
Lane 8: 20ul of colony 10<br /><br />
Lane 9: 20ul of colony 11<br /><br />
Lane 10: 20ul of colony 12<br /><br />
Lane 11: 20ul of colony 13<br /><br />
Lane 12: 20ul of colony 14<br /><br />
Lane 13: 20ul of colony 15</p><br />
<p>Results:</p><br />
<p><img src="http://farm9.staticflickr.com/8176/8049402211_63b5a9d244_m.jpg" /></p><br />
<p>Cannot see 4kb insert in any lanes, and can see 2kb backbone in lanes 13, 14, 15.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/17/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Two more molds were contaminated, but there are solid growths on both the tubes and most molds. We filled four but unfortunately, we ran out of substrates and the autoclave was malfunctioning. Temp in incubator lowered to 29C</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Ellen<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/17/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Both plates showed colony growth, with Gibson Construct plate #1 (higher dilution) showing more growth than Gibson Construct plate #2 (lower dilution).<br /><br />
Negative control (E. coli no plasmid) showed no growth.</p><br />
<p>Made Chlor LB broth media:<br /><br />
250ml LB<br /><br />
184ul stock Chloramphenicol per 50ml</p><br />
<p>Picked 15 colonies and grew overnight in 4ml culture tubes<br /><br />
Used older LB broth in fridge. Poured one negative control for growth.<br /><br />
All in incubator at 37*C overnight.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/16/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Transformed E. coli with Gibson construct were plated onto two plates (see Ellen re: dilution)</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Sep/15/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>PCR Purification (A, N, U)<br /><br />
(Invitrogen)</p><br />
<p>· Add 4 volumes of PureLink Binding Buffer (B2) with isopropanol to 1 volume of the PCR product (50–100 μL). Mix well.<br /><br />
· Add the sample with the appropriate Binding Buffer (from step 1 of this procedure) to the PureLink Spin Column.<br /><br />
· Centrifuge the column at room temperature at 10,000 × g for 1 minute. (Discard the flow through)<br /><br />
· Add 650 μL of Wash Buffer with ethanol to the column.<br /><br />
· Centrifuge the column at room temperature at 10,000 × g for 1 minute. Discard the flow through from the collection tube and place the column into the tube.<br /><br />
· Centrifuge the column at maximum speed at room temperature for 2–3 minutes to remove any residual Wash Buffer. Discard the collection tube.<br /><br />
· Place the spin column in a clean 1.7-mL PureLink Elution Tube supplied with the kit.<br /><br />
· Add 50 μL of Elution Buffer<br /><br />
· Incubate the column at room temperature for 1 minute.<br /><br />
· Centrifuge the column at maximum speed for 2 minutes.<br /><br />
· The elution tube contains the purified PCR product. Remove and discard the column. The recovered elution volume is ~48 μL.</p><br />
<p>Made 1% Gel</p><br />
<p>· Ran in a gel for ~15-20 min<br /><img src="http://farm9.staticflickr.com/8458/8049392368_8984aff729_m.jpg" /><br /><br />
N U A(in plasmid) MWM</p><br />
<p>Cutting the gel and purifying</p><br />
<p>· Equilibrate a water bath 50 C<br /><br />
· Cut the gel<br /><br />
· 3 volumes (288ul)<br /><br />
· Place it in water bath for 10min<br /><br />
· Additional 5min</p><br />
<p>Purification procedure using centrifugation</p><br />
<p>· Load the dissolved gel mixture with DNA onto the center of a pure link wash tube<br /><br />
· Centrifuge the column at room temperature at 10,000 × g for 1 minute. (Discard the flow through)<br /><br />
· Add 650 μL of Wash Buffer with ethanol to the column.<br /><br />
· Centrifuge the column at room temperature at 10,000 × g for 1 minute. Discard the flow through from the collection tube and place the column into the tube.<br /><br />
· Centrifuge the column at maximum speed at room temperature for 2–3 minutes to remove any residual Wash Buffer. Discard the collection tube.<br /><br />
· Place the spin column in a clean 1.7-mL PureLink Elution Tube supplied with the kit.<br /><br />
· Add 50 μL of Elution Buffer<br /><br />
· Incubate the column at room temperature for 1 minute.<br /><br />
· Centrifuge the column at maximum speed for 2 minutes.<br /><br />
· The elution tube contains the purified PCR product. Remove and discard the column. The recovered elution volume is ~48 μL.</p><br />
<p>PCR<br /><br />
10ul plasmid prep a4<br /><br />
1ul 10X buffer<br /><br />
1ul Spe1</p><br />
<p>Made 1% Gel for PCR Purification for plasmid prep a4<br /><br />
(Also ran with Nag1 and Uap1)<br /><br />
First well DNA ladder (New England Bio quick-load), second well AGM1 plasmid,<br /><br />
Third well NAG1, and fourth well UAP1</p><br />
<p><img src="http://farm9.staticflickr.com/8173/8049394500_1f00f5c7ef_n.jpg" /></p><br />
<p>Very little yield for linearized AGM1 plasmid but it is there. Std was 5uL, all others 10uL per lane. The smaller. The frag the more efficient the purification.</p><br />
<p>Transformation (Gibbson assembly)</p><br />
<p>Version 1 Version 2</p><br />
<p>7ul AGM1 plasmid 9ul AGM1 plasmid<br /><br />
1ul NAG1 0.5 NAG1<br /><br />
2ul UAP1 0.5 UAP1</p><br />
<p> 10ul 10ul<br /><br />
+ 10ul master mix + 10ul master mix</p><br />
<p>20ul total 20ul total </p><br />
<p>*PCR (version 1 and version 2) is in PCR machine</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/14/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>I filled two molds and was unable to fill more since the autoclave was being used and it could not wait to autoclave more. Incubator temp 31</p><br />
<p>The lab strains look the same. Ph same as well as temp</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/12/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Lab strain looks much better and uniform from last time, a sheet is expected. Ph 4. 5<br /><br />
Wild strain is not growing quickly but its growth seems more concentrated. Ph 4<br /><br />
Temp. 23.5 degrees.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/10/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The 10 beakers were moved to the incubator, temp. 30. Two more molds were. Contaminated and will be filled in. In all we filled 4 molds and 11 small tubes for test samples.</p><br />
<p>Kombucha-temp is 23. 5 in cabinet.<br /><br />
Assessment.<br /><br />
One of the lab strain, aceto food is growing weakly. There seems to be a particle floating inside.<br /><br />
Ph 4</p><br />
<p>Lab strain in blueberry juice is contaminated. Ph 2</p><br />
<p>Wild kombucha is growing best but still weakly. Ph 4. 5</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/07/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>We moved the molds out of the incubator and into cabinets in the lab. Four from before were contaminated, they were cleaned and four more molds were made. 5 star shapes were also put together.<br /><br />
Ten smaller beakers were also inoculated with the mycelia and were originally in the fan space (fan off).</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/06/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Came into lab. Jimmy had already made the substrate, we filled out 5 of the 9 molds needed with the oak pellet substrate. To avoid contamination, we wrapped the finished molds in plastic wrap. We also used aluminum star shaped containers, in order to create smaller molds. Two and a half. All molds were made with h2o2 mycelium. No new contaminants, though one seems to be developed.</p><br />
<p>Kombucha. Made three with lab strain scoby, two with aceto food, one with blueberry juice</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Josue<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Sep/04/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Came into lab today, 7 out of 16 molds were contaminated. It seems like the tapes used to seal up cracks are the culprits as most of the mold growing seemed to originate at the tapes. There needs to be a better way to seal things up. what was done: we merely cleaned out the contaminated trays and are leaving the rest for tomorrow.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/24/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><b>Ligation & Transformation</b></p><br />
<p>Two ligation reactions:<br /><b>First rnx is Labeled “Lig 1 SH 8/24”</b><br /><br />
4 ul purified A + pSB1C3<br /><br />
4 ul purified N<br /><br />
1 ul 10x T4 ligase buffer<br /><br />
1 ul T4 ligase<br /><br />
10 ul total</p><br />
<p>The second one (that is a bit of a crapshoot but could potentially put all three pieces together):<br /><b>Second rnx is Labeled “Lig 2 SH 8/24”</b><br /><br />
2 ul purified A + pSB1C3<br /><br />
3 ul purified N<br /><br />
3 ul purified U<br /><br />
1 ul 10x T4 ligase buffer<br /><br />
1 ul T4 ligase<br /><br />
10 ul total</p><br />
<p>Centrifuged for 20 seconds at 2.0rcf because T4 ligase was pipetted onto the side of the tube for Lig 2.<br /><br />
Began rnx at 7:58pm, running for 31 minutes on the timer.</p><br />
<p>Incubate at room temperature for 30 min to 1 h.</p><br />
<p>*** We should have used CIP/phosphatase so that the AGM1 gene with the pSB1C3 vector cannot religate... Since we did not, we are expecting to see more religated plasmids without the intended inserts for both Lig 1 and Lig 2 rnx’s. </p><br />
<p><b>Transformation set up for Ligation 1 and Ligation 2:</b></p><br />
<p>Pellet for 8.4rcf</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/23/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>PCR products of the N and U gene plasmid digests were retrieved and run on a 1% gel at 3:08pm for about 40 minutes.</p><br />
<p>5ul of 1KB Plus DNA ladder</p><br />
<p>2uL PCR product<br /><br />
2ul Xylene Cyanol loading dye<br /><br />
10ul H2O<br /><br />
14ul total</p><br />
<p>Lane 1: empty<br /><br />
Lane 2: 1KB PLUS DNA ladder<br /><br />
Lane 3: Tube A (NAG1)<br /><br />
Lane 4: Tube B (NAG1) + MgCl<br /><br />
Lane 5: Tube C (UAP1)<br /><br />
Lane 6: Tube D (UAP1) + MgCl<br /><br />
(Recall that we did not have the proper reverse primer for AGM1, so this was not included)</p><br />
<p><b>Predicted band sizes:</b><br /><br />
Lane 3: 747kb<br /><br />
Lane 4: 747kb<br /><br />
Lane 5: 1461kb<br /><br />
Lane 6: 1461kb<br /><br />
(with lanes 4 and 6 showing more distinct bands, if the PCR reaction was enhanced by the MgCl cofactor)</p><br />
<p>Also, running the gel for 40 minutes was way too long-- next time only 25-30 so our product doesn’t go off the gel!</p><br />
<p>Results:<br /><img src="http://farm9.staticflickr.com/8450/8049380964_fd22eba205_m.jpg" /></p><br />
<p>PCR products (tubes A, B, C, D) are in the hot pink “Cloning Materials” box and labeled “Genes N/U RE & PCR Products 8/23”</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Julie<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/22/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>We purified our PCR products via miniprep. Only then did we look more closely at the gel to see that our "products" were in the 250-400 bp range, when we expect 800-1600 bp range. Clearly the PCRs failed. </p><br />
<p>In examining the cause of PCR failure more closely, we realized that the reverse primer for gene 1 (AGM1) is incorrect. The reverse complement of the forward sequence was never generated (see the "primers" google document to confirm this). The good news is that it's easy to generate the correct sequence and order the primer. The bad news is that we can't do the final gibson assembly without it. </p><br />
<p>To troubleshoot the PCRs that should have worked (NAG1 and UAP1), we are running PCRs again overnight. We are using different concentrations of primer/template and testing different Mg2+ concentrations. This time our reactions looked like:</p><br />
<p>Forward primer (10 uM): 1 ul<br /><br />
Reverse primer (10 uM): 1 ul<br /><br />
template DNA: 1 ul<br /><br />
H2O: 22 ul</p><br />
<p>OR</p><br />
<p>Forward primer (10 uM): 1 ul<br /><br />
Reverse primer (10 uM): 1 ul<br /><br />
template DNA: 1 ul<br /><br />
100 mM MgCl: 1 ul<br /><br />
H2O: 21 ul</p><br />
<p>Our PCR cofactor (1% MgCl2) was:<br /><br />
900ul H2O<br /><br />
100ul 1M MgCl2</p><br />
<p><b>A Tube: NAG1</b><br /><br />
1ul of Forward Primer 1 (Gene 2F)<br /><br />
1ul of Reverse Primer 2 (Gene 2R)<br /><br />
1ul of Template (NAG1-5)<br /><br />
22ul of H2O<br /><br />
25ul Total</p><br />
<p><b>B Tube: NAG1 with MgCl cofactor</b><br /><br />
1ul of Forward Primer (Gene 2F)<br /><br />
1ul of Reverse Primer (Gene 2R)<br /><br />
1ul of Template (NAG1-5)<br /><br />
1ul MgCl solution<br /><br />
21ul of H2O<br /><br />
25ul Total</p><br />
<p><b>C Tube: UAP1</b><br /><br />
1ul of Forward Primer 1 (Gene 3F)<br /><br />
1ul of Reverse Primer 2 (Gene 3R)<br /><br />
1ul of Template (UAP1-3)<br /><br />
22ul of H2O<br /><br />
25ul Total</p><br />
<p><b>D Tube: UAP1 with MgCl cofactor</b><br /><br />
1ul of Forward Primer 1 (Gene 3F)<br /><br />
1ul of Reverse Primer 2 (Gene 3R)<br /><br />
1ul of Template (NAG1-5)<br /><br />
1ul MgCl solution<br /><br />
21ul of H2O<br /><br />
25ul Total</p><br />
<p>We also decided to start cloning the classic digest-and-ligate way using our genes which are already in the biobrick plasmids. We digested AGM1 plasmid with SpeI (thus linearizing it). We digested NAG1 and UAP1 plasmids with SpeI and XbaI, liberating the genes (and RBS) from their backbone plasmids. </p><br />
<p><b>AGM Plasmid:</b><br /><br />
3ul AGM1 Plasmid<br /><br />
2ul Buffer<br /><br />
1ul SpeI<br /><br />
0ul XbaI<br /><br />
14ul H2O<br /><br />
20ul Total</p><br />
<p><b>NAG Plasmid:</b><br /><br />
3ul NAG1 Plasmid<br /><br />
2ul Buffer<br /><br />
1ul SpeI<br /><br />
1ul XbaI<br /><br />
13ul H2O<br /><br />
20ul Total</p><br />
<p><b>UAP Plasmids:</b><br /><br />
3ul UAP Plasmid<br /><br />
2ul Buffer<br /><br />
1ul SpeI<br /><br />
1ul XbaI<br /><br />
13ul H2O<br /><br />
20ul Total</p><br />
<p>We ran a gel of our digests, and they look great - the exact sizes we expected (I will attach it later). Another confirmation that our minipreps contain the genes we expect them to (even if we don't have the full sequence). We cut the pieces out of the gel that were the correct sizes and gel purified them. They are in the fridge and ready to ligate together.</p><br />
<p><img src="http://farm9.staticflickr.com/8456/8049368751_497bdfabb9_m.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Julie<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/21/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>We ran a gel to confirm that we have PCR products of expected sizes. I glanced only quickly at the gel, saw that there were some bands (admittedly diffuse but the gel itself was a week old). The gel is attached (sad gel.png). Its name will become clear tomorrow.</p><br />
<p><img src="http://farm9.staticflickr.com/8030/8049366364_94191cecc0_m.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Julie<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/20/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>We set up PCRs of the genes using primers containing overlapping sequences. For each PCR, we diluted the dessicated reagents (Taq Polymerase, dNTPs, MgCl, buffer) in the following:</p><br />
<p>Forward primer (10 uM): 2 ul<br /><br />
Reverse primer (10 uM): 2 ul<br /><br />
template DNA: 3 ul<br /><br />
H2O: 18 ul</p><br />
<p>(I may be off. I didn't take notes here. If I'm wrong and you remember, please let me know.)</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/17/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The DNA sequences came back. None of the forward reactions worked (especially surprising as these primers were supplied by iGEM headquarters). Of the reverse reactions, some worked and some didn't. There was no read for the NAG1 gene, for example, but as we only had one digest that looked positive, we have to move forward with this clone (for now). </p><br />
<p>The best hits were: </p><br />
<p>AGM1 - clone 4<br /><br />
NAG1 - clone 5<br /><br />
UAP1 - clone 3</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Alex<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/16/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The cultures were well grown the next day (and the original colonies were still white, a promising sign). We miniprepped the plasmids from the cultures, and then used an XbaI/SpeI digest to identify plasmids with the correct-sized inserts. The expected sizes for the DNA fragments:</p><br />
<p>1.6 kB - AGM1<br /><br />
0.7 kB - NAG1<br /><br />
1.5 kB - UAP1<br /><br />
2.1 kB - biobrick plasmid<br /><img src="http://farm9.staticflickr.com/8460/8049355440_bf0b721d5e_m.jpg" /><br /><br />
All of the positive hits had bands of these expected sizes. Some of them had larger bands that add to a singly-cut plasmid (insert + backbone, e.g., AGM1 + biobrick plasmid, i.e., 1.6 kB + 2.1 kB = 3.7 kB) but the ones we considered positive contained only predicted sized bands - no miscellaneous weirdos. </p><br />
<p>The digests were run on a 1% agarose gel. I've attached the picture (gel annotated.png) that shows the inserts with the correct sized bands (the samples with the asterisks). These were sent for sequencing using the VF and VR (verify forward and verify reverse) primers.</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/15/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The next day we had lots of colonies (I don't have the pictures of the plates, but maybe someone else does). Many of these were red, indicating they were transformed due to residual RFP plasmid (as had happened previously). We circled several white colonies as prospective positive transformants. For each construct, we chose 5 clones and inoculated 4 ml of LB-chlor to grow these overnight at 37 deg C.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/14/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>The second gibson assemblies that we did worked! We followed Ellen's advice to increase the G-bit DNA concentration. This means our final assembly reactions looked like this:</p><br />
<p>2.5 ul pSB1C3 (biobrick backbone plasmid DNA, linearized)<br /><br />
7.5 ul G-bit DNA*<br /><br />
10 ul master mix<br /><br />
20 ul total</p><br />
<p>* we divided the volume left by the number of G-bit parts. For NAG1, there were 3 parts, so each took up 2.5 ul. For UAP 1, there were 4 parts, so each took up 1.8 ul. For AGM1, there were 5 parts, so each took up 1.5 ul.</p><br />
<p>We incubated these for 1 hr at 50 deg C and then immediately transformed the commercial competent cells.</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/12/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Gibson, Transformation:<br /><br />
So instead of 50 fentomoles of each, try 100 but 50 of the plasmid as before. I think we have room in the 10 microliters for that. And maybe close the lid of the PCR machine?</p><br />
<p>Gibson assembly protocol</p><br />
<p>-reaction is in 0.2mL PCR tube using program “Gibson” under user “ellen”<br /><br />
50C for 1h, hold at 4C<br /><br />
-total reaction volume is 20 microliters<br /><br />
-all G-Blocks were resuspended at a concentration of 50 fentomoles per microliter<br /><br />
-TOTAL amount of DNA in tube (sum of all parts) should be between 200-1000 fentomoles. NOTE: last time we were at the low end of this!</p><br />
<p>Recommended procedure:<br /><br />
For ‘U’<br /><br />
1.85 µL U-1<br /><br />
1.85 µL U-2<br /><br />
1.85 µL U-3<br /><br />
1.85 µL U-4<br /><br />
2.6 µL pSB1C3<br /><br />
10.0 µL Gibson Master Mix<br /><br />
20.0 µL</p><br />
<p>For ’N’<br /><br />
2.5 µL N-1<br /><br />
2.5 µL N-2<br /><br />
2.5 µL N-3<br /><br />
2.5 µL pSB1C3<br /><br />
10.0 µL Gibson Master Mix<br /><br />
20.0 µL</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/10/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8174/8048768673_d51ef329a3.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Alex<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/10/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Results of Gibson Assembly:<br /><br />
4 big plates of the 3 chitin path genes A, U, and N, a + control<br /><br />
2 small plaets: neg control, baseline control without antibio</p><br />
<p>Results:</p><br />
<p>Lawn on antibiotic free control</p><br />
<p>Some contamination on A & U plates</p><br />
<p>No growth on N, + Control plates</p><br />
<p>[PASTE ALL PHOTOS FROM ALEX EMAIL AFTER RESIZING]</p><br />
<p>Pink colonies may be traces of RFP plasmids remaining from when biobrick plasmid part was PCR’ed.</p><br />
<p>Reasons for failure could be:</p><br />
<p>1) use the heated lid on the PCR machine - I did not shut it because I thought it might jack up the temp.<br /><br />
2) the manual says to use a 2-3x overage of inserts to backbone. The tech service guy said use equimolar so we did. maybe we need to rethink that.<br /><br />
3) overall total conc of DNA in the rxn mix could be upped.</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Alex<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/08/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>Notes for NAG1 Gibson</p><br />
<p>N-1 87163240<br /><br />
163696916 Date Ordered: 3rd Aug, 2012<br /><br />
200 ng = 1012.2 fmol</p><br />
<p>N-2 87163241<br /><br />
163696911 Date Ordered: 3rd Aug, 2012<br /><br />
200 ng - 1005.9 fmol</p><br />
<p>N-3 87163242<br /><br />
163696921 Date ordered: 3rd Aug, 2012<br /><br />
200 ng = 978.5 fmol</p><br />
<p>Gibson Assembly Master Mix<br /><br />
#E26115 Exp: 6/13<br /><br />
Lot: 0031206</p><br />
<p>PSBIC3<br /><br />
Biobrick Plasmid 2071 bases<br /><br />
650 * 2071 =<br /><br />
Mol. Weight: 1.346 x 106 fg/fmol</p><br />
<p>N1<br /><br />
10012.2 fmol / 20 μL<br /><br />
= 50.61 fmol/ μL<br /><br />
N2<br /><br />
1005.9 fmol / 20 μL<br /><br />
= 50.29 fmol/ μL<br /><br />
N3<br /><br />
978.5 fmol / 19 μL<br /><br />
= 51.50 fmol/ μL</p><br />
<p>4.3 μL water<br /><br />
+ 2.7 μL PSB1C3<br /><br />
+ 1.0 μL N1 (Concentration - 50.61 fmol/μL)<br /><br />
+ 1.0 μL N2 (Concentration - 50.29 fmol/μL)<br /><br />
+ 1.0 μL N3 (Concentration - 51.50 fmol/μL)<br /><br />
+ 10 μL Mastermix<br /><br />
= 20 μL</p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah </td><br />
<td class="views-field views-field-created" ><br />
Aug/08/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8458/8048768341_cd215f8a44.jpg" /><br /><img src="http://farm9.staticflickr.com/8314/8048768463_ebf452dfea.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/07/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8313/8048773304_9ce0f49fd2.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Steven<br />Cloning </td><br />
<td class="views-field views-field-created" ><br />
Aug/06/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p>G-blocks arrived</p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/04/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8451/8048765553_1ffd507e36.jpg" /><br /><img src="http://farm9.staticflickr.com/8172/8048770556_2604c4a9b2.jpg" /><br /><img src="http://farm9.staticflickr.com/8316/8048765169_52ca13cda9_n.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/03/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8450/8048766095_c94a54efd5.jpg" /><br /><img src="http://farm9.staticflickr.com/8313/8048765937_f6fd019924.jpg" /><br /><img src="http://farm9.staticflickr.com/8180/8048770890_12ba62d1a7.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/02/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8318/8048766337_a5795fb13d.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Aug/01/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8182/8048766707_9cb88da4d7.jpg" /><br /><img src="http://farm9.staticflickr.com/8171/8048771682_17e08a6f17.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/30/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8179/8048766867_8c6cc28dd4.jpg" /><br /><img src="http://farm9.staticflickr.com/8174/8048767007_9a47831e22.jpg" /><br /><img src="http://farm9.staticflickr.com/8455/8048772414_005410d2f1.jpg" /><br /><img src="http://farm9.staticflickr.com/8169/8048767529_8993906e3d.jpg" /><br /><img src="http://farm9.staticflickr.com/8318/8048767697_95e77a28af.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="odd"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sarah<br />Transformation </td><br />
<td class="views-field views-field-created" ><br />
Jul/20/2012 </td><br />
<td class="views-field views-field-body" ><br />
<p><img src="http://farm9.staticflickr.com/8033/8048772282_58fab176aa.jpg" /></p><br />
</td><br />
</tr><br />
<tr class="even views-row-last"><br />
<td class="views-field views-field-field-sub-team" ><br />
Sara<br />Growing </td><br />
<td class="views-field views-field-created" ><br />
Jun/09/2012 </td><br />
<td class="views-field views-field-body" ><br />
<ol><li>Almost no growth, very thin film.</li><br />
<li>Cellulose very thin, seems to have grown on bottom (not top)</li><br />
<li>Thin growth, not measurable from sides, but def more significant than just scoby.</li><br />
<li>Super thick from bubbles, accidentally popped it. A little thicker than #9.</li><br />
<li>Infested w/ flies. Nice growth, not in a sheet, disposing.</li><br />
<li>Pretty thick, made a little pillow from the air bubbles.</li><br />
<li>Thin growth along top.</li><br />
<li>Thin growth along top.</li><br />
<li>Nice sheet, 2nd to 10+13.</li><br />
<li>Very thick cellulose, abt 1-2mm growth.</li><br />
<li>Thickest non-BB. Weird flakes (brown) everywhere.</li><br />
<li>Thin growth, a little thicker than the other thins.</li><br />
<li>Almost entirely cellulose, very little liquid left.</li><br />
</ol> </td><br />
</tr><br />
</tbody><br />
</table><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
</div> </div><br />
</div><br />
</div><br />
</div></div> <!-- /.section, /#content --><br />
</div></div></div> <!-- /#main-inner, /#main, /#main-wrapper --><br />
<br />
</nowiki></html><br />
{{:Team:NYU_Gallatin/Templates/Footer_Content}}<br />
<html><br />
<br />
</div></div> <!-- /#page, /#page-wrapper --><br />
</body></html><br />
{{:Team:NYU_Gallatin/Templates/Footer}}</div>
Sararobertson
http://2012.igem.org/File:Aseatobacter-Javascript_Cellulose.txt
File:Aseatobacter-Javascript Cellulose.txt
2012-10-03T05:51:44Z
<p>Sararobertson: uploaded a new version of &quot;File:Aseatobacter-Javascript Cellulose.txt&quot;</p>
<hr />
<div></div>
Sararobertson
http://2012.igem.org/Team:NYU_Gallatin/Templates/Styles
Team:NYU Gallatin/Templates/Styles
2012-10-03T05:41:52Z
<p>Sararobertson: </p>
<hr />
<div><html><br />
<head><br />
<nowiki><style><br />
/* Styles for the Wiki site */<br />
<br />
/* Neuropol Fonts */<br />
@font-face {<br />
font-family: neuropol;<br />
/* src: url('http://igem.melodramatic.com/sites/default/themes/igem/fonts/NEUROPOL.ttf'); */<br />
src: url('https://static.igem.org/mediawiki/2012/e/e6/Aseatobacter-FONT_NEUROPOL.txt');<br />
}<br />
.view-team h3,<br />
.view-team .views-label,<br />
.view-team span.username,<br />
.aseato,<br />
#page-title,<br />
#main-menu-links a span b,<br />
#page .sidebar .block h2,<br />
#block-block-9 h2,<br />
#block-block-4 h2,<br />
#block-block-5 h2,<br />
#block-block-2 span.stat,<br />
#site-slogan,<br />
#site-name {<br />
font-family: neuropol, "Courier New" !important;<br />
}<br />
<br />
/* Hidden Elements */<br />
#p-logo,<br />
#catlinks,<br />
#top-section #p-logo img,<br />
div.front #page-title,<br />
h1.firstHeading,<br />
#top-section, <br />
#footer-box,<br />
html.js .js-hide,<br />
#bodyContent p,<br />
.element-hidden {<br />
display: none;<br />
}<br />
<br />
#content {<br />
padding-top: 0 !important;<br />
}<br />
#content {<br />
padding: 0;<br />
}<br />
#bodyContent {<br />
padding: 0;<br />
margin: 0;<br />
}<br />
#bodyContent #page-wrapper p {<br />
display: block;<br />
}<br />
#header {<br />
}<br />
#page {<br />
font-size: 75%;<br />
}<br />
<br />
/* ---------- Basic Layout Styles ----------- */<br />
<br />
html,<br />
body,<br />
#page {<br />
height: 100%;<br />
}<br />
#content {<br />
width: 100%;<br />
}<br />
#page-wrapper {<br />
min-height: 100%;<br />
min-width: 950px;<br />
}<br />
#header div.section,<br />
#featured div.section,<br />
#messages div.section,<br />
#main,<br />
#triptych,<br />
#footer-columns {<br />
width: 950px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
}<br />
#header div.section {<br />
position: relative;<br />
}<br />
.region-header {<br />
float: right; /* LTR */<br />
margin: 0 5px 10px;<br />
}<br />
.with-secondary-menu .region-header {<br />
margin-top: 3em;<br />
}<br />
.without-secondary-menu .region-header {<br />
margin-top: 15px;<br />
}<br />
#secondary-menu {<br />
position: absolute;<br />
right: 0; /* LTR */<br />
top: 0;<br />
width: 480px;<br />
}<br />
#igem-content,<br />
#sidebar-first,<br />
#sidebar-second {<br />
display: inline;<br />
float: left; /* LTR */<br />
position: relative;<br />
}<br />
.one-sidebar #igem-content {<br />
width: 710px;<br />
}<br />
.two-sidebars #igem-content {<br />
width: 480px;<br />
}<br />
.no-sidebars #igem-content {<br />
width: 950px;<br />
float: none;<br />
}<br />
#sidebar-first,<br />
#sidebar-second {<br />
width: 210px;<br />
}<br />
#main-wrapper {<br />
min-height: 300px;<br />
}<br />
#igem-content .section,<br />
.sidebar .section {<br />
padding: 0 15px;<br />
}<br />
#footer-wrapper {<br />
padding: 0px 5px 0px;<br />
}<br />
.region-footer-firstcolumn,<br />
.region-footer-secondcolumn,<br />
.region-footer-thirdcolumn,<br />
.region-footer-fourthcolumn {<br />
padding: 0 10px;<br />
width: 220px;<br />
}<br />
<br />
#globalWrapper {<br />
z-index: 1;<br />
padding: 0px !important;<br />
}<br />
#contentSub {<br />
border: solid black 1px;<br />
}<br />
#canvas {<br />
position: fixed !important;<br />
top: 0 !important;<br />
left: 0 !important;<br />
}<br />
<br />
<br />
/**<br />
* Inline items.<br />
*/<br />
.container-inline div,<br />
.container-inline label {<br />
display: inline;<br />
}<br />
.container-inline .fieldset-wrapper {<br />
display: block;<br />
}<br />
.nowrap {<br />
white-space: nowrap;<br />
}<br />
<br />
.element-invisible {<br />
position: absolute !important;<br />
clip: rect(1px 1px 1px 1px); /* IE6, IE7 */<br />
clip: rect(1px, 1px, 1px, 1px);<br />
}<br />
.element-invisible.element-focusable:active,<br />
.element-invisible.element-focusable:focus {<br />
position: static !important;<br />
clip: auto;<br />
}<br />
<br />
/**<br />
* Markup free clearing.<br />
*<br />
* @see http://perishablepress.com/press/2009/12/06/new-clearfix-hack<br />
*/<br />
.clearfix:after {<br />
content: ".";<br />
display: block;<br />
height: 0;<br />
clear: both;<br />
visibility: hidden;<br />
}<br />
/* IE6 */<br />
* html .clearfix {<br />
height: 1%;<br />
}<br />
/* IE7 */<br />
*:first-child + html .clearfix {<br />
min-height: 1%;<br />
}<br />
<br />
<br />
/* ---------- Overall Specifications ---------- */<br />
<br />
body {<br />
line-height: 1.5;<br />
font-size: 100%;<br />
word-wrap: break-word;<br />
margin: 0;<br />
padding: 0;<br />
border: 0;<br />
outline: 0;<br />
font-family: "Helvetica";<br />
}<br />
#page, #main {<br />
font-family: "Helvetica";<br />
}<br />
a:link,<br />
a:visited {<br />
text-decoration: none;<br />
}<br />
a:hover,<br />
a:active,<br />
a:focus {<br />
text-decoration: underline;<br />
}<br />
tr.odd {<br />
background-color: #e8e9dc;<br />
}<br />
img {<br />
outline: 0;<br />
}<br />
<br />
/* ------------------ Fonts ------------------ */<br />
<br />
#header,<br />
#footer-wrapper,<br />
ul.contextual-links,<br />
ul.links,<br />
ul.primary,<br />
.item-list .pager,<br />
div.field-type-taxonomy-term-reference,<br />
div.messages,<br />
div.meta,<br />
p.comment-time,<br />
table,<br />
.breadcrumb {<br />
font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;<br />
}<br />
input,<br />
textarea,<br />
select,<br />
a.button {<br />
font-family: "Lucida Grande", "Lucida Sans Unicode", Verdana, sans-serif;<br />
}<br />
<br />
<br />
/* ------------------ Table Styles ------------------ */<br />
<br />
table {<br />
border: 0;<br />
border-spacing: 0;<br />
font-size: 0.7em;<br />
margin: 10px 0;<br />
width: 100%;<br />
border: solid #909268 1px;<br />
border-right: none;<br />
border-top: none;<br />
}<br />
table table {<br />
font-size: 1em;<br />
}<br />
#footer-wrapper table {<br />
font-size: 1em;<br />
}<br />
table tr th {<br />
background: #53561d;<br />
color: #fff;<br />
border-bottom-style: none;<br />
}<br />
table tr th,<br />
table tr th a,<br />
table tr th a:hover {<br />
color: #FFF;<br />
font-weight: bold;<br />
font-size: 0.9em;<br />
}<br />
table tbody tr th {<br />
vertical-align: top;<br />
}<br />
tr td,<br />
tr th {<br />
padding: 4px 9px;<br />
border: solid #909268 1px;<br />
border-left: none;<br />
border-bottom: none;<br />
text-align: left; /* LTR */<br />
vertical-align: top;<br />
}<br />
<br />
tr td.last,<br />
tr th {<br />
<br />
}<br />
#footer-wrapper tr td,<br />
#footer-wrapper tr th {<br />
border-color: #555;<br />
border-color: rgba(255, 255, 255, 0.18);<br />
}<br />
table ul.links {<br />
margin: 0;<br />
padding: 0;<br />
font-size: 1em;<br />
}<br />
table ul.links li {<br />
padding: 0 1em 0 0;<br />
}<br />
<br />
/* ------------------ List Styles ------------------ */<br />
<br />
.block ol,<br />
.block ul {<br />
margin: 0;<br />
padding: 0 0 0.25em 1em; /* LTR */<br />
}<br />
.contextual-links-wrapper {<br />
font-size: small !important;<br />
}<br />
ul.contextual-links {<br />
font-size: 0.923em;<br />
}<br />
.contextual-links-wrapper a {<br />
text-shadow: 0 0 0 !important;<br />
}<br />
.item-list .pager {<br />
font-size: 0.929em;<br />
}<br />
ul.menu li {<br />
margin: 0;<br />
list-style: none;<br />
}<br />
.region-content ul,<br />
.region-content ol {<br />
margin: 1em 0;<br />
padding: 0 0 0.25em 2.5em; /* LTR */<br />
}<br />
.item-list ul li {<br />
margin: 0;<br />
padding: 0.2em 0.5em 0 0; /* LTR */<br />
}<br />
ul.tips {<br />
padding: 0 0 0 1.25em; /* LTR */<br />
}<br />
#sidebar-first li a {<br />
color: black;<br />
}<br />
#sidebar-first li a:hover,<br />
#sidebar-first li a.active {<br />
color: #757418;<br />
text-decoration: underline;<br />
}<br />
<br />
/* ------------------ Header ------------------ */<br />
#logo {<br />
float: left; /* LTR */<br />
padding: 15px 15px 15px 10px; /* LTR */<br />
}<br />
#name-and-slogan {<br />
padding-top: 34px;<br />
margin: 0 0 10px 15px; /* LTR */<br />
}<br />
#site-name {<br />
color: #686868;<br />
font-size: 50px;<br />
text-align: center;<br />
margin: 10px 0 0 0;<br />
}<br />
h1#site-name {<br />
margin: 0;<br />
}<br />
#site-name a {<br />
font-weight: normal;<br />
}<br />
#site-slogan {<br />
font-size: 1.0;<br />
margin: 0;<br />
padding: 0;<br />
word-spacing: 0.1em;<br />
border: 0;<br />
text-align: center;<br />
}<br />
<br />
/* ------------------- Main ------------------- */<br />
<br />
#main {<br />
margin-top: 20px;<br />
margin-bottom: 0px;<br />
}<br />
<br />
/* ----------------- Content ------------------ */<br />
<br />
.content {<br />
margin-top: 10px;<br />
}<br />
h1#page-title {<br />
font-size: 2em;<br />
line-height: 1;<br />
margin-top: 0;<br />
}<br />
#igem-content h2 {<br />
margin-bottom: 2px;<br />
font-size: 1.429em;<br />
line-height: 1.4;<br />
}<br />
.igem-section,<br />
.one-sidebar #igem-content {<br />
padding: 13px;<br />
}<br />
#page .node .content,<br />
#page .view {<br />
font-size: 1.3em;<br />
}<br />
.node .content p,<br />
#page .view p,<br />
.front .block p {<br />
line-height: 1.1em;<br />
}<br />
.meta {<br />
font-size: 0.857em;<br />
color: #68696b;<br />
margin-bottom: -5px;<br />
}<br />
.submitted .user-picture img {<br />
float: left; /* LTR */<br />
height: 20px;<br />
margin: 1px 5px 0 0; /* LTR */<br />
}<br />
.link-wrapper {<br />
text-align: right;<br />
}<br />
.field-type-image img,<br />
.user-picture img {<br />
margin: 0 0 1em;<br />
}<br />
ul.links {<br />
color: #68696b;<br />
font-size: 0.821em;<br />
}<br />
.node-unpublished {<br />
margin: -20px -15px 0;<br />
padding: 20px 15px 0;<br />
}<br />
/* ------------------ Sidebar ----------------- */<br />
.sidebar .block {<br />
padding: 15px 20px;<br />
margin: 0 0 20px;<br />
}<br />
.sidebar h2 {<br />
margin: 0 0 0.5em;<br />
border-bottom: 1px solid #d6d6d6;<br />
padding-bottom: 5px;<br />
text-shadow: 0 1px 0 #fff;<br />
font-size: 1.071em;<br />
line-height: 1.2;<br />
}<br />
.sidebar .block .content {<br />
font-size: 0.914em;<br />
line-height: 1.4;<br />
}<br />
.sidebar tbody {<br />
border: none;<br />
}<br />
.sidebar tr.even,<br />
.sidebar tr.odd {<br />
background: none;<br />
border-bottom: 1px solid #d6d6d6;<br />
}<br />
<br />
/* ------------------ Footer ------------------ */<br />
<br />
#footer-wrapper {<br />
color: #c0c0c0;<br />
color: rgba(255, 255, 255, 0.65);<br />
font-size: 0.857em;<br />
background-color: #c0c0c0;<br />
}<br />
#footer-wrapper a {<br />
color: #fcfcfc;<br />
color: rgba(255, 255, 255, 0.8);<br />
}<br />
#footer-wrapper a:hover,<br />
#footer-wrapper a:focus {<br />
color: #fefefe;<br />
color: rgba(255, 255, 255, 0.95);<br />
text-decoration: underline;<br />
}<br />
#footer-wrapper .block {<br />
margin: 0;<br />
}<br />
#footer-columns .block-menu,<br />
#igem-footer .block {<br />
margin: 0;<br />
padding: 0;<br />
border: none;<br />
}<br />
#igem-footer .block .content {<br />
margin-top: 0;<br />
padding: 0;<br />
}<br />
#igem-footer .block h2 {<br />
margin: 0;<br />
}<br />
<br />
/* iGem Styles */<br />
#page-title {<br />
padding: 0;<br />
margin: 0;<br />
font-family: Helvetica;<br />
}<br />
<br />
#main-menu a {<br />
color: #707070;<br />
}<br />
#canvas {<br />
position: absolute;<br />
top: 0;<br />
left: 0;<br />
}<br />
<br />
.lightbox2-alt-layout #imageData #bottomNav, .lightbox2-alt-layout-data #bottomNav {<br />
margin-bottom: 0;<br />
}<br />
<br />
/* Bacteria & iGEMs Blocks */<br />
#page #block-block-2, #page #block-block-3 {<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
background: black;<br />
opacity:0.3;<br />
filter:alpha(opacity=30); /* For IE8 and earlier */<br />
position: absolute;<br />
z-index: 9999;<br />
}<br />
#block-block-2 .content,<br />
#block-block-3 .content p {<br />
padding: 10px;<br />
margin: 0;<br />
font-size: 10px;<br />
}<br />
#block-block-2 h2,<br />
#block-block-3 h2 {<br />
color: white;<br />
font-size: 12px;<br />
line-height: 12px;<br />
padding: 10px 10px 0 10px;<br />
margin: 0;<br />
border: 0;<br />
}<br />
<br />
/* Bacteria Stats Block */<br />
#block-block-2 {<br />
right: 150px;<br />
top: -150px;<br />
}<br />
#page #block-block-2:hover {<br />
top: 0;<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
#block-block-2 #bacteria {<br />
text-align: center;<br />
text-transform: uppercase;<br />
font-weight: bold;<br />
}<br />
#block-block-2 span.stat {<br />
display: block;<br />
margin: 0;<br />
padding: 0;<br />
font-size: 24px;<br />
font-weight: bold;<br />
}<br />
<br />
/* iGEM Block */<br />
#block-block-3 {<br />
right: 20px;<br />
top: -175px;<br />
width: 120px;<br />
}<br />
#block-block-3 img {<br />
width: 100px;<br />
}<br />
#page #block-block-3:hover {<br />
top: 10px;<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
<br />
<br />
/* Front page styles */<br />
<br />
div.front #main-inner {<br />
padding: 0;<br />
margin: 0;<br />
}<br />
div.front #main-inner .block {<br />
padding: 20px 20px 10px 20px;<br />
margin-bottom: 15px;<br />
}<br />
div.front #main-inner #block-block-6 {<br />
margin-bottom: 0;<br />
}<br />
#block-block-7 div.content {<br />
padding: 0;<br />
}<br />
<br />
#block-block-9,<br />
#block-block-4,<br />
#block-block-5 {<br />
width: 257px;<br />
margin-right: 10px;<br />
float: left;<br />
height: 270px;<br />
}<br />
#block-block-5 {<br />
margin-right: 0;<br />
clear: right;<br />
}<br />
#block-block-9 h2,<br />
#block-block-4 h2,<br />
#block-block-5 h2 {<br />
border: 0;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#block-block-6 {<br />
clear: both;<br />
font-size: 1.3em;<br />
margin-bottom: 0;<br />
}<br />
<br />
#block-block-9 li {<br />
list-style: none;<br />
text-align: center;<br />
}<br />
#block-block-9 img {<br />
border: solid black 1px;<br />
}<br />
<br />
#block-block-9 .more-link,<br />
#block-block-6 .more-link,<br />
#block-block-4 .more-link,<br />
#block-block-5 .more-link {<br />
font-size: 12px;<br />
padding: 5px 5px;<br />
margin: 0;<br />
margin-top: 10px;<br />
line-height: 14px;<br />
}<br />
<br />
<br />
/* News Block */<br />
span.homedate {<br />
background: black;<br />
color: white;<br />
display: block;<br />
-moz-border-radius: 0px 5px 5px 0px;<br />
border-radius: 0px 5px 5px 0px;<br />
margin: 0;<br />
padding: 0;<br />
height: 20px;<br />
text-align: center;<br />
font-size: 20px;<br />
font-weight: bold;<br />
float: left;<br />
padding: 5px;<br />
margin-right: 10px;<br />
}<br />
b.homedate {<br />
background-color: #757418;<br />
color: white;<br />
display: block;<br />
-moz-border-radius: 5px 5px 0px 0px;<br />
border-radius: 5px 5px 0px 0px;<br />
width: 30px;<br />
text-align: center;<br />
font-weight: normal;<br />
font-size: 11px;<br />
padding: 0;<br />
float: left;<br />
margin-top: 4px;<br />
margin-right: -4px;<br />
<br />
/* Safari */<br />
-webkit-transform: rotate(-90deg);<br />
<br />
/* Firefox */<br />
-moz-transform: rotate(-90deg);<br />
<br />
/* IE */<br />
-ms-transform: rotate(-90deg);<br />
<br />
/* Opera */<br />
-o-transform: rotate(-90deg);<br />
<br />
/* Internet Explorer */<br />
filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=3);<br />
}<br />
#block-block-4 li {<br />
list-style: none;<br />
clear: both;<br />
margin-bottom: 15px;<br />
vertical-align: center;<br />
font-size: 13px;<br />
}<br />
#block-block-4 li a,<br />
#block-block-4 li {<br />
color: #757418;<br />
text-decoration: underline;<br />
}<br />
#block-block-4 ul {<br />
padding: 0;<br />
}<br />
<br />
div.social {<br />
/* background: url('../images/trans-bg-white.png'); */<br />
/* border: solid black 2px; */<br />
background: white;<br />
border: solid black 2px;<br />
color: black;<br />
display: inline-block;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
padding: 15px; <br />
text-align: center;<br />
width: 152px;<br />
margin-right: 0px;<br />
/*<br />
opacity:0.5;<br />
filter:alpha(opacity=50); */<br />
-webkit-transition: all 0.5s ease; <br />
-moz-transition: all 0.5s ease; <br />
-ms-transition: all 0.5s ease; <br />
-o-transition: all 0.5s ease; <br />
transition: all 0.5s ease;<br />
height: 300px;<br />
margin-top: -25px;<br />
}<br />
div.social:hover {<br />
opacity:1;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
div.social.last {<br />
margin-right: 0;<br />
}<br />
#block-block-7 p {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
div.social div.social-icon {<br />
<br />
}<br />
div.social div.social-icon img {<br />
width: 150px;<br />
height: 150px;<br />
margin-top: 5px;<br />
margin-bottom: 15px;<br />
opacity:0;<br />
filter:alpha(opacity=0); /* For IE8 and earlier */<br />
-webkit-transition: all 0.5s ease; <br />
-moz-transition: all 0.5s ease; <br />
-ms-transition: all 0.5s ease; <br />
-o-transition: all 0.5s ease; <br />
transition: all 0.5s ease;<br />
}<br />
div.social div.social-icon img:hover {<br />
opacity:.50;<br />
filter:alpha(opacity=50); /* For IE8 and earlier */<br />
}<br />
div.social#social-facebook {<br />
background: #fff url('../images/social/dark-face.png') center 20px no-repeat;<br />
}<br />
div.social#social-flikr {<br />
background: #fff url('../images/social/dark-flikr.png') center 20px no-repeat;<br />
}<br />
div.social#social-twitter {<br />
background: #fff url('../images/social/dark-twitter.png') center 20px no-repeat;<br />
}<br />
div.social#social-youtube {<br />
background: #fff url('../images/social/dark-youtube.png') center 20px no-repeat;<br />
}<br />
div.social#social-rss {<br />
background: #fff url('../images/social/dark-rss.png') center 20px no-repeat;<br />
}<br />
<br />
/* Nav Styles */<br />
<br />
/* --------------- Main Menu ------------ */<br />
<br />
#main-menu {<br />
height: 80px;<br />
overflow: hidden;<br />
padding: 0;<br />
text-align: center;<br />
width: 920px;<br />
z-index: 9999;<br />
}<br />
#main-menu-links {<br />
font-size: 0.929em;<br />
}<br />
#main-menu-links li {<br />
display: inline-block;<br />
list-style: none;<br />
padding: 0;<br />
margin: 0;<br />
text-align: left;<br />
}<br />
<br />
#main-menu-links a {<br />
opacity:0.1;<br />
filter:alpha(opacity=10); /* For IE8 and earlier */<br />
color: #333;<br />
float: left; /* LTR */<br />
width: 76px;<br />
overflow: hidden;<br />
height: 76px;<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
}<br />
#main-menu-links a span {<br />
margin-left: 80px;<br />
display: block;<br />
font-size: 11px;<br />
line-height: 12px;<br />
-moz-border-radius: 10px;<br />
border-radius: 10px;<br />
width: 88px;<br />
text-align: left;<br />
padding: 8px;<br />
height: 55px;<br />
}<br />
#main-menu-links a b {<br />
display: block;<br />
}<br />
#main-menu-links a:hover,<br />
#main-menu-links a:focus,<br />
#main-menu-links a.active {<br />
opacity:1.0;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
-webkit-transition: all 0.3s ease; <br />
-moz-transition: all 0.3s ease; <br />
-ms-transition: all 0.3s ease; <br />
-o-transition: all 0.3s ease; <br />
transition: all 0.3s ease;<br />
width: 190px;<br />
text-decoration: none;<br />
}<br />
#main-menu-links a:active,<br />
#main-menu-links a.active {<br />
opacity:1.0;<br />
filter:alpha(opacity=100); /* For IE8 and earlier */<br />
}<br />
<br />
/* Home */<br />
#main-menu-links li.menu-218 a {<br />
background: url('https://static.igem.org/mediawiki/2012/5/56/Aseatobacter-NAV-Home.png') left center no-repeat;<br />
}<br />
/* Team */<br />
#main-menu-links li.menu-388 a {<br />
background: url('https://static.igem.org/mediawiki/2012/7/73/Aseatobacter-NAV-Team.png') left center no-repeat;<br />
}<br />
/* Project */<br />
#main-menu-links li.menu-307 a {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d2/Aseatobacter-NAV-Project.png') left center no-repeat;<br />
}<br />
/* Parts */<br />
#main-menu-links li.menu-308 a {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Parts.png') left center no-repeat;<br />
}<br />
/* Modeling */<br />
#main-menu-links li.menu-310 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/ed/Aseatobacter-NAV-Modeling.png') left center no-repeat;<br />
}<br />
/* Notebook */<br />
#main-menu-links li.menu-584 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/e8/Aseatobacter-NAV-Notebook.png') left center no-repeat;<br />
}<br />
/* Safety */<br />
#main-menu-links li.menu-312 a {<br />
background: url('https://static.igem.org/mediawiki/2012/5/5f/Aseatobacter-NAV-Safety.png') left center no-repeat;<br />
}<br />
/* Attributions */<br />
#main-menu-links li.menu-313 a {<br />
background: url('https://static.igem.org/mediawiki/2012/c/c9/Aseatobacter-NAV-Attributions.png') left center no-repeat;<br />
}<br />
/* Profile */<br />
#main-menu-links li.menu-306 a {<br />
background: url('https://static.igem.org/mediawiki/2012/e/ea/Aseatobacter-NAV-Profile.png') left center no-repeat;<br />
}<br />
<br />
/* Page titles */<br />
div.page-team #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Small-Safety.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-5 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d5/Aseatobacter-NAV-Small-Modeling.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
/* Project */<br />
div.page-node-3 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/41/Aseatobacter-NAV-Small-Home.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-4 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/e/ea/Aseatobacter-NAV-Small-Parts.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-6 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/b/b7/Aseatobacter-NAV-Small-Notebook.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
div.page-node-7 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/d/d6/Aseatobacter-NAV-Small-Safety.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
/* Attributions */<br />
div.page-node-8 #page-title {<br />
min-height: 30px;<br />
background: url('https://static.igem.org/mediawiki/2012/4/41/Aseatobacter-NAV-Small-Home.png') left center no-repeat;<br />
padding-left: 40px;<br />
}<br />
<br />
<br />
/* ---------- Color Module Styles ----------- */<br />
<br />
body,<br />
body.overlay {<br />
color: #C4C487;<br />
/* background-color: #9c9f7f; */<br />
background-color: #98986c;<br />
}<br />
.comment .comment-arrow {<br />
border-color: #393a2d;<br />
}<br />
#page,<br />
#main-wrapper {<br />
background: transparent;<br />
}<br />
<br />
.no-sidebars #main-inner,<br />
.one-sidebar #igem-content,<br />
div.front #main-inner .block {<br />
background: transparent url('https://static.igem.org/mediawiki/2012/c/cf/Aseatobacter-IMAGES-trans-bg.png');<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
border: solid black 2px;<br />
}<br />
<br />
div.front #main-inner #block-block-9,<br />
div.front #main-inner #block-block-4,<br />
div.front #main-inner #block-block-5 {<br />
/* background: transparent url('../images/trans-bg-white.png'); */<br />
background: white;<br />
color: black;<br />
}<br />
div.front #main-inner #block-block-9 a,<br />
div.front #main-inner #block-block-4 a,<br />
div.front #main-inner #block-block-5 a,<br />
#block-block-2 span.stat {<br />
color: #757418;<br />
}<br />
<br />
div.front.no-sidebars #main-inner {<br />
background: none;<br />
border: none;<br />
}<br />
#page .sidebar .block {<br />
background: #fff;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
border: solid black 2px;<br />
}<br />
<br />
#page .sidebar .block h2 {<br />
margin: 0;<br />
border: 0;<br />
padding: 0;<br />
font-size: 20px;<br />
}<br />
.no-sidebars #main-inner {<br />
padding: 0 20px;<br />
border: solid black 2px;<br />
}<br />
.igem-section {<br />
color: #e9e9c8;<br />
}<br />
.tabs ul.primary li a.active {<br />
background-color: #ffffff;<br />
}<br />
.tabs ul.primary li.active a {<br />
background-color: #ffffff;<br />
border-bottom: 1px solid #ffffff;<br />
}<br />
a, a:visited, a:active {<br />
color: #C4C487;<br />
}<br />
a:hover,<br />
a:focus {<br />
color: #fff;<br />
}<br />
a:active {<br />
color: #55540d;<br />
}<br />
<br />
#main-menu-links a span {<br />
border: solid black 2px;<br />
background: transparent url('https://static.igem.org/mediawiki/2012/c/cf/Aseatobacter-IMAGES-trans-bg.png');<br />
color: black;<br />
}<br />
<br />
#main-menu-links a span b {<br />
color: white;<br />
padding-bottom: 5px;<br />
font-size: 10px;<br />
}<br />
<br />
#page-wrapper,<br />
#footer-wrapper {<br />
background-color: transparent;<br />
}<br />
.region-header,<br />
.region-header a,<br />
.region-header li a.active,<br />
#name-and-slogan,<br />
#name-and-slogan a,<br />
#secondary-menu-links li a {<br />
color: #fffeff;<br />
}<br />
<br />
/* iGEMs Colors */<br />
#top-section #p-logo {<br />
background: transparent;<br />
color: #9c9f7f;<br />
border: none;<br />
}<br />
#top-section #menubar.right-menu a {<br />
background: none;<br />
color: #535445;<br />
}<br />
#top-section #menubar.right-menu a:hover {<br />
color: black;<br />
}<br />
#top-section #search-controls input {<br />
color: #535445;<br />
}<br />
#top-section #menubar.left-menu a {<br />
color: #535445;<br />
}<br />
#top-section #menubar.left-menu:hover {<br />
background: none;<br />
}<br />
#content {<br />
background: transparent;<br />
}<br />
#footer-box {<br />
background: #393a2d;<br />
border: solid #393a2d 1px;<br />
border-top: 0;<br />
}<br />
#footer-box a {<br />
color: #9c9f7f;<br />
}<br />
#page-title {<br />
color: #000;<br />
border: none;<br />
}<br />
#site-name a {<br />
color: black;<br />
}<br />
#site-name a:hover {<br />
text-decoration: none;<br />
}<br />
#site-slogan {<br />
color: #fff;<br />
}<br />
<br />
.field-name-field-photo img {<br />
border: solid black 1px;<br />
}<br />
#main .views-view-grid img.default-pic,<br />
.field-name-field-photo img.default-pic {<br />
border: none;<br />
}<br />
#main .views-view-grid td,<br />
#main .views-view-grid tr td,<br />
#main .views-view-grid tr th,<br />
#main table.views-view-grid {<br />
background: transparent;<br />
border: 0;<br />
-moz-border-radius: 15px;<br />
border-radius: 15px;<br />
}<br />
#main .views-view-grid img,<br />
#main .view-header img {<br />
border: solid black 1px;<br />
float: left;<br />
margin: 0 15px 15px 0;<br />
}<br />
.view-team h3 {<br />
color: black;<br />
}<br />
.view-team .views-label {<br />
font-size: 1.4em;<br />
color: #C4C487;<br />
}<br />
.view-team a.username {<br />
font-size: 22pt;<br />
color: white;<br />
}<br />
#main .view-team div.field-content {<br />
padding: 0;<br />
margin: 0;<br />
line-height: 20px;<br />
}<br />
.view-team td {<br />
width: 50%;<br />
height: 150px;<br />
vertical-align: top;<br />
}<br />
.aseato {<br />
color: black;<br />
font-size: 1.4em;<br />
}<br />
<br />
#top-main-menu {<br />
width: 100%;<br />
height: 30px;<br />
text-align: center;<br />
position: absolute;<br />
top: 0;<br />
left: 0;<br />
margin: 0;<br />
background: black;<br />
font-size: 15px;<br />
z-index: 10;<br />
}<br />
#top-main-menu li {<br />
display: inline-block;<br />
padding-right: 15px;<br />
}<br />
#top-main-menu li a {<br />
color: white;<br />
}<br />
#top-main-menu a:hover,<br />
#top-main-menu a.active {<br />
color: #757418;<br />
}<br />
<br />
#flickr-images li {<br />
list-style: none;<br />
display: inline-block;<br />
padding: 7px 9px;<br />
}<br />
#flickr-images li img {<br />
border: solid black 1px;<br />
}<br />
<br />
table a:link, table a:visited, table a:active {<br />
color: black;<br />
text-decoration: underline;<br />
}<br />
table a:hover {<br />
color: black;<br />
text-decoration: underline;<br />
}<br />
<br />
li {<br />
list-style-image: none;<br />
list-style-type: square;<br />
}<br />
<br />
li li {<br />
list-style-image: none;<br />
list-style-type: circle;<br />
}<br />
<br />
img.border {<br />
border: solid black 1px;<br />
}<br />
</style></nowiki><br />
</head><br />
</html></div>
Sararobertson
http://2012.igem.org/File:Aseatobacter-NAV-Attributions.png
File:Aseatobacter-NAV-Attributions.png
2012-10-03T05:41:07Z
<p>Sararobertson: </p>
<hr />
<div></div>
Sararobertson
http://2012.igem.org/File:Aseatobacter-NAV-Project.png
File:Aseatobacter-NAV-Project.png
2012-10-03T05:40:38Z
<p>Sararobertson: </p>
<hr />
<div></div>
Sararobertson