http://2012.igem.org/wiki/index.php?title=Special:Contributions/Pablinitus&feed=atom&limit=50&target=Pablinitus&year=&month=2012.igem.org - User contributions [en]2024-03-29T07:16:49ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/Team:Freiburg/HumanPractices/PhiloTeam:Freiburg/HumanPractices/Philo2012-12-10T17:34:22Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
= 1. PHILOSOPHICAL ANALYSIS =<br />
----<br />
<br><br />
<br />
{|align="center"<br />
|[[Image:Philo.png|500px|link=]]<br />
|}<br />
<br><br />
<p style= "font-size: 17px;color: #1c649f;margin:3em;font-family: Calibri">'''''"Pablo and the iGEM-Team Freiburg delve deep into biological theory and philosophy without losing sight of ethical implications of these issues.<br> A truly impressive accomplishment!"'''''</p><br />
:::[http://www.egm.uni-freiburg.de/institut/Mitarbeiter/mitarbeiter_boldt Dr. Joachim Boldt] <br> Institute of Ethics and the History of Medicine, Albert-Ludwigs-University of Freiburg<br />
<br />
<br><br />
== <div id="Essay">1.1 Philosophical essay</div> ==<br />
----<br />
<br><br />
<div align="justify">Synthetic biology aspires to be an engineering discipline, with the aim of constructing artificial living systems as means to human ends. The products of synthetic biology ought to be ''living machines''. The ‘international Genetically Engineered Machine competition’ is prospectively raising a whole generation of future scientists trained in the methods of this novel field of synthetic biology. We believe that in this context the ‘Know How’ (procedure) needs to be accompanied with the ‘Know Why’ (causal knowledge), but most important by the often forgotten ‘Know What’ (meaning), because the emerging of every new engineering discipline brings not only chances but also risks, uncertainties, and worries. There is no doubt that the field of synthetic biology promises a large number of meaningful applications and solutions for many present problems. However, at the same time, many social, ethical and legal problems are being revealed by the claim of the creation of ‘artificial living systems’ or ‘living machines’. We need to ask ourselves: ‘what are we actually doing?’, ‘what are living machines good for?’ and also ‘what are they ''in themselves''?’. Any ''ad-hoc'' answer to these questions would lead to a misjudgement of the arising problems.<br />
<br />
Our iGEM-team tried to leave aside any preconceived opinion and to make a profound critical analysis of the actual source of the nascent public concerns (dual-use-dilemma, ‘playing god’, biosafety, biosecurity, etc). We did not only meet for lab meetings, but for philosophical evenings as well: Together with scholars from diverse fields of science, we discuss core philosophical aspects of synthetic biology, focussing on the ontology of the products of synthetic biology (see [[#Chronicle|'Chronicle of philosophical evenings']]). What do we actually mean by expressions like ‘living machines’ and ‘artificial life’? To answer these questions, we studied modern approaches of philosophy of language (e.g. theory of conceptual metaphors), philosophy of technology (e.g. ICE-theory for the ascription of technical functions), philosophy of biology (e.g. organisational account of biological functions) and diverse bioethical theories (e.g. Taylor’s biocentric position). Through our deliberations, we came to the conclusion that many apparent ontological and ethical problems concerning synthetic biology and its aimed products are actually epistemological and semantical ones, which arise due to its ‘intentional epistemology’ and the unreflective use of innovative metaphors such as ‘living machine’. Our analysis pointed out important epistemological deficits of synthetic biology such as the unjustified methodological principle of ‘knowing by doing’, a tailor-made notion of life and the metaphoric character of its main terms. Pablo Rodrigo Grassi, one of our team members, took the challenge and collected the different thoughts of our discussions building a coherent text:<br />
<br><br><br><br />
<div style="color: #1c649f; font-size: 15px; text-indent:0px;">''''‘LIVING MACHINES’, METAPHORS AND FUNCTIONAL EXPLANATIONS – Towards an epistemological foundation of synthetic biology '''</div><br />
<br><br />
<br />
<div style="text-indent:40px; color: #1c649f; font-size: 15px;"><br />
'''SHORT ABSTRACT'''</div><br />
<div style=margin:3em>The analysis of the innovative term ‘living machine’ in this essay describes a novel argumentation, which combines advanced theories of philosophy of technology and philosophy of biology and allows us to make clear distinctions between organisms and machines. Out of the exposed accounts in the essay, is it justified to assert that living beings emerge and develop ‘naturally’ and are, in their development, under no circumstances dependent on human agency. This makes any ontological distinction between ‘living machines’ and ‘living organisms’ and between ‘artificial life’ and ‘natural life’ pointless. Therefore, it is not warranted to use hybrid expressions (e.g. ‘synthetic life’, ‘living machines’, ‘genetically engineered machines’) as proper terms; however, their usage as ''metaphors'' may be warranted. This essay argues for the reflexive and not constitutive use of metaphors in the language of the synthetic biology in order to avoid faulty inferences. On the one hand, this essay enables to allay the global unease concerning the idea of creation of life and the notion of ‘living machine’, because, according to our argumentation, no creation of life and no ‘living machine’ is possible at all. On the other hand, this essay shows some important aspects which are required for consolidating a clear and coherent epistemology of synthetic biology. Moreover, based on the conduced analysis of biological functions in our essay, the outline of a consistent biocentric ethic which also includes the products of synthetic biology, is possible.</div><br />
<html><br />
<div style="text-indent:40px;font-size:10px"><br />
Please write an email to the following adress to get the full essay: Pablo.Grassi(at)neptun.uni-freiburg.de<br />
</html><br />
__NOTOC__<br />
</div><br />
<br />
<br />
<br><br />
<br />
==<div id="Chronicle">1.2 Chronicle of the philosophical evenings</div>==<br />
----<br />
<br><br><br />
In this section we would like to describe the development of our arguments and thoughts concerning the epistemological roots of synthetic biology and the different arising problems. Through these 'philosophical evenings' we examined in detail if the expression 'living machine' can really be considered to be a proper term or if it is necessarily a metaphor. We inquired together if this novel categorisation and kind-setting ('living machine') is actually warranted or not. Although our chronicles might wake the feeling of straightforwardness, this was not really the case. In fact, we needed hours of discussions, sanguine brainstorming and intensive reading to archieve our final arguments. Clearly, not all of the team members were the same opinion through our deliberations and it took time to find our common premises and starting points. But once we cleared up our diverse positions, we were able to do a fine work together! Although we also wanted to describe these different aspects and opinions through our discussions, we decided to simply present the thread and fruits of our philosophical evenings. <br />
<br><br><br />
<br />
{|align="center"<br />
|[[Image:PhilSeminar.jpg|center|500px|link=]]<br />
|}<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''First meeting - Introduction'''</div><br />
After a short introduction to the ''definition, aims'' and ''different approaches'' of the synthetic biology ([1],[2],[3],[4]), we clarified some special philosophical terms in order to have a common basis for further discussion. During the first meeting, we soon realised that the synthetic biology grounds on a different epistemology than the fields of ‘pure sciences’ do.<br />
<br />
Publications we worked with:<br />
<br />
:[1] Arkin A et al (2009): Synthetic biology: what’s in a name? ''Nat Biotechn'' 27 (12): 1071–1073<br><br />
:[2] Benner SA, Sismour AM (2005): Synthetic biology. ''Nat Rev Gen'' 6: 533-543<br><br />
:[3] Boldt J, Müller O, Maio G (2009): ''Synthetische Biologie. Eine ethisch-philosophische Analyse''. EKAH, Bern<br><br />
:[4] O'Malley M, Powell A, Davies JF, Calvert J (2008): Knowledge-making distinctions in synthetic biology.'' Bioessays'' 30: 57-65<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Second meeting - Epistemology'''</div><br />
In our second meeting we tried to work out what the special epistemological characteristics of an applied science are [5]. We expounded the general epistemological problems and possibilities of an engineering discipline. We noticed that ''causal knowledge'' and natural laws are not the main aim of an engineering discipline. Rather, the main aim is for ''efficient maxims'' and sufficient rules: In order to judge a technological system we only refer to it's efficiency - we just see if something works or not. In the epistemology of technological sciences the concept of efficiency plays a similar role to that which the concept of truth plays in the epistemology pure sciences, since scientific theories are judged by their truth value. Therefore, if the synthetic biology aspires to define itself as an engineering discipline, then the aim of knowledge-making is necessarily non-substantial [6].<br />
<br />
Publications we worked with:<br />
<br />
:[5] Bunge M (1974): Technology as applied science. In: Rapp F (ed.) ''Contributions to a Philosophy of Technology: Readings in the Philosophical Problems of Technology.'' Free Press, New York. 19-39<br><br />
:[6] Schummer J (2011): ''Das Gotteshandwerk. Die künstliche Herstellung von Leben im Labor.'' Suhrkamp, Berlin<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Third meeting - Procedure'''</div><br />
After asserting that synthetic biology follows an ‘intentional epistemology’, we analysed the conceptual procedure of synthetic biology. In view of the fact that the synthetic biology aims to create life, a consistent definition of the phenomena of life is needed, in order to have a reasonable goal ([7],[8]). Interestingly, the conception of life in synthetic biology matches with the settled purposes [9]. The understanding of life is adjusted to the notion of things that humans can make, modify and comprehend. Thus, the field of synthetic biology approaches ''biological systems as technological systems'' ([10],[11]). In this context, the ''analogical transfer'' from technological properties into the realm of the living can be understood as the epistemological program of synthetic biology. This transfer then promotes the aim of creating life, as it provides an understanding of life which makes such a feat possible in the first place. In short: within the field of synthetic biology, we encounter living beings ''as if'' they were machines. <br />
<br />
Publications we worked with:<br />
<br />
:[7] Brenner A (2007): ''Leben. Eine philosophische Untersuchung.'' EKAH, Bern<br><br />
:[8] Brenner A (2011): Living life and making life. ''Analecta Husserliana'' 110: 91-102<br><br />
:[9] Deplazes-Zemp A (2011): The Conception of Life in Synthetic Biology. Sci Eng Ethics doi:10.1007/s11948-011-9269-z <br><br />
:[10] Deplazes A, Huppenbauer M (2009): Synthetic organisms and living machines: Positioning the products of synthetic biology at the borderline between living and non-living matter. ''Syst Synth Bio'' 3(1-4): 55-63<br><br />
:[11] Schyfter P (2012): Technological biology? Things and kinds in synthetic biology. ''Biol Philos'' 27: 29-48<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Forth meeting - Metaphors'''</div><br />
Because synthetic biology approaches biological systems as technological systems by means of analogy, we examined the general concept of metaphors ([12],[13],[14]) and the epistemic value of inference from analogies. Through this examination, two problems became clear: First, because conceptual metaphors constitute of a way to see, think and act towards things [14], it is necessary to inquiry how our position towards life might change in the light of it as a machine [3]. Second, if synthetic biology does base upon a series of conceptual metaphors, which are not identified as such, then serious epistemological problems exist. All inference from the inductive argument of analogy is to be considered invalid: We might try and understand living beings as machines – that, however, does not impy that they indeed behave as such. <br />
<br />
Publications we worked with: <br />
<br />
:[12] Black M (1954): Metaphor. ''Proc Aristo Soc'' 55: 273-294<br><br />
:[13] Black M (1979): More about Metaphor. In: Ortony A (ed.): ''Metaphor and thought.'' Cambridge University Press, Cambridge. 19-43 <br><br />
:[14] Lakoff G (1993): The contemporary theory of metaphor. In: Ortony A (ed.): ''Metaphor and thought.'' Cambridge University Press, Cambridge. 202-251 <br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Fifth meeting - Necessary properties of a ‘living machine’'''</div><br />
In our firth meeting, we discussed about the necessary properties that a living beings needs to have in order to be considered a ‘living machine’ ([8],[10],[11],[15]). For the following meetings we decided to analyse in detail the properties of ''artificiality'' and ''technical functionality'', as machines are usually understood as physical objects, which were intentionally produced by human beings to achieve certain goals. Only if we can justify why products of synthetic biology are artificial and why do they have a technical function, we can use the expression ‘living machine’ as a proper term.<br />
<br />
Publications we worked with:<br />
<br />
:[15] Schark M (2012): Synthetic Biology and the Distinction between Organisms and Machines. ''Environ. Values'' 21: 19-41<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Sixth meeting - Artificiality'''</div><br />
Our inquiry of artificiality showed that we ought not to use the adjective ‘artificial’ as an honorary title. Due to the existing continuum between the natural and the artificial (e.g. [16]), we cannot argue that something is simply natural or simply artificial. A bioengineering product is less artificial than Venter’s ''Synthia'', which is respectively less artificial than a product of the protocell approach. All the products of synthetic biology are not simply ‘artificial life’: a bioengineering product has ‘artificial parts’, a synthetic genomics product an ‘artificial genome’ and, according to our argumentation, only the bottom-up protocell approach might be capable of producing entities, which could be meaningfully called as a whole ‘artificial life’ or ‘synthetic life’. Thus, all references to biological systems with the adjectives ‘artificial’ or ‘synthetic’ not being marked as a ''metaphor'' or as a ''future aim'' are therefore not warranted. <br />
<br />
Publications we worked with:<br />
<br />
:[16] Sandler R (2012): Is artefactualness a value-relevant property of living beings? ''Synthese'' 185: 89-102 <br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Seventh meeting - Technical functionality: the overdetermination problem'''</div><br />
<br />
The following necessary property we examined was the ''technical functionality'', because machines are not only made by humans, they are also supposed to have a useful function: a machine needs to be constructed with the intention to be a helpful mean to some human end. Although many of the scholars who worked on the products of synthetic biology accepted almost unproblematicly that the synthetic entities have technical functions (e.g. [10],[11],[17]), we wanted to examine in detail the idea of a synthetic biological product following a human-set goal. For this, we decided to study the relation between ''technical functions'' and ''biological functions'', as the concept of a ‘living machine’ seems to have both of them. <br />
Generally, referring to a function supposes to explain why its correspondent function bearer occurs and why it is there [18]. For example: if someone asks what a knife is, then we usually appeal to its function as cutting and stabbing tool and if someone asks what a heart is, then we answer referring to its function of pumping blood. Hence, functions are good for causal explanations. However, regarding the products of the synthetic biology we have an ''overdetermination problem'', because we can explain what a trait is referring to both, technical functions and biological functions. Imagine following situation:<br />
<br />
<p style=margin:3em>A synthetic biologist produces modified bacteria which are susceptible to glucose and that assist the treatment of diabetes in human beings. These bioengineered bacteria have a synthetic toggle switch which is activated when blood sugar levels reaches a tolerance threshold and allows the transcription of a substance to help the uptake of glucose from the blood. The decrease of glucose in blood allows the bacteria to live on.</p><br />
<br />
If we want to explain why the bacteria have a toggle switch, we can say two things: this toggle switch enables the production of a substance, which decreases the amount of blood sugar and hence helps the treatment of diabetes ''or'' this toggle switch enables the production of a substance which decreases the amount of blood sugar and is therefore beneficial for the bacteria (and the occurrence of this toggle switch in the bacteria is the result of a feedback mechanisms involving the exercise of producing the substance). The bacteria also have a synthetic toggle switch, because it was constructed so or because it helps the whole system to live. If both functional explanations are correct ''in the same context'', then we have a faulty overdetermination (two causes for one effect).<br />
<br />
Publications we worked with:<br />
<br />
:[17] Holm S (2011a): Biocentrism and Synthetic Biology. ''App Ethics'' 62-74<br><br />
:[18] Krohs U, Kroes P (eds) (2009): ''Functions in biological artificial worlds''. MIT press, Cambridge<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Eighth meeting - Technical functionality: solution'''</div><br />
<br />
We decided to work with two different theories of functions in order to encounter the abovementioned overdetermination problem. On the one hand we studied the ICE-theory for the ascription of technical functions by agents ([19],[20]). On the other hand we studied the organisational account of biological functions ([21],[22],[23]). By the products of synthetic biology both ascriptions of functions are possible – although we noticed that the technical function ascription applies imperfectly. Through the analysis of specific situations and counterexamples we showed that the technical function ascription is neither necessary nor sufficient to explain the products of synthetic biology ''per se''. The explanation based on biological functions makes a closure, due to the circular causality of living systems, which makes every reference to human intentionality dispensable. To make this account clear, we can examine the following example: <br />
<br><br><br><br />
<div style="color: #1c649f; text-align: center; font-size: 12px; text-indent:0px;">'''The hidden entities'''</div><br />
<p style=margin:3em>In a fictive secret part of our world a civilisation of human beings with an impressive scientific knowledge existed. They constructed impressive machine-like entities, which were capable of moving around and do things, but not to (re)produce, maintain and organize themselves. Using artificial organic materials they also constructed some bacteria-like living entities, which were able to absolve self-production, self-maintenance and self-organisation. This civilisation was destroyed without leaving anything but these two kinds of entities. We now find these entities, without knowledge of the past civilisation, and try to explain them.</p><br />
The explanation of the machine-like entities is ad-hoc not possible at all. One could try to explain them under the terms of their physical structures, but certainly without luck. One would probably make an ‘inference to the best explanation’ and, because these functioning machine-like entities cannot (re)produce, maintain and organise themselves, conclude that they were made by intentional beings. In contrast, no reference to human intentionality is needed by the explanation of the bacteria-like entities. A sufficient explanation of these entities can be given by just referring to the circular causality they own. The ahistorical circular causality makes any external cause unnecessary. These considerations show that in the moment in which we are capable of ascribing biological functions to an entity, all references to an ‘intelligent designer’ to explain this entity in itself is dispensable. Therefore, we conclude that the ascription of technical functions to the products of synthetic biology is only possible regarding a human context, but not if we want to describe what they are in themselves. Thus, it is not warranted to say that the synthetic entities follow a ‘human aim’. Moreover, this analysis allows a clear distinction between machines and living beings, making the expression ‘living machine’ necessarily a metaphor.<br />
<br />
Publications we worked with:<br><br />
<br />
:[19] Vermaas, PE (2006): The physical connection: Engineering function ascriptions to technical artefacts and their components. ''Stud Hist Philos Sci'' A 37: 62-75<br><br />
:[20] Vermaas, PE, Houkes, W (2006): Technical functions: A drawbridge between the intentional and structural natures of technical artefacts. ''Stud Hist Philos Sci'' 37: 5-18<br><br />
:[21] McLaughlin, P (2001): ''What Functions Explain. Functional Explanation and Self-reproducing Systems.'' Cambridge University Press, Cambridge<br><br />
:[22] Mossio M, Saborido C, Moreno A (2009): An Organizational Account of Biological Functions. ''Br J Philos Sci'' 60(4): 813-841<br><br />
:[23] Saborido C, Mossio M, Moreno A (2011). Biological organization and cross-generation functions. ''Br J Philos Sc'' 62: 583-606<br><br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Ninth meeting - Conclusion and ethics'''</div><br />
<br />
Finally, we discussed in our last meeting about the implications of our epistemological analysis for the synthetic biology and for society. In addition we studied different ethical approaches and tried to apply them to the products of synthetic biology ([16],[17],[24],[25]). Many of the approaches failed to justify if the synthesised entities have a moral status or not, revealing the necessity of novel bioethical theories. Some of our team members sympathises with Sune Holm’s biocentric view, because he also refers to the organisational account of biological functions for the foundation of his position ([17],[25]). Some other team members believe that the notion of a ‘natural purpose’ and the naturalisation of teleology and normativity (as the organisational account does) need further examination.<br />
<br />
Publications we worked with: <br><br />
<br />
:[24] Krebs A (eds) (1997): ''Naturethik. Grundtexte der gegenwärtigen tier- und ökologischen Diskussion.'' Suhrkamp, Frankfurt a.M. <br><br />
:[25] Holm S (2011b): Biological Interests, Normative Functions and Synthetic Biology. ''Philos Technol'' doi:10.1007/s13347-012-0075-6<br />
<br />
<br />
<br />
<br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/HumanPractices/PhiloTeam:Freiburg/HumanPractices/Philo2012-12-10T17:33:52Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
= 1. PHILOSOPHICAL ANALYSIS =<br />
----<br />
<br><br />
<br />
{|align="center"<br />
|[[Image:Philo.png|500px|link=]]<br />
|}<br />
<br><br />
<p style= "font-size: 17px;color: #1c649f;margin:3em;font-family: Calibri">'''''"Pablo and the iGEM-Team Freiburg delve deep into biological theory and philosophy without losing sight of ethical implications of these issues.<br> A truly impressive accomplishment!"'''''</p><br />
:::[http://www.egm.uni-freiburg.de/institut/Mitarbeiter/mitarbeiter_boldt Dr. Joachim Boldt] <br> Institute of Ethics and the History of Medicine, Albert-Ludwigs-University of Freiburg<br />
<br />
<br><br />
== <div id="Essay">1.1 Philosophical essay</div> ==<br />
----<br />
<br><br />
<div align="justify">Synthetic biology aspires to be an engineering discipline, with the aim of constructing artificial living systems as means to human ends. The products of synthetic biology ought to be ''living machines''. The ‘international Genetically Engineered Machine competition’ is prospectively raising a whole generation of future scientists trained in the methods of this novel field of synthetic biology. We believe that in this context the ‘Know How’ (procedure) needs to be accompanied with the ‘Know Why’ (causal knowledge), but most important by the often forgotten ‘Know What’ (meaning), because the emerging of every new engineering discipline brings not only chances but also risks, uncertainties, and worries. There is no doubt that the field of synthetic biology promises a large number of meaningful applications and solutions for many present problems. However, at the same time, many social, ethical and legal problems are being revealed by the claim of the creation of ‘artificial living systems’ or ‘living machines’. We need to ask ourselves: ‘what are we actually doing?’, ‘what are living machines good for?’ and also ‘what are they ''in themselves''?’. Any ''ad-hoc'' answer to these questions would lead to a misjudgement of the arising problems.<br />
<br />
Our iGEM-team tried to leave aside any preconceived opinion and to make a profound critical analysis of the actual source of the nascent public concerns (dual-use-dilemma, ‘playing god’, biosafety, biosecurity, etc). We did not only meet for lab meetings, but for philosophical evenings as well: Together with scholars from diverse fields of science, we discuss core philosophical aspects of synthetic biology, focussing on the ontology of the products of synthetic biology (see [[#Chronicle|'Chronicle of philosophical evenings']]). What do we actually mean by expressions like ‘living machines’ and ‘artificial life’? To answer these questions, we studied modern approaches of philosophy of language (e.g. theory of conceptual metaphors), philosophy of technology (e.g. ICE-theory for the ascription of technical functions), philosophy of biology (e.g. organisational account of biological functions) and diverse bioethical theories (e.g. Taylor’s biocentric position). Through our deliberations, we came to the conclusion that many apparent ontological and ethical problems concerning synthetic biology and its aimed products are actually epistemological and semantical ones, which arise due to its ‘intentional epistemology’ and the unreflective use of innovative metaphors such as ‘living machine’. Our analysis pointed out important epistemological deficits of synthetic biology such as the unjustified methodological principle of ‘knowing by doing’, a tailor-made notion of life and the metaphoric character of its main terms. Pablo Rodrigo Grassi, one of our team members, took the challenge and collected the different thoughts of our discussions building a coherent text:<br />
<br><br><br><br />
<div style="color: #1c649f; font-size: 15px; text-indent:0px;">''''‘LIVING MACHINES’, METAPHORS AND FUNCTIONAL EXPLANATIONS – Towards an epistemological foundation of synthetic biology '''</div><br />
<br><br />
<br />
<div style="text-indent:40px; color: #1c649f; font-size: 15px;"><br />
'''SHORT ABSTRACT'''</div><br />
<div style=margin:3em>The analysis of the innovative term ‘living machine’ in this essay describes a novel argumentation, which combines advanced theories of philosophy of technology and philosophy of biology and allows us to make clear distinctions between organisms and machines. Out of the exposed accounts in the essay, is it justified to assert that living beings emerge and develop ‘naturally’ and are, in their development, under no circumstances dependent on human agency. This makes any ontological distinction between ‘living machines’ and ‘living organisms’ and between ‘artificial life’ and ‘natural life’ pointless. Therefore, it is not warranted to use hybrid expressions (e.g. ‘synthetic life’, ‘living machines’, ‘genetically engineered machines’) as proper terms; however, their usage as ''metaphors'' may be warranted. This essay argues for the reflexive and not constitutive use of metaphors in the language of the synthetic biology in order to avoid faulty inferences. On the one hand, this essay enables to allay the global unease concerning the idea of creation of life and the notion of ‘living machine’, because, according to our argumentation, no creation of life and no ‘living machine’ is possible at all. On the other hand, this essay shows some important aspects which are required for consolidating a clear and coherent epistemology of synthetic biology. Moreover, based on the conduced analysis of biological functions in our essay, the outline of a consistent biocentric ethic which also includes the products of synthetic biology, is possible.</div><br />
<html><br />
<div style="text-indent:20px;font-size:16px"><br />
Please write an email to the following adress to get the full essay: Pablo.Grassi(at)neptun.uni-freiburg.de<br />
</html><br />
__NOTOC__<br />
</div><br />
<br />
<br />
<br><br />
<br />
==<div id="Chronicle">1.2 Chronicle of the philosophical evenings</div>==<br />
----<br />
<br><br><br />
In this section we would like to describe the development of our arguments and thoughts concerning the epistemological roots of synthetic biology and the different arising problems. Through these 'philosophical evenings' we examined in detail if the expression 'living machine' can really be considered to be a proper term or if it is necessarily a metaphor. We inquired together if this novel categorisation and kind-setting ('living machine') is actually warranted or not. Although our chronicles might wake the feeling of straightforwardness, this was not really the case. In fact, we needed hours of discussions, sanguine brainstorming and intensive reading to archieve our final arguments. Clearly, not all of the team members were the same opinion through our deliberations and it took time to find our common premises and starting points. But once we cleared up our diverse positions, we were able to do a fine work together! Although we also wanted to describe these different aspects and opinions through our discussions, we decided to simply present the thread and fruits of our philosophical evenings. <br />
<br><br><br />
<br />
{|align="center"<br />
|[[Image:PhilSeminar.jpg|center|500px|link=]]<br />
|}<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''First meeting - Introduction'''</div><br />
After a short introduction to the ''definition, aims'' and ''different approaches'' of the synthetic biology ([1],[2],[3],[4]), we clarified some special philosophical terms in order to have a common basis for further discussion. During the first meeting, we soon realised that the synthetic biology grounds on a different epistemology than the fields of ‘pure sciences’ do.<br />
<br />
Publications we worked with:<br />
<br />
:[1] Arkin A et al (2009): Synthetic biology: what’s in a name? ''Nat Biotechn'' 27 (12): 1071–1073<br><br />
:[2] Benner SA, Sismour AM (2005): Synthetic biology. ''Nat Rev Gen'' 6: 533-543<br><br />
:[3] Boldt J, Müller O, Maio G (2009): ''Synthetische Biologie. Eine ethisch-philosophische Analyse''. EKAH, Bern<br><br />
:[4] O'Malley M, Powell A, Davies JF, Calvert J (2008): Knowledge-making distinctions in synthetic biology.'' Bioessays'' 30: 57-65<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Second meeting - Epistemology'''</div><br />
In our second meeting we tried to work out what the special epistemological characteristics of an applied science are [5]. We expounded the general epistemological problems and possibilities of an engineering discipline. We noticed that ''causal knowledge'' and natural laws are not the main aim of an engineering discipline. Rather, the main aim is for ''efficient maxims'' and sufficient rules: In order to judge a technological system we only refer to it's efficiency - we just see if something works or not. In the epistemology of technological sciences the concept of efficiency plays a similar role to that which the concept of truth plays in the epistemology pure sciences, since scientific theories are judged by their truth value. Therefore, if the synthetic biology aspires to define itself as an engineering discipline, then the aim of knowledge-making is necessarily non-substantial [6].<br />
<br />
Publications we worked with:<br />
<br />
:[5] Bunge M (1974): Technology as applied science. In: Rapp F (ed.) ''Contributions to a Philosophy of Technology: Readings in the Philosophical Problems of Technology.'' Free Press, New York. 19-39<br><br />
:[6] Schummer J (2011): ''Das Gotteshandwerk. Die künstliche Herstellung von Leben im Labor.'' Suhrkamp, Berlin<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Third meeting - Procedure'''</div><br />
After asserting that synthetic biology follows an ‘intentional epistemology’, we analysed the conceptual procedure of synthetic biology. In view of the fact that the synthetic biology aims to create life, a consistent definition of the phenomena of life is needed, in order to have a reasonable goal ([7],[8]). Interestingly, the conception of life in synthetic biology matches with the settled purposes [9]. The understanding of life is adjusted to the notion of things that humans can make, modify and comprehend. Thus, the field of synthetic biology approaches ''biological systems as technological systems'' ([10],[11]). In this context, the ''analogical transfer'' from technological properties into the realm of the living can be understood as the epistemological program of synthetic biology. This transfer then promotes the aim of creating life, as it provides an understanding of life which makes such a feat possible in the first place. In short: within the field of synthetic biology, we encounter living beings ''as if'' they were machines. <br />
<br />
Publications we worked with:<br />
<br />
:[7] Brenner A (2007): ''Leben. Eine philosophische Untersuchung.'' EKAH, Bern<br><br />
:[8] Brenner A (2011): Living life and making life. ''Analecta Husserliana'' 110: 91-102<br><br />
:[9] Deplazes-Zemp A (2011): The Conception of Life in Synthetic Biology. Sci Eng Ethics doi:10.1007/s11948-011-9269-z <br><br />
:[10] Deplazes A, Huppenbauer M (2009): Synthetic organisms and living machines: Positioning the products of synthetic biology at the borderline between living and non-living matter. ''Syst Synth Bio'' 3(1-4): 55-63<br><br />
:[11] Schyfter P (2012): Technological biology? Things and kinds in synthetic biology. ''Biol Philos'' 27: 29-48<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Forth meeting - Metaphors'''</div><br />
Because synthetic biology approaches biological systems as technological systems by means of analogy, we examined the general concept of metaphors ([12],[13],[14]) and the epistemic value of inference from analogies. Through this examination, two problems became clear: First, because conceptual metaphors constitute of a way to see, think and act towards things [14], it is necessary to inquiry how our position towards life might change in the light of it as a machine [3]. Second, if synthetic biology does base upon a series of conceptual metaphors, which are not identified as such, then serious epistemological problems exist. All inference from the inductive argument of analogy is to be considered invalid: We might try and understand living beings as machines – that, however, does not impy that they indeed behave as such. <br />
<br />
Publications we worked with: <br />
<br />
:[12] Black M (1954): Metaphor. ''Proc Aristo Soc'' 55: 273-294<br><br />
:[13] Black M (1979): More about Metaphor. In: Ortony A (ed.): ''Metaphor and thought.'' Cambridge University Press, Cambridge. 19-43 <br><br />
:[14] Lakoff G (1993): The contemporary theory of metaphor. In: Ortony A (ed.): ''Metaphor and thought.'' Cambridge University Press, Cambridge. 202-251 <br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Fifth meeting - Necessary properties of a ‘living machine’'''</div><br />
In our firth meeting, we discussed about the necessary properties that a living beings needs to have in order to be considered a ‘living machine’ ([8],[10],[11],[15]). For the following meetings we decided to analyse in detail the properties of ''artificiality'' and ''technical functionality'', as machines are usually understood as physical objects, which were intentionally produced by human beings to achieve certain goals. Only if we can justify why products of synthetic biology are artificial and why do they have a technical function, we can use the expression ‘living machine’ as a proper term.<br />
<br />
Publications we worked with:<br />
<br />
:[15] Schark M (2012): Synthetic Biology and the Distinction between Organisms and Machines. ''Environ. Values'' 21: 19-41<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Sixth meeting - Artificiality'''</div><br />
Our inquiry of artificiality showed that we ought not to use the adjective ‘artificial’ as an honorary title. Due to the existing continuum between the natural and the artificial (e.g. [16]), we cannot argue that something is simply natural or simply artificial. A bioengineering product is less artificial than Venter’s ''Synthia'', which is respectively less artificial than a product of the protocell approach. All the products of synthetic biology are not simply ‘artificial life’: a bioengineering product has ‘artificial parts’, a synthetic genomics product an ‘artificial genome’ and, according to our argumentation, only the bottom-up protocell approach might be capable of producing entities, which could be meaningfully called as a whole ‘artificial life’ or ‘synthetic life’. Thus, all references to biological systems with the adjectives ‘artificial’ or ‘synthetic’ not being marked as a ''metaphor'' or as a ''future aim'' are therefore not warranted. <br />
<br />
Publications we worked with:<br />
<br />
:[16] Sandler R (2012): Is artefactualness a value-relevant property of living beings? ''Synthese'' 185: 89-102 <br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Seventh meeting - Technical functionality: the overdetermination problem'''</div><br />
<br />
The following necessary property we examined was the ''technical functionality'', because machines are not only made by humans, they are also supposed to have a useful function: a machine needs to be constructed with the intention to be a helpful mean to some human end. Although many of the scholars who worked on the products of synthetic biology accepted almost unproblematicly that the synthetic entities have technical functions (e.g. [10],[11],[17]), we wanted to examine in detail the idea of a synthetic biological product following a human-set goal. For this, we decided to study the relation between ''technical functions'' and ''biological functions'', as the concept of a ‘living machine’ seems to have both of them. <br />
Generally, referring to a function supposes to explain why its correspondent function bearer occurs and why it is there [18]. For example: if someone asks what a knife is, then we usually appeal to its function as cutting and stabbing tool and if someone asks what a heart is, then we answer referring to its function of pumping blood. Hence, functions are good for causal explanations. However, regarding the products of the synthetic biology we have an ''overdetermination problem'', because we can explain what a trait is referring to both, technical functions and biological functions. Imagine following situation:<br />
<br />
<p style=margin:3em>A synthetic biologist produces modified bacteria which are susceptible to glucose and that assist the treatment of diabetes in human beings. These bioengineered bacteria have a synthetic toggle switch which is activated when blood sugar levels reaches a tolerance threshold and allows the transcription of a substance to help the uptake of glucose from the blood. The decrease of glucose in blood allows the bacteria to live on.</p><br />
<br />
If we want to explain why the bacteria have a toggle switch, we can say two things: this toggle switch enables the production of a substance, which decreases the amount of blood sugar and hence helps the treatment of diabetes ''or'' this toggle switch enables the production of a substance which decreases the amount of blood sugar and is therefore beneficial for the bacteria (and the occurrence of this toggle switch in the bacteria is the result of a feedback mechanisms involving the exercise of producing the substance). The bacteria also have a synthetic toggle switch, because it was constructed so or because it helps the whole system to live. If both functional explanations are correct ''in the same context'', then we have a faulty overdetermination (two causes for one effect).<br />
<br />
Publications we worked with:<br />
<br />
:[17] Holm S (2011a): Biocentrism and Synthetic Biology. ''App Ethics'' 62-74<br><br />
:[18] Krohs U, Kroes P (eds) (2009): ''Functions in biological artificial worlds''. MIT press, Cambridge<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Eighth meeting - Technical functionality: solution'''</div><br />
<br />
We decided to work with two different theories of functions in order to encounter the abovementioned overdetermination problem. On the one hand we studied the ICE-theory for the ascription of technical functions by agents ([19],[20]). On the other hand we studied the organisational account of biological functions ([21],[22],[23]). By the products of synthetic biology both ascriptions of functions are possible – although we noticed that the technical function ascription applies imperfectly. Through the analysis of specific situations and counterexamples we showed that the technical function ascription is neither necessary nor sufficient to explain the products of synthetic biology ''per se''. The explanation based on biological functions makes a closure, due to the circular causality of living systems, which makes every reference to human intentionality dispensable. To make this account clear, we can examine the following example: <br />
<br><br><br><br />
<div style="color: #1c649f; text-align: center; font-size: 12px; text-indent:0px;">'''The hidden entities'''</div><br />
<p style=margin:3em>In a fictive secret part of our world a civilisation of human beings with an impressive scientific knowledge existed. They constructed impressive machine-like entities, which were capable of moving around and do things, but not to (re)produce, maintain and organize themselves. Using artificial organic materials they also constructed some bacteria-like living entities, which were able to absolve self-production, self-maintenance and self-organisation. This civilisation was destroyed without leaving anything but these two kinds of entities. We now find these entities, without knowledge of the past civilisation, and try to explain them.</p><br />
The explanation of the machine-like entities is ad-hoc not possible at all. One could try to explain them under the terms of their physical structures, but certainly without luck. One would probably make an ‘inference to the best explanation’ and, because these functioning machine-like entities cannot (re)produce, maintain and organise themselves, conclude that they were made by intentional beings. In contrast, no reference to human intentionality is needed by the explanation of the bacteria-like entities. A sufficient explanation of these entities can be given by just referring to the circular causality they own. The ahistorical circular causality makes any external cause unnecessary. These considerations show that in the moment in which we are capable of ascribing biological functions to an entity, all references to an ‘intelligent designer’ to explain this entity in itself is dispensable. Therefore, we conclude that the ascription of technical functions to the products of synthetic biology is only possible regarding a human context, but not if we want to describe what they are in themselves. Thus, it is not warranted to say that the synthetic entities follow a ‘human aim’. Moreover, this analysis allows a clear distinction between machines and living beings, making the expression ‘living machine’ necessarily a metaphor.<br />
<br />
Publications we worked with:<br><br />
<br />
:[19] Vermaas, PE (2006): The physical connection: Engineering function ascriptions to technical artefacts and their components. ''Stud Hist Philos Sci'' A 37: 62-75<br><br />
:[20] Vermaas, PE, Houkes, W (2006): Technical functions: A drawbridge between the intentional and structural natures of technical artefacts. ''Stud Hist Philos Sci'' 37: 5-18<br><br />
:[21] McLaughlin, P (2001): ''What Functions Explain. Functional Explanation and Self-reproducing Systems.'' Cambridge University Press, Cambridge<br><br />
:[22] Mossio M, Saborido C, Moreno A (2009): An Organizational Account of Biological Functions. ''Br J Philos Sci'' 60(4): 813-841<br><br />
:[23] Saborido C, Mossio M, Moreno A (2011). Biological organization and cross-generation functions. ''Br J Philos Sc'' 62: 583-606<br><br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Ninth meeting - Conclusion and ethics'''</div><br />
<br />
Finally, we discussed in our last meeting about the implications of our epistemological analysis for the synthetic biology and for society. In addition we studied different ethical approaches and tried to apply them to the products of synthetic biology ([16],[17],[24],[25]). Many of the approaches failed to justify if the synthesised entities have a moral status or not, revealing the necessity of novel bioethical theories. Some of our team members sympathises with Sune Holm’s biocentric view, because he also refers to the organisational account of biological functions for the foundation of his position ([17],[25]). Some other team members believe that the notion of a ‘natural purpose’ and the naturalisation of teleology and normativity (as the organisational account does) need further examination.<br />
<br />
Publications we worked with: <br><br />
<br />
:[24] Krebs A (eds) (1997): ''Naturethik. Grundtexte der gegenwärtigen tier- und ökologischen Diskussion.'' Suhrkamp, Frankfurt a.M. <br><br />
:[25] Holm S (2011b): Biological Interests, Normative Functions and Synthetic Biology. ''Philos Technol'' doi:10.1007/s13347-012-0075-6<br />
<br />
<br />
<br />
<br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/HumanPractices/PhiloTeam:Freiburg/HumanPractices/Philo2012-12-10T17:33:21Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
= 1. PHILOSOPHICAL ANALYSIS =<br />
----<br />
<br><br />
<br />
{|align="center"<br />
|[[Image:Philo.png|500px|link=]]<br />
|}<br />
<br><br />
<p style= "font-size: 17px;color: #1c649f;margin:3em;font-family: Calibri">'''''"Pablo and the iGEM-Team Freiburg delve deep into biological theory and philosophy without losing sight of ethical implications of these issues.<br> A truly impressive accomplishment!"'''''</p><br />
:::[http://www.egm.uni-freiburg.de/institut/Mitarbeiter/mitarbeiter_boldt Dr. Joachim Boldt] <br> Institute of Ethics and the History of Medicine, Albert-Ludwigs-University of Freiburg<br />
<br />
<br><br />
== <div id="Essay">1.1 Philosophical essay</div> ==<br />
----<br />
<br><br />
<div align="justify">Synthetic biology aspires to be an engineering discipline, with the aim of constructing artificial living systems as means to human ends. The products of synthetic biology ought to be ''living machines''. The ‘international Genetically Engineered Machine competition’ is prospectively raising a whole generation of future scientists trained in the methods of this novel field of synthetic biology. We believe that in this context the ‘Know How’ (procedure) needs to be accompanied with the ‘Know Why’ (causal knowledge), but most important by the often forgotten ‘Know What’ (meaning), because the emerging of every new engineering discipline brings not only chances but also risks, uncertainties, and worries. There is no doubt that the field of synthetic biology promises a large number of meaningful applications and solutions for many present problems. However, at the same time, many social, ethical and legal problems are being revealed by the claim of the creation of ‘artificial living systems’ or ‘living machines’. We need to ask ourselves: ‘what are we actually doing?’, ‘what are living machines good for?’ and also ‘what are they ''in themselves''?’. Any ''ad-hoc'' answer to these questions would lead to a misjudgement of the arising problems.<br />
<br />
Our iGEM-team tried to leave aside any preconceived opinion and to make a profound critical analysis of the actual source of the nascent public concerns (dual-use-dilemma, ‘playing god’, biosafety, biosecurity, etc). We did not only meet for lab meetings, but for philosophical evenings as well: Together with scholars from diverse fields of science, we discuss core philosophical aspects of synthetic biology, focussing on the ontology of the products of synthetic biology (see [[#Chronicle|'Chronicle of philosophical evenings']]). What do we actually mean by expressions like ‘living machines’ and ‘artificial life’? To answer these questions, we studied modern approaches of philosophy of language (e.g. theory of conceptual metaphors), philosophy of technology (e.g. ICE-theory for the ascription of technical functions), philosophy of biology (e.g. organisational account of biological functions) and diverse bioethical theories (e.g. Taylor’s biocentric position). Through our deliberations, we came to the conclusion that many apparent ontological and ethical problems concerning synthetic biology and its aimed products are actually epistemological and semantical ones, which arise due to its ‘intentional epistemology’ and the unreflective use of innovative metaphors such as ‘living machine’. Our analysis pointed out important epistemological deficits of synthetic biology such as the unjustified methodological principle of ‘knowing by doing’, a tailor-made notion of life and the metaphoric character of its main terms. Pablo Rodrigo Grassi, one of our team members, took the challenge and collected the different thoughts of our discussions building a coherent text:<br />
<br><br><br><br />
<div style="color: #1c649f; font-size: 15px; text-indent:0px;">''''‘LIVING MACHINES’, METAPHORS AND FUNCTIONAL EXPLANATIONS – Towards an epistemological foundation of synthetic biology '''</div><br />
<br><br />
<br />
<div style="text-indent:40px; color: #1c649f; font-size: 15px;"><br />
'''SHORT ABSTRACT'''</div><br />
<div style=margin:3em>The analysis of the innovative term ‘living machine’ in this essay describes a novel argumentation, which combines advanced theories of philosophy of technology and philosophy of biology and allows us to make clear distinctions between organisms and machines. Out of the exposed accounts in the essay, is it justified to assert that living beings emerge and develop ‘naturally’ and are, in their development, under no circumstances dependent on human agency. This makes any ontological distinction between ‘living machines’ and ‘living organisms’ and between ‘artificial life’ and ‘natural life’ pointless. Therefore, it is not warranted to use hybrid expressions (e.g. ‘synthetic life’, ‘living machines’, ‘genetically engineered machines’) as proper terms; however, their usage as ''metaphors'' may be warranted. This essay argues for the reflexive and not constitutive use of metaphors in the language of the synthetic biology in order to avoid faulty inferences. On the one hand, this essay enables to allay the global unease concerning the idea of creation of life and the notion of ‘living machine’, because, according to our argumentation, no creation of life and no ‘living machine’ is possible at all. On the other hand, this essay shows some important aspects which are required for consolidating a clear and coherent epistemology of synthetic biology. Moreover, based on the conduced analysis of biological functions in our essay, the outline of a consistent biocentric ethic which also includes the products of synthetic biology, is possible.</div><br />
<html><br />
<div style="text-indent:40px;font-size:16px"><br />
Please write an email to the following adress to get the full essay: Pablo.Grassi(at)neptun.uni-freiburg.de<br />
</html><br />
__NOTOC__<br />
</div><br />
<br />
<br />
<br><br />
<br />
==<div id="Chronicle">1.2 Chronicle of the philosophical evenings</div>==<br />
----<br />
<br><br><br />
In this section we would like to describe the development of our arguments and thoughts concerning the epistemological roots of synthetic biology and the different arising problems. Through these 'philosophical evenings' we examined in detail if the expression 'living machine' can really be considered to be a proper term or if it is necessarily a metaphor. We inquired together if this novel categorisation and kind-setting ('living machine') is actually warranted or not. Although our chronicles might wake the feeling of straightforwardness, this was not really the case. In fact, we needed hours of discussions, sanguine brainstorming and intensive reading to archieve our final arguments. Clearly, not all of the team members were the same opinion through our deliberations and it took time to find our common premises and starting points. But once we cleared up our diverse positions, we were able to do a fine work together! Although we also wanted to describe these different aspects and opinions through our discussions, we decided to simply present the thread and fruits of our philosophical evenings. <br />
<br><br><br />
<br />
{|align="center"<br />
|[[Image:PhilSeminar.jpg|center|500px|link=]]<br />
|}<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''First meeting - Introduction'''</div><br />
After a short introduction to the ''definition, aims'' and ''different approaches'' of the synthetic biology ([1],[2],[3],[4]), we clarified some special philosophical terms in order to have a common basis for further discussion. During the first meeting, we soon realised that the synthetic biology grounds on a different epistemology than the fields of ‘pure sciences’ do.<br />
<br />
Publications we worked with:<br />
<br />
:[1] Arkin A et al (2009): Synthetic biology: what’s in a name? ''Nat Biotechn'' 27 (12): 1071–1073<br><br />
:[2] Benner SA, Sismour AM (2005): Synthetic biology. ''Nat Rev Gen'' 6: 533-543<br><br />
:[3] Boldt J, Müller O, Maio G (2009): ''Synthetische Biologie. Eine ethisch-philosophische Analyse''. EKAH, Bern<br><br />
:[4] O'Malley M, Powell A, Davies JF, Calvert J (2008): Knowledge-making distinctions in synthetic biology.'' Bioessays'' 30: 57-65<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Second meeting - Epistemology'''</div><br />
In our second meeting we tried to work out what the special epistemological characteristics of an applied science are [5]. We expounded the general epistemological problems and possibilities of an engineering discipline. We noticed that ''causal knowledge'' and natural laws are not the main aim of an engineering discipline. Rather, the main aim is for ''efficient maxims'' and sufficient rules: In order to judge a technological system we only refer to it's efficiency - we just see if something works or not. In the epistemology of technological sciences the concept of efficiency plays a similar role to that which the concept of truth plays in the epistemology pure sciences, since scientific theories are judged by their truth value. Therefore, if the synthetic biology aspires to define itself as an engineering discipline, then the aim of knowledge-making is necessarily non-substantial [6].<br />
<br />
Publications we worked with:<br />
<br />
:[5] Bunge M (1974): Technology as applied science. In: Rapp F (ed.) ''Contributions to a Philosophy of Technology: Readings in the Philosophical Problems of Technology.'' Free Press, New York. 19-39<br><br />
:[6] Schummer J (2011): ''Das Gotteshandwerk. Die künstliche Herstellung von Leben im Labor.'' Suhrkamp, Berlin<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Third meeting - Procedure'''</div><br />
After asserting that synthetic biology follows an ‘intentional epistemology’, we analysed the conceptual procedure of synthetic biology. In view of the fact that the synthetic biology aims to create life, a consistent definition of the phenomena of life is needed, in order to have a reasonable goal ([7],[8]). Interestingly, the conception of life in synthetic biology matches with the settled purposes [9]. The understanding of life is adjusted to the notion of things that humans can make, modify and comprehend. Thus, the field of synthetic biology approaches ''biological systems as technological systems'' ([10],[11]). In this context, the ''analogical transfer'' from technological properties into the realm of the living can be understood as the epistemological program of synthetic biology. This transfer then promotes the aim of creating life, as it provides an understanding of life which makes such a feat possible in the first place. In short: within the field of synthetic biology, we encounter living beings ''as if'' they were machines. <br />
<br />
Publications we worked with:<br />
<br />
:[7] Brenner A (2007): ''Leben. Eine philosophische Untersuchung.'' EKAH, Bern<br><br />
:[8] Brenner A (2011): Living life and making life. ''Analecta Husserliana'' 110: 91-102<br><br />
:[9] Deplazes-Zemp A (2011): The Conception of Life in Synthetic Biology. Sci Eng Ethics doi:10.1007/s11948-011-9269-z <br><br />
:[10] Deplazes A, Huppenbauer M (2009): Synthetic organisms and living machines: Positioning the products of synthetic biology at the borderline between living and non-living matter. ''Syst Synth Bio'' 3(1-4): 55-63<br><br />
:[11] Schyfter P (2012): Technological biology? Things and kinds in synthetic biology. ''Biol Philos'' 27: 29-48<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Forth meeting - Metaphors'''</div><br />
Because synthetic biology approaches biological systems as technological systems by means of analogy, we examined the general concept of metaphors ([12],[13],[14]) and the epistemic value of inference from analogies. Through this examination, two problems became clear: First, because conceptual metaphors constitute of a way to see, think and act towards things [14], it is necessary to inquiry how our position towards life might change in the light of it as a machine [3]. Second, if synthetic biology does base upon a series of conceptual metaphors, which are not identified as such, then serious epistemological problems exist. All inference from the inductive argument of analogy is to be considered invalid: We might try and understand living beings as machines – that, however, does not impy that they indeed behave as such. <br />
<br />
Publications we worked with: <br />
<br />
:[12] Black M (1954): Metaphor. ''Proc Aristo Soc'' 55: 273-294<br><br />
:[13] Black M (1979): More about Metaphor. In: Ortony A (ed.): ''Metaphor and thought.'' Cambridge University Press, Cambridge. 19-43 <br><br />
:[14] Lakoff G (1993): The contemporary theory of metaphor. In: Ortony A (ed.): ''Metaphor and thought.'' Cambridge University Press, Cambridge. 202-251 <br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Fifth meeting - Necessary properties of a ‘living machine’'''</div><br />
In our firth meeting, we discussed about the necessary properties that a living beings needs to have in order to be considered a ‘living machine’ ([8],[10],[11],[15]). For the following meetings we decided to analyse in detail the properties of ''artificiality'' and ''technical functionality'', as machines are usually understood as physical objects, which were intentionally produced by human beings to achieve certain goals. Only if we can justify why products of synthetic biology are artificial and why do they have a technical function, we can use the expression ‘living machine’ as a proper term.<br />
<br />
Publications we worked with:<br />
<br />
:[15] Schark M (2012): Synthetic Biology and the Distinction between Organisms and Machines. ''Environ. Values'' 21: 19-41<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Sixth meeting - Artificiality'''</div><br />
Our inquiry of artificiality showed that we ought not to use the adjective ‘artificial’ as an honorary title. Due to the existing continuum between the natural and the artificial (e.g. [16]), we cannot argue that something is simply natural or simply artificial. A bioengineering product is less artificial than Venter’s ''Synthia'', which is respectively less artificial than a product of the protocell approach. All the products of synthetic biology are not simply ‘artificial life’: a bioengineering product has ‘artificial parts’, a synthetic genomics product an ‘artificial genome’ and, according to our argumentation, only the bottom-up protocell approach might be capable of producing entities, which could be meaningfully called as a whole ‘artificial life’ or ‘synthetic life’. Thus, all references to biological systems with the adjectives ‘artificial’ or ‘synthetic’ not being marked as a ''metaphor'' or as a ''future aim'' are therefore not warranted. <br />
<br />
Publications we worked with:<br />
<br />
:[16] Sandler R (2012): Is artefactualness a value-relevant property of living beings? ''Synthese'' 185: 89-102 <br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Seventh meeting - Technical functionality: the overdetermination problem'''</div><br />
<br />
The following necessary property we examined was the ''technical functionality'', because machines are not only made by humans, they are also supposed to have a useful function: a machine needs to be constructed with the intention to be a helpful mean to some human end. Although many of the scholars who worked on the products of synthetic biology accepted almost unproblematicly that the synthetic entities have technical functions (e.g. [10],[11],[17]), we wanted to examine in detail the idea of a synthetic biological product following a human-set goal. For this, we decided to study the relation between ''technical functions'' and ''biological functions'', as the concept of a ‘living machine’ seems to have both of them. <br />
Generally, referring to a function supposes to explain why its correspondent function bearer occurs and why it is there [18]. For example: if someone asks what a knife is, then we usually appeal to its function as cutting and stabbing tool and if someone asks what a heart is, then we answer referring to its function of pumping blood. Hence, functions are good for causal explanations. However, regarding the products of the synthetic biology we have an ''overdetermination problem'', because we can explain what a trait is referring to both, technical functions and biological functions. Imagine following situation:<br />
<br />
<p style=margin:3em>A synthetic biologist produces modified bacteria which are susceptible to glucose and that assist the treatment of diabetes in human beings. These bioengineered bacteria have a synthetic toggle switch which is activated when blood sugar levels reaches a tolerance threshold and allows the transcription of a substance to help the uptake of glucose from the blood. The decrease of glucose in blood allows the bacteria to live on.</p><br />
<br />
If we want to explain why the bacteria have a toggle switch, we can say two things: this toggle switch enables the production of a substance, which decreases the amount of blood sugar and hence helps the treatment of diabetes ''or'' this toggle switch enables the production of a substance which decreases the amount of blood sugar and is therefore beneficial for the bacteria (and the occurrence of this toggle switch in the bacteria is the result of a feedback mechanisms involving the exercise of producing the substance). The bacteria also have a synthetic toggle switch, because it was constructed so or because it helps the whole system to live. If both functional explanations are correct ''in the same context'', then we have a faulty overdetermination (two causes for one effect).<br />
<br />
Publications we worked with:<br />
<br />
:[17] Holm S (2011a): Biocentrism and Synthetic Biology. ''App Ethics'' 62-74<br><br />
:[18] Krohs U, Kroes P (eds) (2009): ''Functions in biological artificial worlds''. MIT press, Cambridge<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Eighth meeting - Technical functionality: solution'''</div><br />
<br />
We decided to work with two different theories of functions in order to encounter the abovementioned overdetermination problem. On the one hand we studied the ICE-theory for the ascription of technical functions by agents ([19],[20]). On the other hand we studied the organisational account of biological functions ([21],[22],[23]). By the products of synthetic biology both ascriptions of functions are possible – although we noticed that the technical function ascription applies imperfectly. Through the analysis of specific situations and counterexamples we showed that the technical function ascription is neither necessary nor sufficient to explain the products of synthetic biology ''per se''. The explanation based on biological functions makes a closure, due to the circular causality of living systems, which makes every reference to human intentionality dispensable. To make this account clear, we can examine the following example: <br />
<br><br><br><br />
<div style="color: #1c649f; text-align: center; font-size: 12px; text-indent:0px;">'''The hidden entities'''</div><br />
<p style=margin:3em>In a fictive secret part of our world a civilisation of human beings with an impressive scientific knowledge existed. They constructed impressive machine-like entities, which were capable of moving around and do things, but not to (re)produce, maintain and organize themselves. Using artificial organic materials they also constructed some bacteria-like living entities, which were able to absolve self-production, self-maintenance and self-organisation. This civilisation was destroyed without leaving anything but these two kinds of entities. We now find these entities, without knowledge of the past civilisation, and try to explain them.</p><br />
The explanation of the machine-like entities is ad-hoc not possible at all. One could try to explain them under the terms of their physical structures, but certainly without luck. One would probably make an ‘inference to the best explanation’ and, because these functioning machine-like entities cannot (re)produce, maintain and organise themselves, conclude that they were made by intentional beings. In contrast, no reference to human intentionality is needed by the explanation of the bacteria-like entities. A sufficient explanation of these entities can be given by just referring to the circular causality they own. The ahistorical circular causality makes any external cause unnecessary. These considerations show that in the moment in which we are capable of ascribing biological functions to an entity, all references to an ‘intelligent designer’ to explain this entity in itself is dispensable. Therefore, we conclude that the ascription of technical functions to the products of synthetic biology is only possible regarding a human context, but not if we want to describe what they are in themselves. Thus, it is not warranted to say that the synthetic entities follow a ‘human aim’. Moreover, this analysis allows a clear distinction between machines and living beings, making the expression ‘living machine’ necessarily a metaphor.<br />
<br />
Publications we worked with:<br><br />
<br />
:[19] Vermaas, PE (2006): The physical connection: Engineering function ascriptions to technical artefacts and their components. ''Stud Hist Philos Sci'' A 37: 62-75<br><br />
:[20] Vermaas, PE, Houkes, W (2006): Technical functions: A drawbridge between the intentional and structural natures of technical artefacts. ''Stud Hist Philos Sci'' 37: 5-18<br><br />
:[21] McLaughlin, P (2001): ''What Functions Explain. Functional Explanation and Self-reproducing Systems.'' Cambridge University Press, Cambridge<br><br />
:[22] Mossio M, Saborido C, Moreno A (2009): An Organizational Account of Biological Functions. ''Br J Philos Sci'' 60(4): 813-841<br><br />
:[23] Saborido C, Mossio M, Moreno A (2011). Biological organization and cross-generation functions. ''Br J Philos Sc'' 62: 583-606<br><br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Ninth meeting - Conclusion and ethics'''</div><br />
<br />
Finally, we discussed in our last meeting about the implications of our epistemological analysis for the synthetic biology and for society. In addition we studied different ethical approaches and tried to apply them to the products of synthetic biology ([16],[17],[24],[25]). Many of the approaches failed to justify if the synthesised entities have a moral status or not, revealing the necessity of novel bioethical theories. Some of our team members sympathises with Sune Holm’s biocentric view, because he also refers to the organisational account of biological functions for the foundation of his position ([17],[25]). Some other team members believe that the notion of a ‘natural purpose’ and the naturalisation of teleology and normativity (as the organisational account does) need further examination.<br />
<br />
Publications we worked with: <br><br />
<br />
:[24] Krebs A (eds) (1997): ''Naturethik. Grundtexte der gegenwärtigen tier- und ökologischen Diskussion.'' Suhrkamp, Frankfurt a.M. <br><br />
:[25] Holm S (2011b): Biological Interests, Normative Functions and Synthetic Biology. ''Philos Technol'' doi:10.1007/s13347-012-0075-6<br />
<br />
<br />
<br />
<br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/HumanPractices/PhiloTeam:Freiburg/HumanPractices/Philo2012-12-10T17:31:14Z<p>Pablinitus: Undo revision 299278 by Pablinitus (talk)</p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
= 1. PHILOSOPHICAL ANALYSIS =<br />
----<br />
<br><br />
<br />
{|align="center"<br />
|[[Image:Philo.png|500px|link=]]<br />
|}<br />
<br><br />
<p style= "font-size: 17px;color: #1c649f;margin:3em;font-family: Calibri">'''''"Pablo and the iGEM-Team Freiburg delve deep into biological theory and philosophy without losing sight of ethical implications of these issues.<br> A truly impressive accomplishment!"'''''</p><br />
:::[http://www.egm.uni-freiburg.de/institut/Mitarbeiter/mitarbeiter_boldt Dr. Joachim Boldt] <br> Institute of Ethics and the History of Medicine, Albert-Ludwigs-University of Freiburg<br />
<br />
<br><br />
== <div id="Essay">1.1 Philosophical essay</div> ==<br />
----<br />
<br><br />
<div align="justify">Synthetic biology aspires to be an engineering discipline, with the aim of constructing artificial living systems as means to human ends. The products of synthetic biology ought to be ''living machines''. The ‘international Genetically Engineered Machine competition’ is prospectively raising a whole generation of future scientists trained in the methods of this novel field of synthetic biology. We believe that in this context the ‘Know How’ (procedure) needs to be accompanied with the ‘Know Why’ (causal knowledge), but most important by the often forgotten ‘Know What’ (meaning), because the emerging of every new engineering discipline brings not only chances but also risks, uncertainties, and worries. There is no doubt that the field of synthetic biology promises a large number of meaningful applications and solutions for many present problems. However, at the same time, many social, ethical and legal problems are being revealed by the claim of the creation of ‘artificial living systems’ or ‘living machines’. We need to ask ourselves: ‘what are we actually doing?’, ‘what are living machines good for?’ and also ‘what are they ''in themselves''?’. Any ''ad-hoc'' answer to these questions would lead to a misjudgement of the arising problems.<br />
<br />
Our iGEM-team tried to leave aside any preconceived opinion and to make a profound critical analysis of the actual source of the nascent public concerns (dual-use-dilemma, ‘playing god’, biosafety, biosecurity, etc). We did not only meet for lab meetings, but for philosophical evenings as well: Together with scholars from diverse fields of science, we discuss core philosophical aspects of synthetic biology, focussing on the ontology of the products of synthetic biology (see [[#Chronicle|'Chronicle of philosophical evenings']]). What do we actually mean by expressions like ‘living machines’ and ‘artificial life’? To answer these questions, we studied modern approaches of philosophy of language (e.g. theory of conceptual metaphors), philosophy of technology (e.g. ICE-theory for the ascription of technical functions), philosophy of biology (e.g. organisational account of biological functions) and diverse bioethical theories (e.g. Taylor’s biocentric position). Through our deliberations, we came to the conclusion that many apparent ontological and ethical problems concerning synthetic biology and its aimed products are actually epistemological and semantical ones, which arise due to its ‘intentional epistemology’ and the unreflective use of innovative metaphors such as ‘living machine’. Our analysis pointed out important epistemological deficits of synthetic biology such as the unjustified methodological principle of ‘knowing by doing’, a tailor-made notion of life and the metaphoric character of its main terms. Pablo Rodrigo Grassi, one of our team members, took the challenge and collected the different thoughts of our discussions building a coherent text:<br />
<br><br><br><br />
<div style="color: #1c649f; font-size: 15px; text-indent:0px;">''''‘LIVING MACHINES’, METAPHORS AND FUNCTIONAL EXPLANATIONS – Towards an epistemological foundation of synthetic biology '''</div><br />
<br><br />
<br />
<div style="text-indent:40px; color: #1c649f; font-size: 15px;"><br />
'''SHORT ABSTRACT'''</div><br />
<div style=margin:3em>The analysis of the innovative term ‘living machine’ in this essay describes a novel argumentation, which combines advanced theories of philosophy of technology and philosophy of biology and allows us to make clear distinctions between organisms and machines. Out of the exposed accounts in the essay, is it justified to assert that living beings emerge and develop ‘naturally’ and are, in their development, under no circumstances dependent on human agency. This makes any ontological distinction between ‘living machines’ and ‘living organisms’ and between ‘artificial life’ and ‘natural life’ pointless. Therefore, it is not warranted to use hybrid expressions (e.g. ‘synthetic life’, ‘living machines’, ‘genetically engineered machines’) as proper terms; however, their usage as ''metaphors'' may be warranted. This essay argues for the reflexive and not constitutive use of metaphors in the language of the synthetic biology in order to avoid faulty inferences. On the one hand, this essay enables to allay the global unease concerning the idea of creation of life and the notion of ‘living machine’, because, according to our argumentation, no creation of life and no ‘living machine’ is possible at all. On the other hand, this essay shows some important aspects which are required for consolidating a clear and coherent epistemology of synthetic biology. Moreover, based on the conduced analysis of biological functions in our essay, the outline of a consistent biocentric ethic which also includes the products of synthetic biology, is possible.</div><br />
<html><br />
<div style="text-indent:40px;font-size:16px"><br />
<a href="http://omnibus.uni-freiburg.de/~ds151/HumPrac-Grassi.pdf">The full essay can be downloaded here.</a><br />
</html><br />
__NOTOC__<br />
</div><br />
<br />
<br />
<br><br />
<br />
==<div id="Chronicle">1.2 Chronicle of the philosophical evenings</div>==<br />
----<br />
<br><br><br />
In this section we would like to describe the development of our arguments and thoughts concerning the epistemological roots of synthetic biology and the different arising problems. Through these 'philosophical evenings' we examined in detail if the expression 'living machine' can really be considered to be a proper term or if it is necessarily a metaphor. We inquired together if this novel categorisation and kind-setting ('living machine') is actually warranted or not. Although our chronicles might wake the feeling of straightforwardness, this was not really the case. In fact, we needed hours of discussions, sanguine brainstorming and intensive reading to archieve our final arguments. Clearly, not all of the team members were the same opinion through our deliberations and it took time to find our common premises and starting points. But once we cleared up our diverse positions, we were able to do a fine work together! Although we also wanted to describe these different aspects and opinions through our discussions, we decided to simply present the thread and fruits of our philosophical evenings. <br />
<br><br><br />
<br />
{|align="center"<br />
|[[Image:PhilSeminar.jpg|center|500px|link=]]<br />
|}<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''First meeting - Introduction'''</div><br />
After a short introduction to the ''definition, aims'' and ''different approaches'' of the synthetic biology ([1],[2],[3],[4]), we clarified some special philosophical terms in order to have a common basis for further discussion. During the first meeting, we soon realised that the synthetic biology grounds on a different epistemology than the fields of ‘pure sciences’ do.<br />
<br />
Publications we worked with:<br />
<br />
:[1] Arkin A et al (2009): Synthetic biology: what’s in a name? ''Nat Biotechn'' 27 (12): 1071–1073<br><br />
:[2] Benner SA, Sismour AM (2005): Synthetic biology. ''Nat Rev Gen'' 6: 533-543<br><br />
:[3] Boldt J, Müller O, Maio G (2009): ''Synthetische Biologie. Eine ethisch-philosophische Analyse''. EKAH, Bern<br><br />
:[4] O'Malley M, Powell A, Davies JF, Calvert J (2008): Knowledge-making distinctions in synthetic biology.'' Bioessays'' 30: 57-65<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Second meeting - Epistemology'''</div><br />
In our second meeting we tried to work out what the special epistemological characteristics of an applied science are [5]. We expounded the general epistemological problems and possibilities of an engineering discipline. We noticed that ''causal knowledge'' and natural laws are not the main aim of an engineering discipline. Rather, the main aim is for ''efficient maxims'' and sufficient rules: In order to judge a technological system we only refer to it's efficiency - we just see if something works or not. In the epistemology of technological sciences the concept of efficiency plays a similar role to that which the concept of truth plays in the epistemology pure sciences, since scientific theories are judged by their truth value. Therefore, if the synthetic biology aspires to define itself as an engineering discipline, then the aim of knowledge-making is necessarily non-substantial [6].<br />
<br />
Publications we worked with:<br />
<br />
:[5] Bunge M (1974): Technology as applied science. In: Rapp F (ed.) ''Contributions to a Philosophy of Technology: Readings in the Philosophical Problems of Technology.'' Free Press, New York. 19-39<br><br />
:[6] Schummer J (2011): ''Das Gotteshandwerk. Die künstliche Herstellung von Leben im Labor.'' Suhrkamp, Berlin<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Third meeting - Procedure'''</div><br />
After asserting that synthetic biology follows an ‘intentional epistemology’, we analysed the conceptual procedure of synthetic biology. In view of the fact that the synthetic biology aims to create life, a consistent definition of the phenomena of life is needed, in order to have a reasonable goal ([7],[8]). Interestingly, the conception of life in synthetic biology matches with the settled purposes [9]. The understanding of life is adjusted to the notion of things that humans can make, modify and comprehend. Thus, the field of synthetic biology approaches ''biological systems as technological systems'' ([10],[11]). In this context, the ''analogical transfer'' from technological properties into the realm of the living can be understood as the epistemological program of synthetic biology. This transfer then promotes the aim of creating life, as it provides an understanding of life which makes such a feat possible in the first place. In short: within the field of synthetic biology, we encounter living beings ''as if'' they were machines. <br />
<br />
Publications we worked with:<br />
<br />
:[7] Brenner A (2007): ''Leben. Eine philosophische Untersuchung.'' EKAH, Bern<br><br />
:[8] Brenner A (2011): Living life and making life. ''Analecta Husserliana'' 110: 91-102<br><br />
:[9] Deplazes-Zemp A (2011): The Conception of Life in Synthetic Biology. Sci Eng Ethics doi:10.1007/s11948-011-9269-z <br><br />
:[10] Deplazes A, Huppenbauer M (2009): Synthetic organisms and living machines: Positioning the products of synthetic biology at the borderline between living and non-living matter. ''Syst Synth Bio'' 3(1-4): 55-63<br><br />
:[11] Schyfter P (2012): Technological biology? Things and kinds in synthetic biology. ''Biol Philos'' 27: 29-48<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Forth meeting - Metaphors'''</div><br />
Because synthetic biology approaches biological systems as technological systems by means of analogy, we examined the general concept of metaphors ([12],[13],[14]) and the epistemic value of inference from analogies. Through this examination, two problems became clear: First, because conceptual metaphors constitute of a way to see, think and act towards things [14], it is necessary to inquiry how our position towards life might change in the light of it as a machine [3]. Second, if synthetic biology does base upon a series of conceptual metaphors, which are not identified as such, then serious epistemological problems exist. All inference from the inductive argument of analogy is to be considered invalid: We might try and understand living beings as machines – that, however, does not impy that they indeed behave as such. <br />
<br />
Publications we worked with: <br />
<br />
:[12] Black M (1954): Metaphor. ''Proc Aristo Soc'' 55: 273-294<br><br />
:[13] Black M (1979): More about Metaphor. In: Ortony A (ed.): ''Metaphor and thought.'' Cambridge University Press, Cambridge. 19-43 <br><br />
:[14] Lakoff G (1993): The contemporary theory of metaphor. In: Ortony A (ed.): ''Metaphor and thought.'' Cambridge University Press, Cambridge. 202-251 <br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Fifth meeting - Necessary properties of a ‘living machine’'''</div><br />
In our firth meeting, we discussed about the necessary properties that a living beings needs to have in order to be considered a ‘living machine’ ([8],[10],[11],[15]). For the following meetings we decided to analyse in detail the properties of ''artificiality'' and ''technical functionality'', as machines are usually understood as physical objects, which were intentionally produced by human beings to achieve certain goals. Only if we can justify why products of synthetic biology are artificial and why do they have a technical function, we can use the expression ‘living machine’ as a proper term.<br />
<br />
Publications we worked with:<br />
<br />
:[15] Schark M (2012): Synthetic Biology and the Distinction between Organisms and Machines. ''Environ. Values'' 21: 19-41<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Sixth meeting - Artificiality'''</div><br />
Our inquiry of artificiality showed that we ought not to use the adjective ‘artificial’ as an honorary title. Due to the existing continuum between the natural and the artificial (e.g. [16]), we cannot argue that something is simply natural or simply artificial. A bioengineering product is less artificial than Venter’s ''Synthia'', which is respectively less artificial than a product of the protocell approach. All the products of synthetic biology are not simply ‘artificial life’: a bioengineering product has ‘artificial parts’, a synthetic genomics product an ‘artificial genome’ and, according to our argumentation, only the bottom-up protocell approach might be capable of producing entities, which could be meaningfully called as a whole ‘artificial life’ or ‘synthetic life’. Thus, all references to biological systems with the adjectives ‘artificial’ or ‘synthetic’ not being marked as a ''metaphor'' or as a ''future aim'' are therefore not warranted. <br />
<br />
Publications we worked with:<br />
<br />
:[16] Sandler R (2012): Is artefactualness a value-relevant property of living beings? ''Synthese'' 185: 89-102 <br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Seventh meeting - Technical functionality: the overdetermination problem'''</div><br />
<br />
The following necessary property we examined was the ''technical functionality'', because machines are not only made by humans, they are also supposed to have a useful function: a machine needs to be constructed with the intention to be a helpful mean to some human end. Although many of the scholars who worked on the products of synthetic biology accepted almost unproblematicly that the synthetic entities have technical functions (e.g. [10],[11],[17]), we wanted to examine in detail the idea of a synthetic biological product following a human-set goal. For this, we decided to study the relation between ''technical functions'' and ''biological functions'', as the concept of a ‘living machine’ seems to have both of them. <br />
Generally, referring to a function supposes to explain why its correspondent function bearer occurs and why it is there [18]. For example: if someone asks what a knife is, then we usually appeal to its function as cutting and stabbing tool and if someone asks what a heart is, then we answer referring to its function of pumping blood. Hence, functions are good for causal explanations. However, regarding the products of the synthetic biology we have an ''overdetermination problem'', because we can explain what a trait is referring to both, technical functions and biological functions. Imagine following situation:<br />
<br />
<p style=margin:3em>A synthetic biologist produces modified bacteria which are susceptible to glucose and that assist the treatment of diabetes in human beings. These bioengineered bacteria have a synthetic toggle switch which is activated when blood sugar levels reaches a tolerance threshold and allows the transcription of a substance to help the uptake of glucose from the blood. The decrease of glucose in blood allows the bacteria to live on.</p><br />
<br />
If we want to explain why the bacteria have a toggle switch, we can say two things: this toggle switch enables the production of a substance, which decreases the amount of blood sugar and hence helps the treatment of diabetes ''or'' this toggle switch enables the production of a substance which decreases the amount of blood sugar and is therefore beneficial for the bacteria (and the occurrence of this toggle switch in the bacteria is the result of a feedback mechanisms involving the exercise of producing the substance). The bacteria also have a synthetic toggle switch, because it was constructed so or because it helps the whole system to live. If both functional explanations are correct ''in the same context'', then we have a faulty overdetermination (two causes for one effect).<br />
<br />
Publications we worked with:<br />
<br />
:[17] Holm S (2011a): Biocentrism and Synthetic Biology. ''App Ethics'' 62-74<br><br />
:[18] Krohs U, Kroes P (eds) (2009): ''Functions in biological artificial worlds''. MIT press, Cambridge<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Eighth meeting - Technical functionality: solution'''</div><br />
<br />
We decided to work with two different theories of functions in order to encounter the abovementioned overdetermination problem. On the one hand we studied the ICE-theory for the ascription of technical functions by agents ([19],[20]). On the other hand we studied the organisational account of biological functions ([21],[22],[23]). By the products of synthetic biology both ascriptions of functions are possible – although we noticed that the technical function ascription applies imperfectly. Through the analysis of specific situations and counterexamples we showed that the technical function ascription is neither necessary nor sufficient to explain the products of synthetic biology ''per se''. The explanation based on biological functions makes a closure, due to the circular causality of living systems, which makes every reference to human intentionality dispensable. To make this account clear, we can examine the following example: <br />
<br><br><br><br />
<div style="color: #1c649f; text-align: center; font-size: 12px; text-indent:0px;">'''The hidden entities'''</div><br />
<p style=margin:3em>In a fictive secret part of our world a civilisation of human beings with an impressive scientific knowledge existed. They constructed impressive machine-like entities, which were capable of moving around and do things, but not to (re)produce, maintain and organize themselves. Using artificial organic materials they also constructed some bacteria-like living entities, which were able to absolve self-production, self-maintenance and self-organisation. This civilisation was destroyed without leaving anything but these two kinds of entities. We now find these entities, without knowledge of the past civilisation, and try to explain them.</p><br />
The explanation of the machine-like entities is ad-hoc not possible at all. One could try to explain them under the terms of their physical structures, but certainly without luck. One would probably make an ‘inference to the best explanation’ and, because these functioning machine-like entities cannot (re)produce, maintain and organise themselves, conclude that they were made by intentional beings. In contrast, no reference to human intentionality is needed by the explanation of the bacteria-like entities. A sufficient explanation of these entities can be given by just referring to the circular causality they own. The ahistorical circular causality makes any external cause unnecessary. These considerations show that in the moment in which we are capable of ascribing biological functions to an entity, all references to an ‘intelligent designer’ to explain this entity in itself is dispensable. Therefore, we conclude that the ascription of technical functions to the products of synthetic biology is only possible regarding a human context, but not if we want to describe what they are in themselves. Thus, it is not warranted to say that the synthetic entities follow a ‘human aim’. Moreover, this analysis allows a clear distinction between machines and living beings, making the expression ‘living machine’ necessarily a metaphor.<br />
<br />
Publications we worked with:<br><br />
<br />
:[19] Vermaas, PE (2006): The physical connection: Engineering function ascriptions to technical artefacts and their components. ''Stud Hist Philos Sci'' A 37: 62-75<br><br />
:[20] Vermaas, PE, Houkes, W (2006): Technical functions: A drawbridge between the intentional and structural natures of technical artefacts. ''Stud Hist Philos Sci'' 37: 5-18<br><br />
:[21] McLaughlin, P (2001): ''What Functions Explain. Functional Explanation and Self-reproducing Systems.'' Cambridge University Press, Cambridge<br><br />
:[22] Mossio M, Saborido C, Moreno A (2009): An Organizational Account of Biological Functions. ''Br J Philos Sci'' 60(4): 813-841<br><br />
:[23] Saborido C, Mossio M, Moreno A (2011). Biological organization and cross-generation functions. ''Br J Philos Sc'' 62: 583-606<br><br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Ninth meeting - Conclusion and ethics'''</div><br />
<br />
Finally, we discussed in our last meeting about the implications of our epistemological analysis for the synthetic biology and for society. In addition we studied different ethical approaches and tried to apply them to the products of synthetic biology ([16],[17],[24],[25]). Many of the approaches failed to justify if the synthesised entities have a moral status or not, revealing the necessity of novel bioethical theories. Some of our team members sympathises with Sune Holm’s biocentric view, because he also refers to the organisational account of biological functions for the foundation of his position ([17],[25]). Some other team members believe that the notion of a ‘natural purpose’ and the naturalisation of teleology and normativity (as the organisational account does) need further examination.<br />
<br />
Publications we worked with: <br><br />
<br />
:[24] Krebs A (eds) (1997): ''Naturethik. Grundtexte der gegenwärtigen tier- und ökologischen Diskussion.'' Suhrkamp, Frankfurt a.M. <br><br />
:[25] Holm S (2011b): Biological Interests, Normative Functions and Synthetic Biology. ''Philos Technol'' doi:10.1007/s13347-012-0075-6<br />
<br />
<br />
<br />
<br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/HumanPractices/PhiloTeam:Freiburg/HumanPractices/Philo2012-12-10T17:30:31Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
= 1. PHILOSOPHICAL ANALYSIS =<br />
----<br />
<br><br />
<br />
{|align="center"<br />
|[[Image:Philo.png|500px|link=]]<br />
|}<br />
<br><br />
<p style= "font-size: 17px;color: #1c649f;margin:3em;font-family: Calibri">'''''"Pablo and the iGEM-Team Freiburg delve deep into biological theory and philosophy without losing sight of ethical implications of these issues.<br> A truly impressive accomplishment!"'''''</p><br />
:::[http://www.egm.uni-freiburg.de/institut/Mitarbeiter/mitarbeiter_boldt Dr. Joachim Boldt] <br> Institute of Ethics and the History of Medicine, Albert-Ludwigs-University of Freiburg<br />
<br />
<br><br />
== <div id="Essay">1.1 Philosophical essay</div> ==<br />
----<br />
<br><br />
<div align="justify">Synthetic biology aspires to be an engineering discipline, with the aim of constructing artificial living systems as means to human ends. The products of synthetic biology ought to be ''living machines''. The ‘international Genetically Engineered Machine competition’ is prospectively raising a whole generation of future scientists trained in the methods of this novel field of synthetic biology. We believe that in this context the ‘Know How’ (procedure) needs to be accompanied with the ‘Know Why’ (causal knowledge), but most important by the often forgotten ‘Know What’ (meaning), because the emerging of every new engineering discipline brings not only chances but also risks, uncertainties, and worries. There is no doubt that the field of synthetic biology promises a large number of meaningful applications and solutions for many present problems. However, at the same time, many social, ethical and legal problems are being revealed by the claim of the creation of ‘artificial living systems’ or ‘living machines’. We need to ask ourselves: ‘what are we actually doing?’, ‘what are living machines good for?’ and also ‘what are they ''in themselves''?’. Any ''ad-hoc'' answer to these questions would lead to a misjudgement of the arising problems.<br />
<br />
Our iGEM-team tried to leave aside any preconceived opinion and to make a profound critical analysis of the actual source of the nascent public concerns (dual-use-dilemma, ‘playing god’, biosafety, biosecurity, etc). We did not only meet for lab meetings, but for philosophical evenings as well: Together with scholars from diverse fields of science, we discuss core philosophical aspects of synthetic biology, focussing on the ontology of the products of synthetic biology (see [[#Chronicle|'Chronicle of philosophical evenings']]). What do we actually mean by expressions like ‘living machines’ and ‘artificial life’? To answer these questions, we studied modern approaches of philosophy of language (e.g. theory of conceptual metaphors), philosophy of technology (e.g. ICE-theory for the ascription of technical functions), philosophy of biology (e.g. organisational account of biological functions) and diverse bioethical theories (e.g. Taylor’s biocentric position). Through our deliberations, we came to the conclusion that many apparent ontological and ethical problems concerning synthetic biology and its aimed products are actually epistemological and semantical ones, which arise due to its ‘intentional epistemology’ and the unreflective use of innovative metaphors such as ‘living machine’. Our analysis pointed out important epistemological deficits of synthetic biology such as the unjustified methodological principle of ‘knowing by doing’, a tailor-made notion of life and the metaphoric character of its main terms. Pablo Rodrigo Grassi, one of our team members, took the challenge and collected the different thoughts of our discussions building a coherent text:<br />
<br><br><br><br />
<div style="color: #1c649f; font-size: 15px; text-indent:0px;">''''‘LIVING MACHINES’, METAPHORS AND FUNCTIONAL EXPLANATIONS – Towards an epistemological foundation of synthetic biology '''</div><br />
<br><br />
<br />
<div style="text-indent:40px; color: #1c649f; font-size: 15px;"><br />
'''SHORT ABSTRACT'''</div><br />
<div style=margin:3em>The analysis of the innovative term ‘living machine’ in this essay describes a novel argumentation, which combines advanced theories of philosophy of technology and philosophy of biology and allows us to make clear distinctions between organisms and machines. Out of the exposed accounts in the essay, is it justified to assert that living beings emerge and develop ‘naturally’ and are, in their development, under no circumstances dependent on human agency. This makes any ontological distinction between ‘living machines’ and ‘living organisms’ and between ‘artificial life’ and ‘natural life’ pointless. Therefore, it is not warranted to use hybrid expressions (e.g. ‘synthetic life’, ‘living machines’, ‘genetically engineered machines’) as proper terms; however, their usage as ''metaphors'' may be warranted. This essay argues for the reflexive and not constitutive use of metaphors in the language of the synthetic biology in order to avoid faulty inferences. On the one hand, this essay enables to allay the global unease concerning the idea of creation of life and the notion of ‘living machine’, because, according to our argumentation, no creation of life and no ‘living machine’ is possible at all. On the other hand, this essay shows some important aspects which are required for consolidating a clear and coherent epistemology of synthetic biology. Moreover, based on the conduced analysis of biological functions in our essay, the outline of a consistent biocentric ethic which also includes the products of synthetic biology, is possible.</div><br />
<html><br />
<br />
__NOTOC__<br />
</div><br />
<br />
<br />
<br><br />
<br />
==<div id="Chronicle">1.2 Chronicle of the philosophical evenings</div>==<br />
----<br />
<br><br><br />
In this section we would like to describe the development of our arguments and thoughts concerning the epistemological roots of synthetic biology and the different arising problems. Through these 'philosophical evenings' we examined in detail if the expression 'living machine' can really be considered to be a proper term or if it is necessarily a metaphor. We inquired together if this novel categorisation and kind-setting ('living machine') is actually warranted or not. Although our chronicles might wake the feeling of straightforwardness, this was not really the case. In fact, we needed hours of discussions, sanguine brainstorming and intensive reading to archieve our final arguments. Clearly, not all of the team members were the same opinion through our deliberations and it took time to find our common premises and starting points. But once we cleared up our diverse positions, we were able to do a fine work together! Although we also wanted to describe these different aspects and opinions through our discussions, we decided to simply present the thread and fruits of our philosophical evenings. <br />
<br><br><br />
<br />
{|align="center"<br />
|[[Image:PhilSeminar.jpg|center|500px|link=]]<br />
|}<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''First meeting - Introduction'''</div><br />
After a short introduction to the ''definition, aims'' and ''different approaches'' of the synthetic biology ([1],[2],[3],[4]), we clarified some special philosophical terms in order to have a common basis for further discussion. During the first meeting, we soon realised that the synthetic biology grounds on a different epistemology than the fields of ‘pure sciences’ do.<br />
<br />
Publications we worked with:<br />
<br />
:[1] Arkin A et al (2009): Synthetic biology: what’s in a name? ''Nat Biotechn'' 27 (12): 1071–1073<br><br />
:[2] Benner SA, Sismour AM (2005): Synthetic biology. ''Nat Rev Gen'' 6: 533-543<br><br />
:[3] Boldt J, Müller O, Maio G (2009): ''Synthetische Biologie. Eine ethisch-philosophische Analyse''. EKAH, Bern<br><br />
:[4] O'Malley M, Powell A, Davies JF, Calvert J (2008): Knowledge-making distinctions in synthetic biology.'' Bioessays'' 30: 57-65<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Second meeting - Epistemology'''</div><br />
In our second meeting we tried to work out what the special epistemological characteristics of an applied science are [5]. We expounded the general epistemological problems and possibilities of an engineering discipline. We noticed that ''causal knowledge'' and natural laws are not the main aim of an engineering discipline. Rather, the main aim is for ''efficient maxims'' and sufficient rules: In order to judge a technological system we only refer to it's efficiency - we just see if something works or not. In the epistemology of technological sciences the concept of efficiency plays a similar role to that which the concept of truth plays in the epistemology pure sciences, since scientific theories are judged by their truth value. Therefore, if the synthetic biology aspires to define itself as an engineering discipline, then the aim of knowledge-making is necessarily non-substantial [6].<br />
<br />
Publications we worked with:<br />
<br />
:[5] Bunge M (1974): Technology as applied science. In: Rapp F (ed.) ''Contributions to a Philosophy of Technology: Readings in the Philosophical Problems of Technology.'' Free Press, New York. 19-39<br><br />
:[6] Schummer J (2011): ''Das Gotteshandwerk. Die künstliche Herstellung von Leben im Labor.'' Suhrkamp, Berlin<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Third meeting - Procedure'''</div><br />
After asserting that synthetic biology follows an ‘intentional epistemology’, we analysed the conceptual procedure of synthetic biology. In view of the fact that the synthetic biology aims to create life, a consistent definition of the phenomena of life is needed, in order to have a reasonable goal ([7],[8]). Interestingly, the conception of life in synthetic biology matches with the settled purposes [9]. The understanding of life is adjusted to the notion of things that humans can make, modify and comprehend. Thus, the field of synthetic biology approaches ''biological systems as technological systems'' ([10],[11]). In this context, the ''analogical transfer'' from technological properties into the realm of the living can be understood as the epistemological program of synthetic biology. This transfer then promotes the aim of creating life, as it provides an understanding of life which makes such a feat possible in the first place. In short: within the field of synthetic biology, we encounter living beings ''as if'' they were machines. <br />
<br />
Publications we worked with:<br />
<br />
:[7] Brenner A (2007): ''Leben. Eine philosophische Untersuchung.'' EKAH, Bern<br><br />
:[8] Brenner A (2011): Living life and making life. ''Analecta Husserliana'' 110: 91-102<br><br />
:[9] Deplazes-Zemp A (2011): The Conception of Life in Synthetic Biology. Sci Eng Ethics doi:10.1007/s11948-011-9269-z <br><br />
:[10] Deplazes A, Huppenbauer M (2009): Synthetic organisms and living machines: Positioning the products of synthetic biology at the borderline between living and non-living matter. ''Syst Synth Bio'' 3(1-4): 55-63<br><br />
:[11] Schyfter P (2012): Technological biology? Things and kinds in synthetic biology. ''Biol Philos'' 27: 29-48<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Forth meeting - Metaphors'''</div><br />
Because synthetic biology approaches biological systems as technological systems by means of analogy, we examined the general concept of metaphors ([12],[13],[14]) and the epistemic value of inference from analogies. Through this examination, two problems became clear: First, because conceptual metaphors constitute of a way to see, think and act towards things [14], it is necessary to inquiry how our position towards life might change in the light of it as a machine [3]. Second, if synthetic biology does base upon a series of conceptual metaphors, which are not identified as such, then serious epistemological problems exist. All inference from the inductive argument of analogy is to be considered invalid: We might try and understand living beings as machines – that, however, does not impy that they indeed behave as such. <br />
<br />
Publications we worked with: <br />
<br />
:[12] Black M (1954): Metaphor. ''Proc Aristo Soc'' 55: 273-294<br><br />
:[13] Black M (1979): More about Metaphor. In: Ortony A (ed.): ''Metaphor and thought.'' Cambridge University Press, Cambridge. 19-43 <br><br />
:[14] Lakoff G (1993): The contemporary theory of metaphor. In: Ortony A (ed.): ''Metaphor and thought.'' Cambridge University Press, Cambridge. 202-251 <br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Fifth meeting - Necessary properties of a ‘living machine’'''</div><br />
In our firth meeting, we discussed about the necessary properties that a living beings needs to have in order to be considered a ‘living machine’ ([8],[10],[11],[15]). For the following meetings we decided to analyse in detail the properties of ''artificiality'' and ''technical functionality'', as machines are usually understood as physical objects, which were intentionally produced by human beings to achieve certain goals. Only if we can justify why products of synthetic biology are artificial and why do they have a technical function, we can use the expression ‘living machine’ as a proper term.<br />
<br />
Publications we worked with:<br />
<br />
:[15] Schark M (2012): Synthetic Biology and the Distinction between Organisms and Machines. ''Environ. Values'' 21: 19-41<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Sixth meeting - Artificiality'''</div><br />
Our inquiry of artificiality showed that we ought not to use the adjective ‘artificial’ as an honorary title. Due to the existing continuum between the natural and the artificial (e.g. [16]), we cannot argue that something is simply natural or simply artificial. A bioengineering product is less artificial than Venter’s ''Synthia'', which is respectively less artificial than a product of the protocell approach. All the products of synthetic biology are not simply ‘artificial life’: a bioengineering product has ‘artificial parts’, a synthetic genomics product an ‘artificial genome’ and, according to our argumentation, only the bottom-up protocell approach might be capable of producing entities, which could be meaningfully called as a whole ‘artificial life’ or ‘synthetic life’. Thus, all references to biological systems with the adjectives ‘artificial’ or ‘synthetic’ not being marked as a ''metaphor'' or as a ''future aim'' are therefore not warranted. <br />
<br />
Publications we worked with:<br />
<br />
:[16] Sandler R (2012): Is artefactualness a value-relevant property of living beings? ''Synthese'' 185: 89-102 <br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Seventh meeting - Technical functionality: the overdetermination problem'''</div><br />
<br />
The following necessary property we examined was the ''technical functionality'', because machines are not only made by humans, they are also supposed to have a useful function: a machine needs to be constructed with the intention to be a helpful mean to some human end. Although many of the scholars who worked on the products of synthetic biology accepted almost unproblematicly that the synthetic entities have technical functions (e.g. [10],[11],[17]), we wanted to examine in detail the idea of a synthetic biological product following a human-set goal. For this, we decided to study the relation between ''technical functions'' and ''biological functions'', as the concept of a ‘living machine’ seems to have both of them. <br />
Generally, referring to a function supposes to explain why its correspondent function bearer occurs and why it is there [18]. For example: if someone asks what a knife is, then we usually appeal to its function as cutting and stabbing tool and if someone asks what a heart is, then we answer referring to its function of pumping blood. Hence, functions are good for causal explanations. However, regarding the products of the synthetic biology we have an ''overdetermination problem'', because we can explain what a trait is referring to both, technical functions and biological functions. Imagine following situation:<br />
<br />
<p style=margin:3em>A synthetic biologist produces modified bacteria which are susceptible to glucose and that assist the treatment of diabetes in human beings. These bioengineered bacteria have a synthetic toggle switch which is activated when blood sugar levels reaches a tolerance threshold and allows the transcription of a substance to help the uptake of glucose from the blood. The decrease of glucose in blood allows the bacteria to live on.</p><br />
<br />
If we want to explain why the bacteria have a toggle switch, we can say two things: this toggle switch enables the production of a substance, which decreases the amount of blood sugar and hence helps the treatment of diabetes ''or'' this toggle switch enables the production of a substance which decreases the amount of blood sugar and is therefore beneficial for the bacteria (and the occurrence of this toggle switch in the bacteria is the result of a feedback mechanisms involving the exercise of producing the substance). The bacteria also have a synthetic toggle switch, because it was constructed so or because it helps the whole system to live. If both functional explanations are correct ''in the same context'', then we have a faulty overdetermination (two causes for one effect).<br />
<br />
Publications we worked with:<br />
<br />
:[17] Holm S (2011a): Biocentrism and Synthetic Biology. ''App Ethics'' 62-74<br><br />
:[18] Krohs U, Kroes P (eds) (2009): ''Functions in biological artificial worlds''. MIT press, Cambridge<br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Eighth meeting - Technical functionality: solution'''</div><br />
<br />
We decided to work with two different theories of functions in order to encounter the abovementioned overdetermination problem. On the one hand we studied the ICE-theory for the ascription of technical functions by agents ([19],[20]). On the other hand we studied the organisational account of biological functions ([21],[22],[23]). By the products of synthetic biology both ascriptions of functions are possible – although we noticed that the technical function ascription applies imperfectly. Through the analysis of specific situations and counterexamples we showed that the technical function ascription is neither necessary nor sufficient to explain the products of synthetic biology ''per se''. The explanation based on biological functions makes a closure, due to the circular causality of living systems, which makes every reference to human intentionality dispensable. To make this account clear, we can examine the following example: <br />
<br><br><br><br />
<div style="color: #1c649f; text-align: center; font-size: 12px; text-indent:0px;">'''The hidden entities'''</div><br />
<p style=margin:3em>In a fictive secret part of our world a civilisation of human beings with an impressive scientific knowledge existed. They constructed impressive machine-like entities, which were capable of moving around and do things, but not to (re)produce, maintain and organize themselves. Using artificial organic materials they also constructed some bacteria-like living entities, which were able to absolve self-production, self-maintenance and self-organisation. This civilisation was destroyed without leaving anything but these two kinds of entities. We now find these entities, without knowledge of the past civilisation, and try to explain them.</p><br />
The explanation of the machine-like entities is ad-hoc not possible at all. One could try to explain them under the terms of their physical structures, but certainly without luck. One would probably make an ‘inference to the best explanation’ and, because these functioning machine-like entities cannot (re)produce, maintain and organise themselves, conclude that they were made by intentional beings. In contrast, no reference to human intentionality is needed by the explanation of the bacteria-like entities. A sufficient explanation of these entities can be given by just referring to the circular causality they own. The ahistorical circular causality makes any external cause unnecessary. These considerations show that in the moment in which we are capable of ascribing biological functions to an entity, all references to an ‘intelligent designer’ to explain this entity in itself is dispensable. Therefore, we conclude that the ascription of technical functions to the products of synthetic biology is only possible regarding a human context, but not if we want to describe what they are in themselves. Thus, it is not warranted to say that the synthetic entities follow a ‘human aim’. Moreover, this analysis allows a clear distinction between machines and living beings, making the expression ‘living machine’ necessarily a metaphor.<br />
<br />
Publications we worked with:<br><br />
<br />
:[19] Vermaas, PE (2006): The physical connection: Engineering function ascriptions to technical artefacts and their components. ''Stud Hist Philos Sci'' A 37: 62-75<br><br />
:[20] Vermaas, PE, Houkes, W (2006): Technical functions: A drawbridge between the intentional and structural natures of technical artefacts. ''Stud Hist Philos Sci'' 37: 5-18<br><br />
:[21] McLaughlin, P (2001): ''What Functions Explain. Functional Explanation and Self-reproducing Systems.'' Cambridge University Press, Cambridge<br><br />
:[22] Mossio M, Saborido C, Moreno A (2009): An Organizational Account of Biological Functions. ''Br J Philos Sci'' 60(4): 813-841<br><br />
:[23] Saborido C, Mossio M, Moreno A (2011). Biological organization and cross-generation functions. ''Br J Philos Sc'' 62: 583-606<br><br />
<br />
<br><br />
<div style="color: #1c649f; font-size: 16px; text-indent:0px;">'''Ninth meeting - Conclusion and ethics'''</div><br />
<br />
Finally, we discussed in our last meeting about the implications of our epistemological analysis for the synthetic biology and for society. In addition we studied different ethical approaches and tried to apply them to the products of synthetic biology ([16],[17],[24],[25]). Many of the approaches failed to justify if the synthesised entities have a moral status or not, revealing the necessity of novel bioethical theories. Some of our team members sympathises with Sune Holm’s biocentric view, because he also refers to the organisational account of biological functions for the foundation of his position ([17],[25]). Some other team members believe that the notion of a ‘natural purpose’ and the naturalisation of teleology and normativity (as the organisational account does) need further examination.<br />
<br />
Publications we worked with: <br><br />
<br />
:[24] Krebs A (eds) (1997): ''Naturethik. Grundtexte der gegenwärtigen tier- und ökologischen Diskussion.'' Suhrkamp, Frankfurt a.M. <br><br />
:[25] Holm S (2011b): Biological Interests, Normative Functions and Synthetic Biology. ''Philos Technol'' doi:10.1007/s13347-012-0075-6<br />
<br />
<br />
<br />
<br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-26T23:02:45Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with existing standards. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized and simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless they are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning<sup>1</sup> (or its derivatives MoClo<sup>2</sup> and GoldenBraid<sup>3</sup>). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction. Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
In conventional cloning, restriction enzymes bind to and cut at the exact same spot. Consequently, one conventional restriction enzyme only produces one type of sticky ends. That is the reason why in conventional cloning, only two DNA parts can be assembled in one step. Golden Gate Cloning overcomes this restriction by exploiting the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Thus, these enzymes are capable of producing multiple sticky ends at different DNA fragments in one reaction. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effector expression vectors from six different parts – all in one reaction.<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
<div font-size:15xp>'''Strategy 1'''</div><br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC10 standard restriction sites. We actually built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and successfully applied both RFC10 or "Golden Gate standard".<br />
We therefore propose the following Protocol:<br><br><br />
<br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
<br />
<br><br><br />
<br />
:<div id="GGC">'''Protocol:'''</div><br />
<br />
<br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector. We usually had no colonies on our negative control plate after ligation with T4 ligase and transformation into DH10B cells.<br><br />
<br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 50 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2'''<br><br><br />
The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:'''Step 2:''' Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
::In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
:::1. Use the first 4 bp of the downstream part as overlap.<br><br />
:::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
::Usually, you should be able to define your overlaps now.<br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC10 standard.<br><br><br><br />
<br />
== References ==<br />
----<br />
<br><html><br />
1. Engler, C., Gruetzner, R., Kandzia, R. & Marillonnet, S. Golden Gate Shuffling: A One-Pot DNA Shuffling Method Based on Type IIs Restriction Enzymes. PLoS ONE 4, e5553 (2009).<br><br />
2. Werner, S., Engler, C., Weber, E., Gruetzner, R. & Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs 3, 38–43 (2012).<br><br />
3. Sarrion-Perdigones, A. et al. GoldenBraid: An Iterative Cloning System for Standardized Assembly of Reusable Genetic Modules. PLoS ONE 6, e21622 (2011).<br />
</html><br><br />
<br />
[[#top|Back to top]]<br />
<br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html></div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-26T23:00:59Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with existing standards. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized and simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless they are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning<sup>1</sup> (or its derivatives MoClo<sup>2</sup> and GoldenBraid<sup>3</sup>). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction. Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
In conventional cloning, restriction enzymes bind to and cut at the exact same spot. Consequently, one conventional restriction enzyme only produces one type of sticky ends. That is the reason why in conventional cloning, only two DNA parts can be assembled in one step. Golden Gate Cloning overcomes this restriction by exploiting the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Thus, these enzymes are capable of producing multiple sticky ends at different DNA fragments in one reaction. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effector expression vectors from six different parts – all in one reaction.<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
<div font-size:15xp>'''Strategy 1'''</div><br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC10 standard restriction sites. We actually built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and successfully applied both RFC10 or "Golden Gate standard".<br />
We therefore propose the following Protocol:<br><br><br />
<br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
<br />
<br><br><br />
<br />
:'''Protocol:'''<br />
<br />
<br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector. We usually had no colonies on our negative control plate after ligation with T4 ligase and transformation into DH10B cells.<br><br />
<br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 50 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2'''<br><br><br />
The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:'''Step 2:''' Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
::In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
:::1. Use the first 4 bp of the downstream part as overlap.<br><br />
:::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
::Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC10 standard.<br><br><br><br />
<br />
== References ==<br />
----<br />
<br><html><br />
1. Engler, C., Gruetzner, R., Kandzia, R. & Marillonnet, S. Golden Gate Shuffling: A One-Pot DNA Shuffling Method Based on Type IIs Restriction Enzymes. PLoS ONE 4, e5553 (2009).<br><br />
2. Werner, S., Engler, C., Weber, E., Gruetzner, R. & Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs 3, 38–43 (2012).<br><br />
3. Sarrion-Perdigones, A. et al. GoldenBraid: An Iterative Cloning System for Standardized Assembly of Reusable Genetic Modules. PLoS ONE 6, e21622 (2011).<br />
</html><br><br />
<br />
[[#top|Back to top]]<br />
<br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html></div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/IntroTeam:Freiburg/Project/Intro2012-10-26T22:55:04Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<html><br />
<head><br />
<!-- Timeline script adapted from http://www.csslab.cl/2011/08/18/jquery-timelinr/. Thanks!! --><br />
<br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/><br />
<br />
<link rel="stylesheet" href="<br />
http://omnibus.uni-freiburg.de/~lb125/css/style.css" type="text/css" media="screen" /><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js" type="text/javascript"></script><br />
<br />
<script src="http://omnibus.uni-freiburg.de/~lb125/js/jquery.timelinr-0.9.51.js" type="text/javascript"></script><br />
<br />
<script type="text/javascript"> <br />
<br />
$(function(){<br />
$().timelinr({<br />
orientation: 'horizontal',<br />
containerDiv: '#timeline',<br />
datesDiv: '#dates',<br />
datesSelectedClass: 'selected',<br />
datesSpeed: 'normal',<br />
issuesDiv : '#issues',<br />
issuesSelectedClass: 'selected',<br />
issuesSpeed: 'fast',<br />
issuesTransparency: 0.2,<br />
issuesTransparencySpeed: 500,<br />
prevButton: '#prev',<br />
nextButton: '#next',<br />
arrowKeys: 'false',<br />
startAt: 1,<br />
autoPlay: 'false',<br />
autoPlayDirection: 'forward',<br />
autoPlayPause: 2000<br />
});<br />
});<br />
<br />
</script><br />
<br />
<!-- End timeline --><br />
<br />
<br />
<style type="text/css"><br />
#ip_quote<br />
{<br />
margin-top:0px;<br />
margin-bottom:0px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:75%;<br />
color:#C22227;<br />
font-size:140%;<br />
line-height:140%;<br />
text-align:justify;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
__NOTOC__<br />
= Introduction =<br />
----<br />
<html><br />
<!-- BEGIN TIMELINE WHITEBOX HERE --><br />
<div name="talhistory"><br />
<div id="timeline"><br />
<br />
<ul id="dates"><br />
<li><a href="#" class="dateobject">2009</a></li><br />
<li><a href="#" class="dateobject">2010</a></li><br />
<li><a href="#" class="dateobject">02/11</a></li><br />
<li><a href="#" class="dateobject">10/11</a></li><br />
<li><a href="#" class="dateobject">12/11</a></li><br />
<li><a href="#" class="dateobject">02/12</a></li><br />
<li><a href="#" class="dateobject">04/12</a></li><br />
<li><a href="#" class="dateobject">iGEM'12</a></li><br />
</ul><br />
<br />
<br />
<div id="grad_left"></div><br />
<br />
<div id="grad_right"></div><br />
<br />
<a href="#" id="next">+</a><br />
<br />
<a href="#" id="prev">-</a><br />
<br />
<br />
<ul id="issues"><br />
<br />
<br />
<br />
<li id="#2009"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_09.png" width="256" height="170" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2009</div><br />
<br />
<p>Two research groups publish the TAL Effector codes in the same issue of Science: Amino acid 12 and 13 of every DNA binding module specifically binds to one nucleotide</p><br />
<br />
</li><br />
<br />
<br />
<li id="#2010"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_10.png" width="256" height="200" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2010</div><br />
<br />
<p>Voytas Lab develops TALENs. These fusion proteins of FokI and a TAL protein cut as dimers and allow researchers to cut virtually anywhere in the genome. Since double strand breaks increase efficiency of homologous recombination, TALENS are a powerful tool for genetic engineering and gene therapy</p><br />
<br />
</li><br />
<br />
<li id="#02/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_11.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2011</div><br />
<br />
<p>Based on an exclusive licensing agreement with the University of Minnasota, Cellectis bioresearch launches its TAL effector product line. One TALEN pair currently costs 5000 Euro (6454 US$, 26.10.12).</p><br />
<br />
</li><br />
<br />
<br />
<li id="#10/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2011</div><br />
<br />
<p>The iGEM team from Harvard University employed fancy and expensive techniques to find up to 15 new zinc fingers (each of which binds to 3 bp). There has to be a better way…</p><br />
<br />
</li><br />
<br />
<br />
<li id="#12/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/12_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">December 2011</div><br />
<br />
<p>Nature chooses TALENs as the 2011 Method of the year.</p><br />
<br />
</li><br />
<br />
<li id="#02/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2012</div><br />
<br />
<p>The first two crystal structures of TALE modules bound to DNA published in the same issue of Science. The protein literally wraps itself around the DNA double helix and forms these beautiful symmetric shapes.</p><br />
<br />
</li><br />
<br />
<br />
<br />
<li id="#04/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/04_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">April 2012</div><br />
<br />
<p>Joung lab publishes FLASH assembly in Nature Biotechnology. This first automatable TAL assembly platform facilitates assembly of 96 TAL DNA fragments in less than a day using a pipeting robot.</p><br />
<br />
</li><br />
<br />
<br />
<li id="freiGEM'12"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_12.png" width="200" height="130" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2012</div><br />
<br />
<p>The Freiburg iGEM team makes TALE technology available to everyone by introducing the GATE assembly kit. For TALEs targeting 14 bp, this platform is currently the fastest, cheapest and easiest method in the world.</p><br />
<br />
</li><br />
<br />
</ul><br />
<br />
<br />
</div><br />
</div><br />
<br />
<!-- END TIMELINE WHITEBOX HERE --><br />
<br />
<br />
<p><div align="justify">Originally, TAL proteins are virulence factors of the plant-pathogenic ''Xanthomonas spp.'' that are injected into plant cells via a type III secretion system in order to modulate transcription<sup>1</sup>. For this purpose, their c-terminal end contains a nuclear localisation signal (NLS) and an acidic activation domain. The central part of the TAL protein contains a number of almost similar repeats that mediate specific binding to target loci in the genome.<br />
In 2009, two groups have simultaneously pointed out that each of these repeats specifically binds to one base of the target DNA via two amino acids (aa 12 and 13), named the repeat variable diresidues (RVD)<sup>2</sup> (see figure 1). Moreover, it has been shown that DNA binding of these proteins is highly modular, i.e. the number of bases or sequence of the target DNA can be altered by adjusting the number or order of the repeats in the TAL protein, respectively.<br />
<br><br><img src="https://static.igem.org/mediawiki/2012/7/7b/Schema_tal_protein.png" width="500px" style="margin-left:130px"/><br><div align="center"><br>Figure 1: Schema of a TAL protein<sup>13</sup></div><br><br><br />
The minimal condition for TALE activity is a thymine at the 5’ end of the target sequence. Further target sequence requirements that allow for one TALEN pair binding site every 35 bp (published by the Voytas lab in 2011<sup>3</sup>) have recently been questioned by Reyon et al.<sup>4</sup> In summary, it is very likely that you can find multiple potential TALE binding sites in any sequence you want to target.<br />
This, obviously, is very promising for biotechnological and clinical applications. Thus, two major classes of TAL Effectors have been created by replacing the natural acidic activation domain either by other transcription factors (TALE-TFs) <sup>5</sup> or by a monomer of the non-sequence specific nuclease FokI, resulting in TAL Effector Nucleases (TALENS).<sup>6</sup> A pair of TALENs can be designed to bind adjacent DNA sequences in a way that the two monomers are able to form a functional FokI dimer that produces a double strand break (DBS) within the spacer between the TAL-Effectors (see figure 2). <br><br><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/TAL-figure13T.png" width="500px" style="margin-left:130px"/><br><div align="center">Figure 2: Schematic drawings of a TAL-TF and a TALEN pair<sup>13</sup></div><br><br><br />
<br />
Subsequently, the cell repairs the DBS by either non-homologous end joining (NHEJ, which results in indels at the DSB-site) or homologous recombination of exogenously added genetic material. That way, TALENs allow researchers to introduce genes into a genome with much higher efficiency than before.<br />
In this context, TALENs and TALE-TF have successfully been applied for manipulation of a series of genes in different organisms such as yeast<sup>7</sup>, tobacco<sup>3</sup>, fruitflies<sup>6,8</sup>,worms<sup>6,9</sup>, zebrafish<sup>10</sup>, rats<sup>11</sup> and various human cell types, including human stem cells<sup>12</sup>. Moreover, TALENs are already applied for gene therapy in preclinical trials.<br><br><br />
<br />
<br />
<br><br><br><br><br />
<div style="color: #1C649F; font-size: 20px;font-family: Gill Sans MT">References</div><br><br />
1. Scholze, H. & Boch, J. TAL effectors are remote controls for gene activation. ''Current Opinion in Microbiology'' 14, 47–53 (2011).<br><br />
2. Moscou, M. J. & Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effectors. ''Science'' 326, 1501–1501 (2009).<br><br />
3. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
4. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
5. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nature biotechnology'' 29, 149–153 (2011).<br><br />
6. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nature Biotechnology'' 29, 143–148 (2010).<br><br />
7. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br />
8. Liu, J. et al. Efficient and Specific Modifications of the Drosophila Genome by Means of an Easy TALEN Strategy. ''Journal of Genetics and Genomics'' 39, 209–215 (2012).<br><br />
9. Wood, A. J. et al. Targeted Genome Editing Across Species Using ZFNs and TALENs. ''Science'' 333, 307–307 (2011).<br><br />
10. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol'' 29, 697–698 (2011).<br><br />
11. Tesson, L. et al. Knockout rats generated by embryo microinjection of TALENs. ''Nature Biotechnology'' 29, 695–696 (2011).<br><br />
12. Hockemeyer, D. et al. Genetic engineering of human pluripotent cells using TALE nucleases. ''Nature Biotechnology'' 29, 731–734 (2011)<br><br />
13. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br />
<br />
<br><br><br />
</html><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/IntroTeam:Freiburg/Project/Intro2012-10-26T22:52:08Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<html><br />
<head><br />
<!-- Timeline script adapted from http://www.csslab.cl/2011/08/18/jquery-timelinr/. Thanks!! --><br />
<br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/><br />
<br />
<link rel="stylesheet" href="<br />
http://omnibus.uni-freiburg.de/~lb125/css/style.css" type="text/css" media="screen" /><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js" type="text/javascript"></script><br />
<br />
<script src="http://omnibus.uni-freiburg.de/~lb125/js/jquery.timelinr-0.9.51.js" type="text/javascript"></script><br />
<br />
<script type="text/javascript"> <br />
<br />
$(function(){<br />
$().timelinr({<br />
orientation: 'horizontal',<br />
containerDiv: '#timeline',<br />
datesDiv: '#dates',<br />
datesSelectedClass: 'selected',<br />
datesSpeed: 'normal',<br />
issuesDiv : '#issues',<br />
issuesSelectedClass: 'selected',<br />
issuesSpeed: 'fast',<br />
issuesTransparency: 0.2,<br />
issuesTransparencySpeed: 500,<br />
prevButton: '#prev',<br />
nextButton: '#next',<br />
arrowKeys: 'false',<br />
startAt: 1,<br />
autoPlay: 'false',<br />
autoPlayDirection: 'forward',<br />
autoPlayPause: 2000<br />
});<br />
});<br />
<br />
</script><br />
<br />
<!-- End timeline --><br />
<br />
<br />
<style type="text/css"><br />
#ip_quote<br />
{<br />
margin-top:0px;<br />
margin-bottom:0px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:75%;<br />
color:#C22227;<br />
font-size:140%;<br />
line-height:140%;<br />
text-align:justify;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
__NOTOC__<br />
= Introduction =<br />
----<br />
<html><br />
<!-- BEGIN TIMELINE WHITEBOX HERE --><br />
<div name="talhistory"><br />
<div id="timeline"><br />
<br />
<ul id="dates"><br />
<li><a href="#" class="dateobject">2009</a></li><br />
<li><a href="#" class="dateobject">2010</a></li><br />
<li><a href="#" class="dateobject">02/11</a></li><br />
<li><a href="#" class="dateobject">10/11</a></li><br />
<li><a href="#" class="dateobject">12/11</a></li><br />
<li><a href="#" class="dateobject">02/12</a></li><br />
<li><a href="#" class="dateobject">04/12</a></li><br />
<li><a href="#" class="dateobject">iGEM'12</a></li><br />
</ul><br />
<br />
<br />
<div id="grad_left"></div><br />
<br />
<div id="grad_right"></div><br />
<br />
<a href="#" id="next">+</a><br />
<br />
<a href="#" id="prev">-</a><br />
<br />
<br />
<ul id="issues"><br />
<br />
<br />
<br />
<li id="#2009"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_09.png" width="256" height="170" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2009</div><br />
<br />
<p>Two research groups publish the TAL Effector codes in the same issue of Science: Amino acid 12 and 13 of every DNA binding module specifically binds to one nucleotide</p><br />
<br />
</li><br />
<br />
<br />
<li id="#2010"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_10.png" width="256" height="200" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2010</div><br />
<br />
<p>Voytas Lab develops TALENs. These fusion proteins of FokI and a TAL protein cut as dimers and allow researchers to cut virtually anywhere in the genome. Since double strand breaks increase efficiency of homologous recombination, TALENS are a powerful tool for genetic engineering and gene therapy</p><br />
<br />
</li><br />
<br />
<li id="#02/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_11.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2011</div><br />
<br />
<p>Based on an exclusive licensing agreement with the University of Minnasota, Cellectis bioresearch launches its TAL effector product line. One TALEN pair currently costs 5000 Euro (6454 US$, 26.10.12).</p><br />
<br />
</li><br />
<br />
<br />
<li id="#10/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2011</div><br />
<br />
<p>The iGEM team from Harvard University employed fancy and expensive techniques to find up to 15 new zinc fingers (each of which binds to 3 bp). There has to be a better way…</p><br />
<br />
</li><br />
<br />
<br />
<li id="#12/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/12_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">December 2011</div><br />
<br />
<p>Nature chooses TALENs as the 2011 Method of the year.</p><br />
<br />
</li><br />
<br />
<li id="#02/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2012</div><br />
<br />
<p>The first two crystal structures of TALE modules bound to DNA published in the same issue of Science. The protein literally wraps itself around the DNA double helix and forms these beautiful symmetric shapes.</p><br />
<br />
</li><br />
<br />
<br />
<br />
<li id="#04/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/04_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">April 2012</div><br />
<br />
<p>Joung lab publishes FLASH assembly in Nature Biotechnology. This first automatable TAL assembly platform facilitates assembly of 96 TAL DNA fragments in less than a day using a pipeting robot.</p><br />
<br />
</li><br />
<br />
<br />
<li id="freiGEM'12"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_12.png" width="200" height="130" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2012</div><br />
<br />
<p>The Freiburg iGEM team makes TALE technology available to everyone by introducing the GATE assembly kit. For TALEs targeting 14 bp, this platform is currently the fastest, cheapest and easiest method in the world.</p><br />
<br />
</li><br />
<br />
</ul><br />
<br />
<br />
</div><br />
</div><br />
<br />
<!-- END TIMELINE WHITEBOX HERE --><br />
<br />
<br />
<p><div align="justify">Originally, TAL proteins are virulence factors of the plant-pathogenic ''Xanthomonas spp.'' that are injected into plant cells via a type III secretion system in order to modulate transcription<sup>1</sup>. For this purpose, their c-terminal end contains a nuclear localisation signal (NLS) and an acidic activation domain. The central part of the TAL protein contains a number of almost similar repeats that mediate specific binding to target loci in the genome.<br />
In 2009, two groups have simultaneously pointed out that each of these repeats specifically binds to one base of the target DNA via two amino acids (aa 12 and 13), named the repeat variable diresidues (RVD)<sup>2</sup> (see figure 1). Moreover, it has been shown that DNA binding of these proteins is highly modular, i.e. the number of bases or sequence of the target DNA can be altered by adjusting the number or order of the repeats in the TAL protein, respectively.<br />
<br><br><img src="https://static.igem.org/mediawiki/2012/7/7b/Schema_tal_protein.png" width="500px" style="margin-left:130px"/><br><div align="center"><br>Figure 1: Schema of a TAL protein<sup>13</sup></div><br><br><br />
The minimal condition for TALE activity is a thymine at the 5’ end of the target sequence. Further target sequence requirements that allow for one TALEN pair binding site every 35 bp (published by the Voytas lab in 2011<sup>3</sup>) have recently been questioned by Reyon et al.<sup>4</sup> In summary, it is very likely that you can find multiple potential TALE binding sites in any sequence you want to target.<br />
This, obviously, is very promising for biotechnological and clinical applications. Thus, two major classes of TAL Effectors have been created by replacing the natural acidic activation domain either by other transcription factors (TALE-TFs) <sup>5</sup> or by a monomer of the non-sequence specific nuclease FokI, resulting in TAL Effector Nucleases (TALENS).<sup>6</sup> A pair of TALENs can be designed to bind adjacent DNA sequences in a way that the two monomers are able to form a functional FokI dimer that produces a double strand break (DBS) within the spacer between the TAL-Effectors (see figure 2). <br><br><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/TAL-figure13T.png" width="500px" style="margin-left:130px"/><br><div align="center">Figure 2: Schematic drawings of a TAL-TF and a TALEN pair<sup>13</sup></div><br><br><br />
<br />
Subsequently, the cell repairs the DBS by either non-homologous end joining (NHEJ, which results in indels at the DSB-site) or homologous recombination of exogenously added genetic material. That way, TALENs allow researchers to introduce genes into a genome with much higher efficiency than before.<br />
In this context, TALENs and TALE-TF have successfully been applied for manipulation of a series of genes in different organisms such as yeast<sup>7</sup>, tobacco<sup>3</sup>, fruitflies<sup>6,8</sup>,worms<sup>6,9</sup>, zebrafish<sup>10</sup>, rats<sup>11</sup> and various human cell types, including human stem cells<sup>12</sup>. Moreover, TALENs are already applied for gene therapy in preclinical trials.<br><br><br />
<br />
<br />
<br><br><br><br><br />
<div style="color: #1C649F; font-size: 20px;font-family: Gill Sans MT">References</div><br><br />
1. Scholze, H. & Boch, J. TAL effectors are remote controls for gene activation. ''Current Opinion in Microbiology'' 14, 47–53 (2011).<br><br />
2. Moscou, M. J. & Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effectors. ''Science'' 326, 1501–1501 (2009).<br><br />
3. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
4. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
5. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nature biotechnology'' 29, 149–153 (2011).<br><br />
6. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nature Biotechnology'' 29, 143–148 (2010).<br><br />
7. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br />
8. Liu, J. et al. Efficient and Specific Modifications of the Drosophila Genome by Means of an Easy TALEN Strategy. ''Journal of Genetics and Genomics'' 39, 209–215 (2012).<br><br />
9. Wood, A. J. et al. Targeted Genome Editing Across Species Using ZFNs and TALENs. ''Science'' 333, 307–307 (2011).<br><br />
10. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol'' 29, 697–698 (2011).<br><br />
11. Tesson, L. et al. Knockout rats generated by embryo microinjection of TALENs. ''Nature Biotechnology'' 29, 695–696 (2011).<br><br />
12. Hockemeyer, D. et al. Genetic engineering of human pluripotent cells using TALE nucleases. ''Nature Biotechnology'' 29, 731–734 (2011)<br />
13. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br />
<br />
<br><br><br />
</html><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/ProjectTeam:Freiburg/Project2012-10-26T22:44:44Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
= Project =<br />
----<br />
<br><br />
[[File:projectsymbolT.png|center|180px|link=]]<br />
<br><br />
== Overview ==<br />
<br />
<div align="justify">TALE technology currently revolutionizes synthetic biology, not only because of higher sequence fidelity or less cytotoxicity compared to other DNA binding proteins (e.g. zinc fingers). The main advantage is that they can be produced rationally to bind a DNA sequence of choice, whereas zinc fingers with the desired binding properties need to be selected from a library of fingers.<br />
That is why TAL technology is generally much less costly, time consuming and does guarantee binding sites for every predefined sequence (although open source platforms have also been published for zinc fingers<sup>1</sup>). <br />
Consequently, deciphering the TAL code also resulted in an enormous step towards democratizing targeted DNA manipulation<sup>2</sup>. Moreover, multiple protocols and open source kits have been published by the most influential labs in the field over the past year, which further popularized TALEs<sup>3,4,5</sup>.<br />
However, we believe that the last step of democratizing precise gene targeting has not been made yet – this is corroborated by the fact that the biotech companies Cellectis bioresearch and Invitrogen have launched quite expensive new TAL effector product lines during the last few months.<br />
In order to bring TAL technology within reach for everyone, in particular for future iGEM students, we identified the two main bottlenecks of conventional TALE assembly, namely that it is very time consuming and requires substantial training in molecular biology.<br />
In the next steps, we invented a method, that we refer to as Golden Gate cloning- based, automatable TAL Effector (GATE) assembly, and built the genetic parts (the GATE assembly toolkit) to actually assemble custom TALEs at record speed. Furthermore, we quantified the efficiency of our GATE assembly and tested our constructs in a Human Embryonic Kidney (HEK) cell line. We are proud to say that with our GATE assembly kit, future iGEM students will be able to easily assemble custom 12.5 repeat TALEs faster than anyone else in the world.<br />
While working on the GATE assembly kit, we learned a lot about Golden Gate cloning and came up with a strategy to introduce this powerful cloning technology to the iGEM registry as the Golden Gate standard without compromising existing standards. <br />
Our major goal was to empower future iGEM students to use and further develop TALE technology. That is why we dedicated a whole subsection of our project description to a step-by-step GATE assembly protocol (including a video tutorial).<br />
We believe that by enabling virtually anyone to specifically manipulate any locus even in the context of a complex genome, we have done the last step towards democratizing gene targeting. Although to date, the GATE assembly kit is complete for only a few weeks, we regularly receive requests from research groups all over Europe, asking for copies of the kit. Moreover, we got approached by the open source plasmid repository [http://www.addgene.org/ Addgene] that wants to distribute our toolkit. We are currently preparing to send our kit to them so the GATE kit will be available to everyone soon! That way, we have a significant impact also on the research world around iGEM.<br />
<br />
We believe that we have laid a solid foundation for super-easy site specific genome modifications for future iGEM teams.<br />
<br><br><br />
<br />
== [[Team:Freiburg/Project/Intro|Introduction]]==<br />
<div style="font-size: 12px"><br />
You don't know what TAL effectors actually are? We reviewed the recent literature for you, to give you a quick overview of this exciting new field of research.</div><br />
<br><br />
== [[Team:Freiburg/Project/Golden|Golden Gate Standard]]==<br />
<br />
<div style=" font-size: 12px;align=justify"> Assembling multiple gene constructs in frame without leaving scars is not possible with existing iGEM standards. We therefore introduce the new Golden-Gate Standard that is fully compatible with RFC10.</div><br />
<br><br />
<br />
==[[Team:Freiburg/Project/Vektor|The TAL Vector]]==<br />
<br />
<div style=" font-size: 12px;align=justify">Targeting a sequence and not doing something to it, is like throwing mechanics at your car. Your car will not get any better only the mechanics will get mad. Because we know this, we bring the tools you need to actually work with DNA.To make it even more easy these tools are deliverd already inside the final TAL backbone, just add the sequence and you're ready.</div><br />
<br><br />
== [[Team:Freiburg/Project/Overview|GATE Assembly Kit]]==<br />
<br />
<div style=" font-size: 12px;align=justify"> We have invented a super-fast, super-easy and super-cheap Method for custom TAL effector construction. Learn about the theory behind the TAL effector toolkit, how we created it and why we choose this design.</div><br />
<br><br />
==[[Team:Freiburg/Project/Tal|Using the Toolkit]]==<br />
<br />
<div style=" font-size: 12px; align=justify">Our overall goal is to empower future iGEM teams to use the most exciting new technology synthetic biology has to offer. We therefore not only invented the GATE assembly platform but wrote a step by step manual for super-easy custom TALE construction <br />
</div><br />
<br><br />
==[[Team:Freiburg/Project/Robot|The Future of TAL]]==<br />
<br />
<div style=" font-size: 12px;align=justify">Until now, almost three years after deciphering the TALE code, only two types of TAL Effectors have been developed: TALENs and TAL-TFs. We herein propose additional classes of TAL effectors.</div><br />
<br><br />
==[[Team:Freiburg/Project/Experiments|Experiments and Results]]==<br />
<div style=" font-size: 12px; align=justify">We not only rigorously tested if our in vitro TALE gene assembly method works but also if our TALE constructs actually work in a human cell line. Check out test design and results.</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
==References==<br />
<br />
<br />
1. Maeder, M. L. et al. Rapid ‘Open-Source’ Engineering of Customized Zinc-Finger Nucleases for Highly Efficient Gene Modification. ''Molecular Cell'' 31, 294–301 (2008).<br><br />
2. Clark, K. J., Voytas, D. F. & Ekker, S. C. A TALE of two nucleases: gene targeting for the masses? ''Zebrafish'' 8, 147–149 (2011).<br><br />
3. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. ''Nature Protocols'' 7, 171–192 (2012).<br><br />
4. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
5. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Pablinitushttp://2012.igem.org/Team:Freiburg/ProjectTeam:Freiburg/Project2012-10-26T22:42:29Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
= Project =<br />
----<br />
<br><br />
[[File:projectsymbolT.png|center|180px|link=]]<br />
<br><br />
== Overview ==<br />
<br />
<div align="justify">TALE technology currently revolutionizes synthetic biology, not only because of higher sequence fidelity or less cytotoxicity compared to other DNA binding proteins (e.g. zinc fingers). The main advantage is that they can be produced rationally to bind a DNA sequence of choice, whereas zinc fingers with the desired binding properties need to be selected from a library of fingers.<br />
That is why TAL technology is generally much less costly, time consuming and does guarantee binding sites for every predefined sequence (although open source platforms have also been published for zinc fingers<sup>1</sup>). <br />
Consequently, deciphering the TAL code also resulted in an enormous step towards democratizing targeted DNA manipulation<sup>2</sup>. Moreover, multiple protocols and open source kits have been published by the most influential labs in the field over the past year, which further popularized TALEs<sup>3,4,5</sup>.<br />
However, we believe that the last step of democratizing precise gene targeting has not been made yet – this is corroborated by the fact that the biotech companies Cellectis bioresearch and Invitrogen have launched quite expensive new TAL effector product lines during the last few months.<br />
In order to bring TAL technology within reach for everyone, in particular for future iGEM students, we identified the two main bottlenecks of conventional TALE assembly, namely that it is very time consuming and requires substantial training in molecular biology.<br />
In the next steps, we invented a method, that we refer to as Golden Gate cloning- based, automatable TAL Effector (GATE) assembly, and built the genetic parts (the GATE assembly toolkit) to actually assemble custom TALEs at record speed. Furthermore, we quantified the efficiency of our GATE assembly and tested our constructs in a Human Embryonic Kidney (HEK) cell line. We are proud to say that with our GATE assembly kit, future iGEM students will be able to easily assemble custom 12.5 repeat TALEs faster than anyone else in the world.<br />
While working on the GATE assembly kit, we learned a lot about Golden Gate cloning and came up with a strategy to introduce this powerful cloning technology to the iGEM registry as the Golden Gate standard without compromising existing standards. <br />
Our major goal was to empower future iGEM students to use and further develop TALE technology. That is why we dedicated a whole subsection of our project description to a step-by-step GATE assembly protocol (including a video tutorial).<br />
We believe that by enabling virtually anyone to specifically manipulate any locus even in the context of a complex genome, we have done the last step towards democratizing gene targeting. Although to date, the GATE assembly kit is complete for only a few weeks, we regularly receive requests from research groups all over Europe, asking for copies of the kit. Moreover, we got approached by the open source plasmid repository [http://www.addgene.org/ Addgene] that wants to distribute our toolkit. We are currently preparing to send our kit to them so the GATE kit will be available to everyone soon! That way, we have a significant impact also on the research world around iGEM.<br />
<br />
We believe that we have laid a solid foundation for super-easy site specific genome modifications for future iGEM teams.<br />
<br><br><br />
<br />
== [[Team:Freiburg/Project/Intro|Introduction]]==<br />
<div style="font-size: 12px"><br />
You don't know what TAL effectors actually are? We reviewed the recent literature for you, to give you a quick overview of this exciting new field of research.</div><br />
<br><br />
== [[Team:Freiburg/Project/Golden|Golden Gate Standard]]==<br />
<br />
<div style=" font-size: 12px;align=justify"> Assembling multiple gene constructs in frame without leaving scars is not possible with existing iGEM standards. We therefore introduce the new Golden-Gate Standard that is fully compatible with RFC 10.</div><br />
<br><br />
<br />
==[[Team:Freiburg/Project/Vektor|The TAL Vector]]==<br />
<br />
<div style=" font-size: 12px;align=justify">Targeting a sequence and not doing something to it, is like throwing mechanics at your car. Your car will not get any better only the mechanics will get mad. Because we know this, we bring the tools you need to actually work with DNA.To make it even more easy these tools are deliverd already inside the final TAL backbone, just add the sequence and you're ready.</div><br />
<br><br />
== [[Team:Freiburg/Project/Overview|GATE Assembly Kit]]==<br />
<br />
<div style=" font-size: 12px;align=justify"> We have invented a super-fast, super-easy and super-cheap Method for custom TAL effector construction. Learn about the theory behind the TAL effector toolkit, how we created it and why we choose this design.</div><br />
<br><br />
==[[Team:Freiburg/Project/Tal|Using the Toolkit]]==<br />
<br />
<div style=" font-size: 12px; align=justify">Our overall goal is to empower future iGEM teams to use the most exciting new technology synthetic biology has to offer. We therefore not only invented the GATE assembly platform but wrote a step by step manual for super-easy custom TALE construction <br />
</div><br />
<br><br />
==[[Team:Freiburg/Project/Robot|The Future of TAL]]==<br />
<br />
<div style=" font-size: 12px;align=justify">Until now, almost three years after deciphering the TALE code, only two types of TAL Effectors have been developed: TALENs and TAL-TFs. We herein propose additional classes of TAL effectors.</div><br />
<br><br />
==[[Team:Freiburg/Project/Experiments|Experiments and Results]]==<br />
<div style=" font-size: 12px; align=justify">We not only rigorously tested if our in vitro TALE gene assembly method works but also if our TALE constructs actually work in a human cell line. Check out test design and results.</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
==References==<br />
<br />
<br />
1. Maeder, M. L. et al. Rapid ‘Open-Source’ Engineering of Customized Zinc-Finger Nucleases for Highly Efficient Gene Modification. ''Molecular Cell'' 31, 294–301 (2008).<br><br />
2. Clark, K. J., Voytas, D. F. & Ekker, S. C. A TALE of two nucleases: gene targeting for the masses? ''Zebrafish'' 8, 147–149 (2011).<br><br />
3. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. ''Nature Protocols'' 7, 171–192 (2012).<br><br />
4. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
5. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/IntroTeam:Freiburg/Project/Intro2012-10-26T22:41:20Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<html><br />
<head><br />
<!-- Timeline script adapted from http://www.csslab.cl/2011/08/18/jquery-timelinr/. Thanks!! --><br />
<br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/><br />
<br />
<link rel="stylesheet" href="<br />
http://omnibus.uni-freiburg.de/~lb125/css/style.css" type="text/css" media="screen" /><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js" type="text/javascript"></script><br />
<br />
<script src="http://omnibus.uni-freiburg.de/~lb125/js/jquery.timelinr-0.9.51.js" type="text/javascript"></script><br />
<br />
<script type="text/javascript"> <br />
<br />
$(function(){<br />
$().timelinr({<br />
orientation: 'horizontal',<br />
containerDiv: '#timeline',<br />
datesDiv: '#dates',<br />
datesSelectedClass: 'selected',<br />
datesSpeed: 'normal',<br />
issuesDiv : '#issues',<br />
issuesSelectedClass: 'selected',<br />
issuesSpeed: 'fast',<br />
issuesTransparency: 0.2,<br />
issuesTransparencySpeed: 500,<br />
prevButton: '#prev',<br />
nextButton: '#next',<br />
arrowKeys: 'false',<br />
startAt: 1,<br />
autoPlay: 'false',<br />
autoPlayDirection: 'forward',<br />
autoPlayPause: 2000<br />
});<br />
});<br />
<br />
</script><br />
<br />
<!-- End timeline --><br />
<br />
<br />
<style type="text/css"><br />
#ip_quote<br />
{<br />
margin-top:0px;<br />
margin-bottom:0px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:75%;<br />
color:#C22227;<br />
font-size:140%;<br />
line-height:140%;<br />
text-align:justify;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
__NOTOC__<br />
= Introduction =<br />
----<br />
<html><br />
<!-- BEGIN TIMELINE WHITEBOX HERE --><br />
<div name="talhistory"><br />
<div id="timeline"><br />
<br />
<ul id="dates"><br />
<li><a href="#" class="dateobject">2009</a></li><br />
<li><a href="#" class="dateobject">2010</a></li><br />
<li><a href="#" class="dateobject">02/11</a></li><br />
<li><a href="#" class="dateobject">10/11</a></li><br />
<li><a href="#" class="dateobject">12/11</a></li><br />
<li><a href="#" class="dateobject">02/12</a></li><br />
<li><a href="#" class="dateobject">04/12</a></li><br />
<li><a href="#" class="dateobject">iGEM'12</a></li><br />
</ul><br />
<br />
<br />
<div id="grad_left"></div><br />
<br />
<div id="grad_right"></div><br />
<br />
<a href="#" id="next">+</a><br />
<br />
<a href="#" id="prev">-</a><br />
<br />
<br />
<ul id="issues"><br />
<br />
<br />
<br />
<li id="#2009"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_09.png" width="256" height="170" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2009</div><br />
<br />
<p>Two research groups publish the TAL Effector codes in the same issue of Science: Amino acid 12 and 13 of every DNA binding module specifically binds to one nucleotide</p><br />
<br />
</li><br />
<br />
<br />
<li id="#2010"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_10.png" width="256" height="200" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2010</div><br />
<br />
<p>Voytas Lab develops TALENs. These fusion proteins of FokI and a TAL protein cut as dimers and allow researchers to cut virtually anywhere in the genome. Since double strand breaks increase efficiency of homologous recombination, TALENS are a powerful tool for genetic engineering and gene therapy</p><br />
<br />
</li><br />
<br />
<li id="#02/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_11.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2011</div><br />
<br />
<p>Based on an exclusive licensing agreement with the University of Minnasota, Cellectis bioresearch launches its TAL effector product line. One TALEN pair currently costs 5000 Euro (6454 US$, 26.10.12).</p><br />
<br />
</li><br />
<br />
<br />
<li id="#10/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2011</div><br />
<br />
<p>The iGEM team from Harvard University employed fancy and expensive techniques to find up to 15 new zinc fingers (each of which binds to 3 bp). There has to be a better way…</p><br />
<br />
</li><br />
<br />
<br />
<li id="#12/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/12_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">December 2011</div><br />
<br />
<p>Nature chooses TALENs as the 2011 Method of the year.</p><br />
<br />
</li><br />
<br />
<li id="#02/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2012</div><br />
<br />
<p>The first two crystal structures of TALE modules bound to DNA published in the same issue of Science. The protein literally wraps itself around the DNA double helix and forms these beautiful symmetric shapes.</p><br />
<br />
</li><br />
<br />
<br />
<br />
<li id="#04/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/04_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">April 2012</div><br />
<br />
<p>Joung lab publishes FLASH assembly in Nature Biotechnology. This first automatable TAL assembly platform facilitates assembly of 96 TAL DNA fragments in less than a day using a pipeting robot.</p><br />
<br />
</li><br />
<br />
<br />
<li id="freiGEM'12"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_12.png" width="200" height="130" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2012</div><br />
<br />
<p>The Freiburg iGEM team makes TALE technology available to everyone by introducing the GATE assembly kit. For TALEs targeting 14 bp, this platform is currently the fastest, cheapest and easiest method in the world.</p><br />
<br />
</li><br />
<br />
</ul><br />
<br />
<br />
</div><br />
</div><br />
<br />
<!-- END TIMELINE WHITEBOX HERE --><br />
<br />
<br />
<p><div align="justify">Originally, TAL proteins are virulence factors of the plant-pathogenic ''Xanthomonas spp.'' that are injected into plant cells via a type III secretion system in order to modulate transcription<sup>1</sup>. For this purpose, their c-terminal end contains a nuclear localisation signal (NLS) and an acidic activation domain. The central part of the TAL protein contains a number of almost similar repeats that mediate specific binding to target loci in the genome.<br />
In 2009, two groups have simultaneously pointed out that each of these repeats specifically binds to one base of the target DNA via two amino acids (aa 12 and 13), named the repeat variable diresidues (RVD)<sup>2</sup>. Moreover, it has been shown that DNA binding of these proteins is highly modular, i.e. the number of bases or sequence of the target DNA can be altered by adjusting the number or order of the repeats in the TAL protein, respectively.<br />
The minimal condition for TALE activity is a thymine at the 5’ end of the target sequence. Further target sequence requirements that allow for one TALEN pair binding site every 35 bp (published by the Voytas lab in 2011<sup>3</sup>) have recently been questioned by Reyon et al.<sup>4</sup> In summary, it is very likely that you can find multiple potential TALE binding sites in any sequence you want to target.<br />
This, obviously, is very promising for biotechnological and clinical applications. Thus, two major classes of TAL Effectors have been created by replacing the natural acidic activation domain either by other transcription factors (TALE-TFs) <sup>5</sup> or by a monomer of the non-sequence specific nuclease FokI, resulting in TAL Effector Nucleases (TALENS).<sup>6</sup> A pair of TALENs can be designed to bind adjacent DNA sequences in a way that the two monomers are able to form a functional FokI dimer that produces a double strand break (DBS) within the spacer between the TAL-Effectors (see figure 2). <br><br><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/TAL-figure13T.png" width="500px" style="margin-left:150px"/><br><div align="center">Figure 2: Schematic drawings of a TAL-TF and a TALEN pair<sup>13</sup></div><br><br><br />
<br />
Subsequently, the cell repairs the DBS by either non-homologous end joining (NHEJ, which results in indels at the DSB-site) or homologous recombination of exogenously added genetic material. That way, TALENs allow researchers to introduce genes into a genome with much higher efficiency than before.<br />
In this context, TALENs and TALE-TF have successfully been applied for manipulation of a series of genes in different organisms such as yeast<sup>7</sup>, tobacco<sup>3</sup>, fruitflies<sup>6,8</sup>,worms<sup>6,9</sup>, zebrafish<sup>10</sup>, rats<sup>11</sup> and various human cell types, including human stem cells<sup>12</sup>. Moreover, TALENs are already applied for gene therapy in preclinical trials.<br><br><br />
<br />
<br />
<br><br />
<div style="color: #1C649F; font-size: 20px;font-family: Gill Sans MT">References</div><br><br />
1. Scholze, H. & Boch, J. TAL effectors are remote controls for gene activation. ''Current Opinion in Microbiology'' 14, 47–53 (2011).<br><br />
2. Moscou, M. J. & Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effectors. ''Science'' 326, 1501–1501 (2009).<br><br />
3. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
4. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
5. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nature biotechnology'' 29, 149–153 (2011).<br><br />
6. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nature Biotechnology'' 29, 143–148 (2010).<br><br />
7. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br />
8. Liu, J. et al. Efficient and Specific Modifications of the Drosophila Genome by Means of an Easy TALEN Strategy. ''Journal of Genetics and Genomics'' 39, 209–215 (2012).<br><br />
9. Wood, A. J. et al. Targeted Genome Editing Across Species Using ZFNs and TALENs. ''Science'' 333, 307–307 (2011).<br><br />
10. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol'' 29, 697–698 (2011).<br><br />
11. Tesson, L. et al. Knockout rats generated by embryo microinjection of TALENs. ''Nature Biotechnology'' 29, 695–696 (2011).<br><br />
12. Hockemeyer, D. et al. Genetic engineering of human pluripotent cells using TALE nucleases. ''Nature Biotechnology'' 29, 731–734 (2011)<br />
13. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).<br />
<br />
<br><br><br />
</html><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/File:TAL-figure13T.pngFile:TAL-figure13T.png2012-10-26T22:40:41Z<p>Pablinitus: </p>
<hr />
<div></div>Pablinitushttp://2012.igem.org/Team:Freiburg/ProjectTeam:Freiburg/Project2012-10-26T16:33:20Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
= Project =<br />
----<br />
<br><br />
[[File:projectsymbolT.png|center|180px|link=]]<br />
<br><br />
== Overview ==<br />
<br />
<div align="justify">TALE technology is a huge revolution in synthetic biology not only because of higher sequence fidelity or less cytotoxicity compared to other DNA binding proteins (e.g. zinc fingers). The main advantage is that they can be produced rationally to bind other a DNA sequence of choice, whereas zinc fingers with the desired binding properties need to be selected from a library of fingers. That is why this technology is generally very costly, time consuming and does not guarantee binding sites for every predefined sequence, although open source platforms have been published for zinc fingers<sup>1</sup>. Relatively few laboratories can actually afford using the zinc finger technology.<br />
Consequently, deciphering the TAL code also resulted in a huge step towards democratizing targeted DNA manipulation<sup>2</sup>. Moreover, multiple protocols and open source kits have been published by the few most influential labs in the field over the past year, which further popularized TALEs<sup>3,4,5</sup>.<br />
However, we believe that the last step of democratizing precise gene targeting has not been made yet – this hypothesis is corroborated by the fact that the biotech companies Cellectis bioresearch and Invitrogen have launched quite expensive new TAL effector product lines during the last few months.<br />
In order to bring TAL technology within reach for everyone, in particular for future iGEM students, we identified the two main bottlenecks of conventional TALE assembly, namely that it is very time consuming and requires substantial training in molecular biology.<br />
In the next steps, we invented a new method, called Golden Gate cloning- based, automatable TAL Effector (GATE) assembly, and built the genetic parts (the GATE assembly toolkit) to actually assemble custom TALEs. Furthermore, we quantified the efficiency of our GATE assembly and tested our constructs in a Human Embryonic Kidney (HEK) cell line. We are proud to say that with our GATE assembly kit, future iGEM students will be able to easily assemble custom 12.5 repeat TALEs faster than anyone else in the world.<br />
Working on the GATE assembly kit, we learned a lot about Golden Gate cloning and came up with a strategy to introduce this powerful cloning technology to the iGEM registry as the Golden Gate standard without compromising RFC 10 standard. <br />
Our major goal was to empower future iGEM students to use and further develop TALE technology. That is why we dedicated a whole subsection of our project description to a step-by-step GATE assembly protocol.<br />
We believe that by enabling virtually anyone to specifically manipulate any locus even in the context of a whole genome, we have done the last step towards democratizing gene targeting. Although to date, the GATE assembly kit is complete for little less than a week, we receive requests from research groups in Freiburg almost every day, asking for copies of the kit.<br />
We are therefore thinking about giving the kit to the open source plasmid repository [http://www.addgene.org/ Addgene] so that it can have a positive impact on the research world around iGEM.<br />
<br />
We believe that we have laid a solid foundation for super-easy site specific genome modifications for future iGEM teams.<br />
<br><br><br />
<br />
== [[Team:Freiburg/Project/Intro|Introduction]]==<br />
<div style="color: #1C649F; font-size: 12px"><br />
You don't know what TAL effectors actually are? We reviewed the recent literature for you, to give you a quick overview of this exciting new field of research.</div><br />
<br><br />
== [[Team:Freiburg/Project/Golden|Golden Gate Standard]]==<br />
<br />
<div style="color: #1C649F; font-size: 12px;align=justify"> Assembling multiple gene constructs in frame without leaving scars is not possible with existing iGEM standards. We therefore introduce the new Golden-Gate Standard that is fully compatible with RFC 10.</div><br />
<br><br />
<br />
==[[Team:Freiburg/Project/Vektor|The TAL Vector]]==<br />
<br />
<div style="color: #1C649F; font-size: 12px;align=justify">Targeting a sequence and not doing something to it, is like throwing mechanics at your car. Your car will not get any better only the mechanics will get mad. Because we know this, we bring the tools you need to actually work with DNA.To make it even more easy these tools are deliverd already inside the final TAL backbone, just add the sequence and you're ready.</div><br />
<br><br />
== [[Team:Freiburg/Project/Overview|GATE Assembly Kit]]==<br />
<br />
<div style="color: #1C649F; font-size: 12px;align=justify"> We have invented a super-fast, super-easy and super-cheap Method for custom TAL effector construction. Learn about the theory behind the TAL effector toolkit, how we created it and why we choose this design.</div><br />
<br><br />
==[[Team:Freiburg/Project/Tal|Using the Toolkit]]==<br />
<br />
<div style="color: #1C649F; font-size: 12px; align=justify">Our overall goal is to empower future iGEM teams to use the most exciting new technology synthetic biology has to offer. We therefore not only invented the GATE assembly platform but wrote a step by step manual for super-easy custom TALE construction <br />
</div><br />
<br><br />
==[[Team:Freiburg/Project/Robot|The Future of TAL]]==<br />
<br />
<div style="color: #1C649F; font-size: 12px;align=justify">Until now, almost three years after deciphering the TALE code, only two types of TAL Effectors have been developed: TALENs and TAL-TFs. We herein propose additional classes of TAL effectors.</div><br />
<br><br />
==[[Team:Freiburg/Project/Experiments|Experiments and Results]]==<br />
<div style="color: #1C649F; font-size: 12px; align=justify">We not only rigorously tested if our in vitro TALE gene assembly method works but also if our TALE constructs actually work in a human cell line. Check out test design and results.</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
==References==<br />
<br />
<br />
1. Maeder, M. L. et al. Rapid ‘Open-Source’ Engineering of Customized Zinc-Finger Nucleases for Highly Efficient Gene Modification. ''Molecular Cell'' 31, 294–301 (2008).<br><br />
2. Clark, K. J., Voytas, D. F. & Ekker, S. C. A TALE of two nucleases: gene targeting for the masses? ''Zebrafish'' 8, 147–149 (2011).<br><br />
3. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. ''Nature Protocols'' 7, 171–192 (2012).<br><br />
4. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
5. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Pablinitushttp://2012.igem.org/Team:Freiburg/ProjectTeam:Freiburg/Project2012-10-26T16:32:45Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
= Project =<br />
----<br />
<br><br />
[[File:projectsymbolT.png|center|180px|link=]]<br />
<br><br />
== Overview ==<br />
<br />
<div align="justify">TALE technology is a huge revolution in synthetic biology not only because of higher sequence fidelity or less cytotoxicity compared to other DNA binding proteins (e.g. zinc fingers). The main advantage is that they can be produced rationally to bind other a DNA sequence of choice, whereas zinc fingers with the desired binding properties need to be selected from a library of fingers. That is why this technology is generally very costly, time consuming and does not guarantee binding sites for every predefined sequence, although open source platforms have been published for zinc fingers<sup>1</sup>. Relatively few laboratories can actually afford using the zinc finger technology.<br />
Consequently, deciphering the TAL code also resulted in a huge step towards democratizing targeted DNA manipulation<sup>2</sup>. Moreover, multiple protocols and open source kits have been published by the few most influential labs in the field over the past year, which further popularized TALEs<sup>3,4,5</sup>.<br />
However, we believe that the last step of democratizing precise gene targeting has not been made yet – this hypothesis is corroborated by the fact that the biotech companies Cellectis bioresearch and Invitrogen have launched quite expensive new TAL effector product lines during the last few months.<br />
In order to bring TAL technology within reach for everyone, in particular for future iGEM students, we identified the two main bottlenecks of conventional TALE assembly, namely that it is very time consuming and requires substantial training in molecular biology.<br />
In the next steps, we invented a new method, called Golden Gate cloning- based, automatable TAL Effector (GATE) assembly, and built the genetic parts (the GATE assembly toolkit) to actually assemble custom TALEs. Furthermore, we quantified the efficiency of our GATE assembly and tested our constructs in a Human Embryonic Kidney (HEK) cell line. We are proud to say that with our GATE assembly kit, future iGEM students will be able to easily assemble custom 12.5 repeat TALEs faster than anyone else in the world.<br />
Working on the GATE assembly kit, we learned a lot about Golden Gate cloning and came up with a strategy to introduce this powerful cloning technology to the iGEM registry as the Golden Gate standard without compromising RFC 10 standard. <br />
Our major goal was to empower future iGEM students to use and further develop TALE technology. That is why we dedicated a whole subsection of our project description to a step-by-step GATE assembly protocol.<br />
We believe that by enabling virtually anyone to specifically manipulate any locus even in the context of a whole genome, we have done the last step towards democratizing gene targeting. Although to date, the GATE assembly kit is complete for little less than a week, we receive requests from research groups in Freiburg almost every day, asking for copies of the kit.<br />
We are therefore thinking about giving the kit to the open source plasmid repository [http://www.addgene.org/ Addgene] so that it can have a positive impact on the research world around iGEM.<br />
<br />
We believe that we have laid a solid foundation for super-easy site specific genome modifications for future iGEM teams.<br />
<br><br><br />
<br />
== [[Team:Freiburg/Project/Intro|Introduction]]==<br />
<div style="color: #1C649F; font-size: 10px"><br />
You don't know what TAL effectors actually are? We reviewed the recent literature for you, to give you a quick overview of this exciting new field of research.</div><br />
<br><br />
== [[Team:Freiburg/Project/Golden|Golden Gate Standard]]==<br />
<br />
<div style="color: #1C649F; font-size: 10px;align=justify"> Assembling multiple gene constructs in frame without leaving scars is not possible with existing iGEM standards. We therefore introduce the new Golden-Gate Standard that is fully compatible with RFC 10.</div><br />
<br><br />
<br />
==[[Team:Freiburg/Project/Vektor|The TAL Vector]]==<br />
<br />
<div style="color: #1C649F; font-size: 10px;align=justify">Targeting a sequence and not doing something to it, is like throwing mechanics at your car. Your car will not get any better only the mechanics will get mad. Because we know this, we bring the tools you need to actually work with DNA.To make it even more easy these tools are deliverd already inside the final TAL backbone, just add the sequence and you're ready.</div><br />
<br><br />
== [[Team:Freiburg/Project/Overview|GATE Assembly Kit]]==<br />
<br />
<div style="color: #1C649F; font-size: 10px;align=justify"> We have invented a super-fast, super-easy and super-cheap Method for custom TAL effector construction. Learn about the theory behind the TAL effector toolkit, how we created it and why we choose this design.</div><br />
<br><br />
==[[Team:Freiburg/Project/Tal|Using the Toolkit]]==<br />
<br />
<div style="color: #1C649F; font-size: 10px; align=justify">Our overall goal is to empower future iGEM teams to use the most exciting new technology synthetic biology has to offer. We therefore not only invented the GATE assembly platform but wrote a step by step manual for super-easy custom TALE construction <br />
</div><br />
<br><br />
==[[Team:Freiburg/Project/Robot|The Future of TAL]]==<br />
<br />
<div style="color: #1C649F; font-size: 10px;align=justify">Until now, almost three years after deciphering the TALE code, only two types of TAL Effectors have been developed: TALENs and TAL-TFs. We herein propose additional classes of TAL effectors.</div><br />
<br><br />
==[[Team:Freiburg/Project/Experiments|Experiments and Results]]==<br />
<div style="color: #1C649F; font-size: 10px; align=justify">We not only rigorously tested if our in vitro TALE gene assembly method works but also if our TALE constructs actually work in a human cell line. Check out test design and results.</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
==References==<br />
<br />
<br />
1. Maeder, M. L. et al. Rapid ‘Open-Source’ Engineering of Customized Zinc-Finger Nucleases for Highly Efficient Gene Modification. ''Molecular Cell'' 31, 294–301 (2008).<br><br />
2. Clark, K. J., Voytas, D. F. & Ekker, S. C. A TALE of two nucleases: gene targeting for the masses? ''Zebrafish'' 8, 147–149 (2011).<br><br />
3. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. ''Nature Protocols'' 7, 171–192 (2012).<br><br />
4. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
5. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Pablinitushttp://2012.igem.org/Team:Freiburg/ProjectTeam:Freiburg/Project2012-10-26T16:31:54Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
= Project =<br />
----<br />
<br><br />
[[File:projectsymbolT.png|center|180px|link=]]<br />
<br><br />
== Overview ==<br />
<br />
<div align="justify">TALE technology is a huge revolution in synthetic biology not only because of higher sequence fidelity or less cytotoxicity compared to other DNA binding proteins (e.g. zinc fingers). The main advantage is that they can be produced rationally to bind other a DNA sequence of choice, whereas zinc fingers with the desired binding properties need to be selected from a library of fingers. That is why this technology is generally very costly, time consuming and does not guarantee binding sites for every predefined sequence, although open source platforms have been published for zinc fingers<sup>1</sup>. Relatively few laboratories can actually afford using the zinc finger technology.<br />
Consequently, deciphering the TAL code also resulted in a huge step towards democratizing targeted DNA manipulation<sup>2</sup>. Moreover, multiple protocols and open source kits have been published by the few most influential labs in the field over the past year, which further popularized TALEs<sup>3,4,5</sup>.<br />
However, we believe that the last step of democratizing precise gene targeting has not been made yet – this hypothesis is corroborated by the fact that the biotech companies Cellectis bioresearch and Invitrogen have launched quite expensive new TAL effector product lines during the last few months.<br />
In order to bring TAL technology within reach for everyone, in particular for future iGEM students, we identified the two main bottlenecks of conventional TALE assembly, namely that it is very time consuming and requires substantial training in molecular biology.<br />
In the next steps, we invented a new method, called Golden Gate cloning- based, automatable TAL Effector (GATE) assembly, and built the genetic parts (the GATE assembly toolkit) to actually assemble custom TALEs. Furthermore, we quantified the efficiency of our GATE assembly and tested our constructs in a Human Embryonic Kidney (HEK) cell line. We are proud to say that with our GATE assembly kit, future iGEM students will be able to easily assemble custom 12.5 repeat TALEs faster than anyone else in the world.<br />
Working on the GATE assembly kit, we learned a lot about Golden Gate cloning and came up with a strategy to introduce this powerful cloning technology to the iGEM registry as the Golden Gate standard without compromising RFC 10 standard. <br />
Our major goal was to empower future iGEM students to use and further develop TALE technology. That is why we dedicated a whole subsection of our project description to a step-by-step GATE assembly protocol.<br />
We believe that by enabling virtually anyone to specifically manipulate any locus even in the context of a whole genome, we have done the last step towards democratizing gene targeting. Although to date, the GATE assembly kit is complete for little less than a week, we receive requests from research groups in Freiburg almost every day, asking for copies of the kit.<br />
We are therefore thinking about giving the kit to the open source plasmid repository [http://www.addgene.org/ Addgene] so that it can have a positive impact on the research world around iGEM.<br />
<br />
We believe that we have laid a solid foundation for super-easy site specific genome modifications for future iGEM teams.<br />
<br><br><br />
<br />
== [[Team:Freiburg/Project/Intro|Introduction]]==<br />
<div style="color: #1C649F; font-size: 14px"><br />
You don't know what TAL effectors actually are? We reviewed the recent literature for you, to give you a quick overview of this exciting new field of research.</div><br />
<br><br />
== [[Team:Freiburg/Project/Golden|Golden Gate Standard]]==<br />
<br />
<div style="color: #1C649F; font-size: 14px;align=justify"> Assembling multiple gene constructs in frame without leaving scars is not possible with existing iGEM standards. We therefore introduce the new Golden-Gate Standard that is fully compatible with RFC 10.</div><br />
<br><br />
<br />
==[[Team:Freiburg/Project/Vektor|The TAL Vector]]==<br />
<br />
<div style="color: #1C649F; font-size: 14px;align=justify">Targeting a sequence and not doing something to it, is like throwing mechanics at your car. Your car will not get any better only the mechanics will get mad. Because we know this, we bring the tools you need to actually work with DNA.To make it even more easy these tools are deliverd already inside the final TAL backbone, just add the sequence and you're ready.</div><br />
<br><br />
== [[Team:Freiburg/Project/Overview|GATE Assembly Kit]]==<br />
<br />
<div style="color: #1C649F; font-size: 14px;align=justify"> We have invented a super-fast, super-easy and super-cheap Method for custom TAL effector construction. Learn about the theory behind the TAL effector toolkit, how we created it and why we choose this design.</div><br />
<br><br />
==[[Team:Freiburg/Project/Tal|Using the Toolkit]]==<br />
<br />
<div style="color: #1C649F; font-size: 14px; align=justify">Our overall goal is to empower future iGEM teams to use the most exciting new technology synthetic biology has to offer. We therefore not only invented the GATE assembly platform but wrote a step by step manual for super-easy custom TALE construction <br />
</div><br />
<br><br />
==[[Team:Freiburg/Project/Robot|The Future of TAL]]==<br />
<br />
<div style="color: #1C649F; font-size: 14px;align=justify">Until now, almost three years after deciphering the TALE code, only two types of TAL Effectors have been developed: TALENs and TAL-TFs. We herein propose additional classes of TAL effectors.</div><br />
<br><br />
==[[Team:Freiburg/Project/Experiments|Experiments and Results]]==<br />
<div style="color: #1C649F; font-size: 14px; align=justify">We not only rigorously tested if our in vitro TALE gene assembly method works but also if our TALE constructs actually work in a human cell line. Check out test design and results.</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
==References==<br />
<br />
<br />
1. Maeder, M. L. et al. Rapid ‘Open-Source’ Engineering of Customized Zinc-Finger Nucleases for Highly Efficient Gene Modification. ''Molecular Cell'' 31, 294–301 (2008).<br><br />
2. Clark, K. J., Voytas, D. F. & Ekker, S. C. A TALE of two nucleases: gene targeting for the masses? ''Zebrafish'' 8, 147–149 (2011).<br><br />
3. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. ''Nature Protocols'' 7, 171–192 (2012).<br><br />
4. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
5. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Pablinitushttp://2012.igem.org/Team:Freiburg/ProjectTeam:Freiburg/Project2012-10-26T16:28:50Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
= Project =<br />
----<br />
<br><br />
[[File:projectsymbolT.png|center|180px|link=]]<br />
<br><br />
== Overview ==<br />
<br />
<div align="justify">TALE technology is a huge revolution in synthetic biology not only because of higher sequence fidelity or less cytotoxicity compared to other DNA binding proteins (e.g. zinc fingers). The main advantage is that they can be produced rationally to bind other a DNA sequence of choice, whereas zinc fingers with the desired binding properties need to be selected from a library of fingers. That is why this technology is generally very costly, time consuming and does not guarantee binding sites for every predefined sequence, although open source platforms have been published for zinc fingers<sup>1</sup>. Relatively few laboratories can actually afford using the zinc finger technology.<br />
Consequently, deciphering the TAL code also resulted in a huge step towards democratizing targeted DNA manipulation<sup>2</sup>. Moreover, multiple protocols and open source kits have been published by the few most influential labs in the field over the past year, which further popularized TALEs<sup>3,4,5</sup>.<br />
However, we believe that the last step of democratizing precise gene targeting has not been made yet – this hypothesis is corroborated by the fact that the biotech companies Cellectis bioresearch and Invitrogen have launched quite expensive new TAL effector product lines during the last few months.<br />
In order to bring TAL technology within reach for everyone, in particular for future iGEM students, we identified the two main bottlenecks of conventional TALE assembly, namely that it is very time consuming and requires substantial training in molecular biology.<br />
In the next steps, we invented a new method, called Golden Gate cloning- based, automatable TAL Effector (GATE) assembly, and built the genetic parts (the GATE assembly toolkit) to actually assemble custom TALEs. Furthermore, we quantified the efficiency of our GATE assembly and tested our constructs in a Human Embryonic Kidney (HEK) cell line. We are proud to say that with our GATE assembly kit, future iGEM students will be able to easily assemble custom 12.5 repeat TALEs faster than anyone else in the world.<br />
Working on the GATE assembly kit, we learned a lot about Golden Gate cloning and came up with a strategy to introduce this powerful cloning technology to the iGEM registry as the Golden Gate standard without compromising RFC 10 standard. <br />
Our major goal was to empower future iGEM students to use and further develop TALE technology. That is why we dedicated a whole subsection of our project description to a step-by-step GATE assembly protocol.<br />
We believe that by enabling virtually anyone to specifically manipulate any locus even in the context of a whole genome, we have done the last step towards democratizing gene targeting. Although to date, the GATE assembly kit is complete for little less than a week, we receive requests from research groups in Freiburg almost every day, asking for copies of the kit.<br />
We are therefore thinking about giving the kit to the open source plasmid repository [http://www.addgene.org/ Addgene] so that it can have a positive impact on the research world around iGEM.<br />
<br />
We believe that we have laid a solid foundation for super-easy site specific genome modifications for future iGEM teams.<br />
<br><br><br />
<br />
== [[Team:Freiburg/Project/Intro|Introduction]]==<br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT"><br />
You don't know what TAL effectors actually are? We reviewed the recent literature for you, to give you a quick overview of this exciting new field of research.</div><br />
<br><br />
== [[Team:Freiburg/Project/Golden|Golden Gate Standard]]==<br />
<br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT;align=justify"> Assembling multiple gene constructs in frame without leaving scars is not possible with existing iGEM standards. We therefore introduce the new Golden-Gate Standard that is fully compatible with RFC 10.</div><br />
<br><br />
<br />
==[[Team:Freiburg/Project/Vektor|The TAL Vector]]==<br />
<br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT;align=justify">Targeting a sequence and not doing something to it, is like throwing mechanics at your car. Your car will not get any better only the mechanics will get mad. Because we know this, we bring the tools you need to actually work with DNA.To make it even more easy these tools are deliverd already inside the final TAL backbone, just add the sequence and you're ready.</div><br />
<br><br />
== [[Team:Freiburg/Project/Overview|GATE Assembly Kit]]==<br />
<br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT;align=justify"> We have invented a super-fast, super-easy and super-cheap Method for custom TAL effector construction. Learn about the theory behind the TAL effector toolkit, how we created it and why we choose this design.</div><br />
<br><br />
==[[Team:Freiburg/Project/Tal|Using the Toolkit]]==<br />
<br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT;align=justify">Our overall goal is to empower future iGEM teams to use the most exciting new technology synthetic biology has to offer. We therefore not only invented the GATE assembly platform but wrote a step by step manual for super-easy custom TALE construction <br />
</div><br />
<br><br />
==[[Team:Freiburg/Project/Robot|The Future of TAL]]==<br />
<br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT;align=justify">Until now, almost three years after deciphering the TALE code, only two types of TAL Effectors have been developed: TALENs and TAL-TFs. We herein propose additional classes of TAL effectors.</div><br />
<br><br />
==[[Team:Freiburg/Project/Experiments|Experiments and Results]]==<br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT;align=justify">We not only rigorously tested if our in vitro TALE gene assembly method works but also if our TALE constructs actually work in a human cell line. Check out test design and results.</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
==References==<br />
<br />
<br />
1. Maeder, M. L. et al. Rapid ‘Open-Source’ Engineering of Customized Zinc-Finger Nucleases for Highly Efficient Gene Modification. ''Molecular Cell'' 31, 294–301 (2008).<br><br />
2. Clark, K. J., Voytas, D. F. & Ekker, S. C. A TALE of two nucleases: gene targeting for the masses? ''Zebrafish'' 8, 147–149 (2011).<br><br />
3. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. ''Nature Protocols'' 7, 171–192 (2012).<br><br />
4. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
5. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Pablinitushttp://2012.igem.org/Team:Freiburg/ProjectTeam:Freiburg/Project2012-10-26T16:27:06Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
= Project =<br />
----<br />
<br><br />
[[File:projectsymbolT.png|center|180px|link=]]<br />
<br><br />
== Overview ==<br />
<br />
<div align="justify">TALE technology is a huge revolution in synthetic biology not only because of higher sequence fidelity or less cytotoxicity compared to other DNA binding proteins (e.g. zinc fingers). The main advantage is that they can be produced rationally to bind other a DNA sequence of choice, whereas zinc fingers with the desired binding properties need to be selected from a library of fingers. That is why this technology is generally very costly, time consuming and does not guarantee binding sites for every predefined sequence, although open source platforms have been published for zinc fingers<sup>1</sup>. Relatively few laboratories can actually afford using the zinc finger technology.<br />
Consequently, deciphering the TAL code also resulted in a huge step towards democratizing targeted DNA manipulation<sup>2</sup>. Moreover, multiple protocols and open source kits have been published by the few most influential labs in the field over the past year, which further popularized TALEs<sup>3,4,5</sup>.<br />
However, we believe that the last step of democratizing precise gene targeting has not been made yet – this hypothesis is corroborated by the fact that the biotech companies Cellectis bioresearch and Invitrogen have launched quite expensive new TAL effector product lines during the last few months.<br />
In order to bring TAL technology within reach for everyone, in particular for future iGEM students, we identified the two main bottlenecks of conventional TALE assembly, namely that it is very time consuming and requires substantial training in molecular biology.<br />
In the next steps, we invented a new method, called Golden Gate cloning- based, automatable TAL Effector (GATE) assembly, and built the genetic parts (the GATE assembly toolkit) to actually assemble custom TALEs. Furthermore, we quantified the efficiency of our GATE assembly and tested our constructs in a Human Embryonic Kidney (HEK) cell line. We are proud to say that with our GATE assembly kit, future iGEM students will be able to easily assemble custom 12.5 repeat TALEs faster than anyone else in the world.<br />
Working on the GATE assembly kit, we learned a lot about Golden Gate cloning and came up with a strategy to introduce this powerful cloning technology to the iGEM registry as the Golden Gate standard without compromising RFC 10 standard. <br />
Our major goal was to empower future iGEM students to use and further develop TALE technology. That is why we dedicated a whole subsection of our project description to a step-by-step GATE assembly protocol.<br />
We believe that by enabling virtually anyone to specifically manipulate any locus even in the context of a whole genome, we have done the last step towards democratizing gene targeting. Although to date, the GATE assembly kit is complete for little less than a week, we receive requests from research groups in Freiburg almost every day, asking for copies of the kit.<br />
We are therefore thinking about giving the kit to the open source plasmid repository [http://www.addgene.org/ Addgene] so that it can have a positive impact on the research world around iGEM.<br />
<br />
We believe that we have laid a solid foundation for super-easy site specific genome modifications for future iGEM teams.<br />
<br><br><br />
<br />
== [[Team:Freiburg/Project/Intro|0. Introduction]]==<br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT"><br />
You don't know what TAL effectors actually are? We reviewed the recent literature for you, to give you a quick overview of this exciting new field of research.</div><br />
<br><br />
== [[Team:Freiburg/Project/Golden|1. Golden Gate Standard]]==<br />
<br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT;align=justify"> Assembling multiple gene constructs in frame without leaving scars is not possible with existing iGEM standards. We therefore introduce the new Golden-Gate Standard that is fully compatible with RFC 10.</div><br />
<br><br />
<br />
==[[Team:Freiburg/Project/Vektor|2. The TAL Vector]]==<br />
<br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT;align=justify">Targeting a sequence and not doing something to it, is like throwing mechanics at your car. Your car will not get any better only the mechanics will get mad. Because we know this, we bring the tools you need to actually work with DNA.To make it even more easy these tools are deliverd already inside the final TAL backbone, just add the sequence and you're ready.</div><br />
<br><br />
== [[Team:Freiburg/Project/Overview|3. GATE Assembly Kit]]==<br />
<br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT;align=justify"> We have invented a super-fast, super-easy and super-cheap Method for custom TAL effector construction. Learn about the theory behind the TAL effector toolkit, how we created it and why we choose this design.</div><br />
<br><br />
==[[Team:Freiburg/Project/Tal|4. Using the Toolkit]]==<br />
<br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT;align=justify">Our overall goal is to empower future iGEM teams to use the most exciting new technology synthetic biology has to offer. We therefore not only invented the GATE assembly platform but wrote a step by step manual for super-easy custom TALE construction <br />
</div><br />
<br><br />
==[[Team:Freiburg/Project/Robot|4. The Future of TAL]]==<br />
<br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT;align=justify">Until now, almost three years after deciphering the TALE code, only two types of TAL Effectors have been developed: TALENs and TAL-TFs. We herein propose additional classes of TAL effectors.</div><br />
<br><br />
==[[Team:Freiburg/Project/Experiments|5. Experiments and Results]]==<br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT;align=justify">We not only rigorously tested if our in vitro TALE gene assembly method works but also if our TALE constructs actually work in a human cell line. Check out test design and results.</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
==References==<br />
<br />
<br />
1. Maeder, M. L. et al. Rapid ‘Open-Source’ Engineering of Customized Zinc-Finger Nucleases for Highly Efficient Gene Modification. ''Molecular Cell'' 31, 294–301 (2008).<br><br />
2. Clark, K. J., Voytas, D. F. & Ekker, S. C. A TALE of two nucleases: gene targeting for the masses? ''Zebrafish'' 8, 147–149 (2011).<br><br />
3. Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. ''Nature Protocols'' 7, 171–192 (2012).<br><br />
4. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
5. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
<br />
<br><br><br />
[[#top|Back to top]]<br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Pablinitushttp://2012.igem.org/Template:Team:FreiburgTemplate:Team:Freiburg2012-10-26T16:26:05Z<p>Pablinitus: </p>
<hr />
<div><html><br />
<head><br />
<br />
<style type="text/css"><br />
.firstHeading { /* Gets rid of the default iGEM picture*/<br />
height:2px;<br />
visibility:hidden;<br />
} <br />
<br />
#contentSub, #search-controls, .firstHeading, #catlinks, #p-logo, .editsection {<br />
display:none;<br />
}<br />
<br />
#content {<br />
background-color: transparent;<br />
border-left-width:0px;<br />
border-right-width:0px;<br />
padding: 0px 5px 0px 5px;<br />
width:730px; /* Content width*/<br />
color: #222630; }<br />
<br />
#footer-box {<br />
display:none; <br />
background:none;<br />
border:none;<br />
}<br />
<br />
#menubar {<br />
display: table-cell;<br />
background: transparent;<br />
margin-left: 230px;<br />
margin-right: 230px;<br />
}<br />
<br />
<br />
#menubar * {<br />
color: transparent !important;<br />
background: transparent !important;<br />
}<br />
<br />
#menubar:hover * {<br />
color: blue !important;<br />
}<br />
<br />
<br />
#p-logo { height 1px; overflow:hidden; display: none;<br />
}<br />
<br />
#top-section <br />
{<br />
width: 100%;<br />
margin:0px;<br />
padding: 0px;<br />
background: #FFFFFF;<br />
background: url('https://static.igem.org/mediawiki/2012/c/ce/Headbreiter6T.png') no-repeat;<br />
background-size: 1340px;<br />
height: 220px;<br />
background-position: center;<br />
background-repeat: no-repeat;<br />
border-width:0px;<br />
border-top-width:0px;<br />
}<br />
#toc{<br />
visibility:hidden;<br />
display:none;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#search-controls { /* gets rid of the search bar (it was ugly) */<br />
display:none;<br />
margin-top:0px;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
/*Now to set heading and body fonts*/<br />
body {<br />
background: #fff url('https://static.igem.org/mediawiki/2012/2/2c/SW7.png') no-repeat fixed; /* Background (on side color)*/<br />
background-size: 1350px ;<br />
background-position: center top;<br />
} <br />
<br />
h0<br />
{<br />
text-align:left;<br />
font-family: Gill Sans MT;<br />
font-size:25px;<br />
color: #7fb1da;<br />
line-height:100%;<br />
border-bottom: none; <br />
padding:0px 0px 0px 0px; <br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
h1<br />
{<br />
text-align:left;<br />
font-family: Gill Sans MT;<br />
font-size:25px;<br />
color: #0C4777;<br />
line-height:100%;<br />
border-bottom: none; <br />
padding:0px 0px 0px 0px; <br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
h2<br />
{<br />
text-align:left;<br />
font-family: Gill Sans MT;<br />
font-size:20px;<br />
color: #1c649f;<br />
line-height:100%;<br />
border-bottom: none; <br />
padding:0px 0px 0px 0px; <br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
a[href^="https://"], .link-https {<br />
background: none !important;<br />
padding-right: 0 !important;<br />
}<br />
#p-logo <br />
{<br />
height:20px; overflow:hidden;display:none;<br />
}<br />
<br />
<br />
</style><br />
</head><br />
<body><br />
<html><br />
<br />
</body><br />
<body><br />
<head><br />
<meta><br />
<style><br />
#navbar <br />
{ <br />
padding: 0px;<br />
height: 2em; //innenmaß Dropdown<br />
float: center;<br />
display: inline;<br />
z-index: 1000;<br />
position: relative;<br />
}<br />
#navbar a:hover <br />
{<br />
background-color: #fbfbfb; <!navbar hover color><br />
text-decoration:underline;<br />
}<br />
#navbar li <br />
{<br />
list-style: none;<br />
float: left; <br />
}<br />
#navbar li a <br />
{<br />
padding-left: 10px;<br />
padding-bottom: 5px;<br />
padding-right: 10px;<br />
padding-top: 5px;<br />
display: block;<br />
background-color: ##fbfbfb;<br />
color: #1F68A4; //Textfarbe<br />
text-decoration: normal; <br />
border-right: 1px solid #4A7EA9;<br />
font-weight:normal;<br />
font-family: Gill Sans MT;<br />
font-size: 11.5pt;<br />
}<br />
#navbar li ul <br />
{<br />
display: none; <br />
width: 12em;<br />
background-color: #FFFFFF;<br />
}<br />
#navbar li:hover ul, #navbar li.hover ul <br />
{<br />
display: block;<br />
position: absolute;<br />
background-color: #E0ECF8;<br />
//background-color: #E0ECF8;<br />
margin: 0;<br />
padding: 0; <br />
}<br />
#navbar li:hover li, #navbar li.hover li <br />
{<br />
float: center; <br />
}<br />
#navbar li:hover li a, #navbar li.hover li a <br />
{<br />
background-color:#E0ECF8; /*Dropdown color*/<br />
color: #4F8DDE; <br />
border-right: none;<br />
}<br />
#navbar li li a:hover <br />
{<br />
background-color: #E0ECF8; <br />
}<br />
#design1{<br />
//background-image: url("https://static.igem.org/mediawiki/2012/6/63/Control_thump.jpg");<br />
}<br />
#design1:hover{<br />
//background-image: url("https://static.igem.org/mediawiki/2012/9/94/Control-Copenhagen.JPG");<br />
}<br />
#design2{<br />
background-image: url(" ");<br />
}<br />
#design2:hover{<br />
background-image: url(" ");<br />
}<br />
</style><br />
<script><br />
sfHover = function() <br />
{<br />
var sfEls = document.getElementById("navbar").getElementsByTagName("li");<br />
for (var i=0; i<sfEls.length; i++) <br />
{<br />
sfEls[i].onmouseover=function() <br />
{<br />
this.className+=" hover";<br />
}<br />
sfEls[i].onmouseout=function() <br />
{<br />
this.className=this.className.replace(new RegExp(" hover\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
</script><br />
</head><br />
</a><br />
<body> <br />
<br />
<div><br />
<ul id="navbar"><br />
<li><a href="https://2012.igem.org/Team:Freiburg">Home</a><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Team2">Team</a><br />
<ul><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Team2">Our Team</a></li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/gallery">Photo Gallery</a></li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Project/Coop">Collaborations</a></li><br />
<li><a href="https://igem.org/Team.cgi?id=747">Official team profile</a></li><br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Project">Project</a><br />
<ul><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Project">Overview</a></li> <br />
<li><a href="https://2012.igem.org/Team:Freiburg/Project/Intro">Introduction</a></li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Project/Golden">Golden Gate Standard</a></li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">The TAL Vector</a></li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Project/Overview">GATE Assembly Kit</a></li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Project/Tal">Using the Toolkit</a></li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Project/Robot">The Future of TAL</a></li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Project/Experiments ">Experiments and Results</a></li><br />
</ul> <br />
</li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Notebook">Notebook</a><br />
<ul><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Notebook/Toolkit">Labbook Toolkit</a></li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Notebook/TAL">Labbook TAL Vector</a></li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Notebook/Methoden">Methods</a></li><br />
</ul> <br />
</li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Parts">Parts</a><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Safety">Safety</a> <br />
</li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Modeling">Modeling</a><br />
<ul><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Modeling">Companel|DNA</a></li><br />
<li><a href="https://2012.igem.org/File:Freigem2012-CompanelDNA.zip">Download</a></li><br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/HumanPractices/Overview">Human Practices</a><br />
<ul><br />
<li><a href="https://2012.igem.org/Team:Freiburg/HumanPractices/Overview">Overview</a></li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/HumanPractices/Philo">Philosophical Analysis</a></li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/HumanPractices/Education">Educational Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/HumanPractices/Outreach">Public Outreach</a></li><br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Freiburg/Attributions">Attributions</a><br />
</li><br />
<li><a href="https://2012.igem.org/Main_Page"><img src="https://static.igem.org/mediawiki/igem.org/d/de/IGEM_basic_Logo_stylized.png" padding:0px; width="24px";/></a><br />
</li><br />
</ul> </div><br />
</p><br />
<br />
<br><br><br />
<br />
</body><br />
<br />
<br />
<!--navigation menu--><br />
<ul class="navbar"><br />
<br />
<br />
</ul><br />
<br />
</body><br />
<br />
</p><p><br /><br />
<br />
<head><br />
<style type="text/css"><br />
<br />
#col_left<br />
{<br />
float: left;<br />
width: 576px;<br />
padding: 30px 0px;<br />
margin:0;<br />
background-color: transparent;<br />
}<br />
<br />
#col_right<br />
{<br />
float: right;<br />
width: 242px;<br />
padding: 30px 28px 30px 15px;<br />
margin:0;<br />
background-color: transparent;<br />
}<br />
<br />
#col_center<br />
{<br />
float: center;<br />
width: 567;<br />
padding: 30px 100px;<br />
margin:0;<br />
background-color: transparent;<br />
}<br />
#col_nav<br />
{<br />
float: left;<br />
width: 200px;<br />
padding: 30px 15px 30px 50px;<br />
margin:0;<br />
background-color: transparent;<br />
}<br />
<br />
#block-content<br />
{<br />
padding-bottom: 15px;<br />
clear:both;<br />
}<br />
<br />
</style><br />
</head></div>Pablinitushttp://2012.igem.org/Team:Freiburg/HumanPractices/OverviewTeam:Freiburg/HumanPractices/Overview2012-10-26T12:01:39Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
<br />
= 0. Overview =<br />
----<br />
<br><br />
[[File:humansymbolT.png|center|180px|link=]]<br />
<br />
<br><br />
<p style= "font-size: 17px;color: #1c649f;margin:2em;font-family: Calibri">'''''"There is no such thing as philosophy-free science; there is only science whose philosophical baggage is taken on board without examination."'''''</p><br />
::Daniel Dennet<br><br><br><br />
<p><br />
<div align="justify">The human practices project of our team did not concentrate on inquiring the ethical, social and legal implications of the synthetic biology, but rather on analysing what the actual sources of these diverse problems are. We believe that this is a necessary step before ethical, social and legal deliberations of synthetic biology can be fruitful; that indeed, at first, we need to examine if these problems are actual problems at all, as oppossed to just taking them as facts, without further consideration. To this avail, we tried to leave aside all ‘small-talk-philosophy’ and futuristic ethical ‘just-so-stories’ in order to conduct a detailed and rigorous philosophical analysis of the epistemology of synthetic biology and the ontology of its products. For this, we combined state-of the-art-approaches of three fields of analytic philosophy (philosophy of technology, philosophy of biology and philosophy of language) to deliver consistent judgements. The results of this philosophical analysis reveal a number of epistemological deficits of the synthetic biology, but also offer the possibility of a consistent epistemological foundation of it.<br><br><br><br />
[[File:Threecircles.png|center|380px|link=]]<br />
<br><br />
In addition to the philosophical analysis we also tried to didactically inform people of different ages about the nascent field of synthetic biology, in order to facilitate the acceptance and to avoid prejudice among the broad public. We worked with small children on extracting DNA from onions, visited high schools, held lectures for undergraduates and opened our doors to visitors and school students. Moreover, we presented our project on a congress in Berlin and gave three interviews in order to reach a broader audience. In summary, we can divide our human practices project in three main categories:</div><br />
</p><br />
<br />
<br />
<br />
== [[Team:Freiburg/HumanPractices/Philo|1. Philosophical Analysis]]==<br />
<p><div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Philo#Essay|1.1 Philosophical essay]]</div></p><br />
<p><div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Philo#Chronicle|1.2 Chronicle of the philosophical evenings]]</div></p><br />
<br><br />
<br />
==[[Team:Freiburg/HumanPractices/Education|2. Educational Outreach]]==<br />
<br />
<p><br />
<br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#Children|2.1 Children – DNA-Extraction]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2 High school students]]</div></p><p><br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT; text-indent:60px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2.1 Presentation for high school students]]</div></p><p><br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT; text-indent:60px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2.2 Practical training in our lab]]</div></p><p><br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT; text-indent:60px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2.3 Synthetic biology and society]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#Seminar|2.3 Undergraduates – Compact seminar: ‘Theories of the Living’]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#OpenHouse|2.4 Open house presentation]]</div></p><br />
<br><br />
<br />
==[[Team:Freiburg/HumanPractices/Outreach|3. Public Outreach]]==<br />
<p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Outreach#Poster|3.1 ‘Biotechnologie2020+’ – Poster presentation]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Outreach#Interview|3.2 Interviews]]</div></p><br />
<br />
<br />
<br />
<br />
<br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/HumanPractices/OverviewTeam:Freiburg/HumanPractices/Overview2012-10-26T12:00:32Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
<br />
= 0. Overview =<br />
----<br />
<br><br />
[[File:humansymbolT.png|center|180px|link=]]<br />
<br />
<br><br />
<p style= "font-size: 17px;color: #1c649f;margin:2em;font-family: Calibri">'''''"There is no such thing as philosophy-free science; there is only science whose philosophical baggage is taken on board without examination"'''''</p><br />
::Daniel Dennet<br><br><br><br />
<p><br />
<div align="justify">The human practices project of our team did not concentrate on inquiring the ethical, social and legal implications of the synthetic biology, but rather on analysing what the actual sources of these diverse problems are. We believe that this is a necessary step before ethical, social and legal deliberations of synthetic biology can be fruitful; that indeed, at first, we need to examine if these problems are actual problems at all, as oppossed to just taking them as facts, without further consideration. To this avail, we tried to leave aside all ‘small-talk-philosophy’ and futuristic ethical ‘just-so-stories’ in order to conduct a detailed and rigorous philosophical analysis of the epistemology of synthetic biology and the ontology of its products. For this, we combined state-of the-art-approaches of three fields of analytic philosophy (philosophy of technology, philosophy of biology and philosophy of language) to deliver consistent judgements. The results of this philosophical analysis reveal a number of epistemological deficits of the synthetic biology, but also offer the possibility of a consistent epistemological foundation of it.<br><br><br><br />
[[File:Threecircles.png|center|380px|link=]]<br />
<br><br />
In addition to the philosophical analysis we also tried to didactically inform people of different ages about the nascent field of synthetic biology, in order to facilitate the acceptance and to avoid prejudice among the broad public. We worked with small children on extracting DNA from onions, visited high schools, held lectures for undergraduates and opened our doors to visitors and school students. Moreover, we presented our project on a congress in Berlin and gave three interviews in order to reach a broader audience. In summary, we can divide our human practices project in three main categories:</div><br />
</p><br />
<br />
<br />
<br />
== [[Team:Freiburg/HumanPractices/Philo|1. Philosophical Analysis]]==<br />
<p><div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Philo#Essay|1.1 Philosophical essay]]</div></p><br />
<p><div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Philo#Chronicle|1.2 Chronicle of the philosophical evenings]]</div></p><br />
<br><br />
<br />
==[[Team:Freiburg/HumanPractices/Education|2. Educational Outreach]]==<br />
<br />
<p><br />
<br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#Children|2.1 Children – DNA-Extraction]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2 High school students]]</div></p><p><br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT; text-indent:60px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2.1 Presentation for high school students]]</div></p><p><br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT; text-indent:60px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2.2 Practical training in our lab]]</div></p><p><br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT; text-indent:60px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2.3 Synthetic biology and society]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#Seminar|2.3 Undergraduates – Compact seminar: ‘Theories of the Living’]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#OpenHouse|2.4 Open house presentation]]</div></p><br />
<br><br />
<br />
==[[Team:Freiburg/HumanPractices/Outreach|3. Public Outreach]]==<br />
<p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Outreach#Poster|3.1 ‘Biotechnologie2020+’ – Poster presentation]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Outreach#Interview|3.2 Interviews]]</div></p><br />
<br />
<br />
<br />
<br />
<br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/HumanPractices/OverviewTeam:Freiburg/HumanPractices/Overview2012-10-26T12:00:12Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
<br />
= 0. Overview =<br />
----<br />
<br><br />
[[File:humansymbolT.png|center|180px|link=]]<br />
<br />
<br><br />
<p style= "font-size: 17px;color: #1c649f;margin:3em;font-family: Calibri">'''''"There is no such thing as philosophy-free science; there is only science whose philosophical baggage is taken on board without examination"'''''</p><br />
:::Daniel Dennet<br><br><br><br />
<p><br />
<div align="justify">The human practices project of our team did not concentrate on inquiring the ethical, social and legal implications of the synthetic biology, but rather on analysing what the actual sources of these diverse problems are. We believe that this is a necessary step before ethical, social and legal deliberations of synthetic biology can be fruitful; that indeed, at first, we need to examine if these problems are actual problems at all, as oppossed to just taking them as facts, without further consideration. To this avail, we tried to leave aside all ‘small-talk-philosophy’ and futuristic ethical ‘just-so-stories’ in order to conduct a detailed and rigorous philosophical analysis of the epistemology of synthetic biology and the ontology of its products. For this, we combined state-of the-art-approaches of three fields of analytic philosophy (philosophy of technology, philosophy of biology and philosophy of language) to deliver consistent judgements. The results of this philosophical analysis reveal a number of epistemological deficits of the synthetic biology, but also offer the possibility of a consistent epistemological foundation of it.<br><br><br><br />
[[File:Threecircles.png|center|380px|link=]]<br />
<br><br />
In addition to the philosophical analysis we also tried to didactically inform people of different ages about the nascent field of synthetic biology, in order to facilitate the acceptance and to avoid prejudice among the broad public. We worked with small children on extracting DNA from onions, visited high schools, held lectures for undergraduates and opened our doors to visitors and school students. Moreover, we presented our project on a congress in Berlin and gave three interviews in order to reach a broader audience. In summary, we can divide our human practices project in three main categories:</div><br />
</p><br />
<br />
<br />
<br />
== [[Team:Freiburg/HumanPractices/Philo|1. Philosophical Analysis]]==<br />
<p><div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Philo#Essay|1.1 Philosophical essay]]</div></p><br />
<p><div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Philo#Chronicle|1.2 Chronicle of the philosophical evenings]]</div></p><br />
<br><br />
<br />
==[[Team:Freiburg/HumanPractices/Education|2. Educational Outreach]]==<br />
<br />
<p><br />
<br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#Children|2.1 Children – DNA-Extraction]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2 High school students]]</div></p><p><br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT; text-indent:60px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2.1 Presentation for high school students]]</div></p><p><br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT; text-indent:60px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2.2 Practical training in our lab]]</div></p><p><br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT; text-indent:60px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2.3 Synthetic biology and society]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#Seminar|2.3 Undergraduates – Compact seminar: ‘Theories of the Living’]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#OpenHouse|2.4 Open house presentation]]</div></p><br />
<br><br />
<br />
==[[Team:Freiburg/HumanPractices/Outreach|3. Public Outreach]]==<br />
<p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Outreach#Poster|3.1 ‘Biotechnologie2020+’ – Poster presentation]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Outreach#Interview|3.2 Interviews]]</div></p><br />
<br />
<br />
<br />
<br />
<br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/HumanPractices/OverviewTeam:Freiburg/HumanPractices/Overview2012-10-26T11:59:50Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<br />
__NOTOC__<br />
<br />
= 0. Overview =<br />
----<br />
<br><br />
[[File:humansymbolT.png|center|180px|link=]]<br />
<br />
<br><br />
<p style= "font-size: 17px;color: #1c649f;margin:3em;font-family: Calibri">'''''"There is no such thing as philosophy-free science; there is only science whose philosophical baggage is taken on board without examination"'''''</p><br />
:::Daniel Dennet<br />
<p><br />
<div align="justify">The human practices project of our team did not concentrate on inquiring the ethical, social and legal implications of the synthetic biology, but rather on analysing what the actual sources of these diverse problems are. We believe that this is a necessary step before ethical, social and legal deliberations of synthetic biology can be fruitful; that indeed, at first, we need to examine if these problems are actual problems at all, as oppossed to just taking them as facts, without further consideration. To this avail, we tried to leave aside all ‘small-talk-philosophy’ and futuristic ethical ‘just-so-stories’ in order to conduct a detailed and rigorous philosophical analysis of the epistemology of synthetic biology and the ontology of its products. For this, we combined state-of the-art-approaches of three fields of analytic philosophy (philosophy of technology, philosophy of biology and philosophy of language) to deliver consistent judgements. The results of this philosophical analysis reveal a number of epistemological deficits of the synthetic biology, but also offer the possibility of a consistent epistemological foundation of it.<br><br><br><br />
[[File:Threecircles.png|center|380px|link=]]<br />
<br><br />
In addition to the philosophical analysis we also tried to didactically inform people of different ages about the nascent field of synthetic biology, in order to facilitate the acceptance and to avoid prejudice among the broad public. We worked with small children on extracting DNA from onions, visited high schools, held lectures for undergraduates and opened our doors to visitors and school students. Moreover, we presented our project on a congress in Berlin and gave three interviews in order to reach a broader audience. In summary, we can divide our human practices project in three main categories:</div><br />
</p><br />
<br />
<br />
<br />
== [[Team:Freiburg/HumanPractices/Philo|1. Philosophical Analysis]]==<br />
<p><div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Philo#Essay|1.1 Philosophical essay]]</div></p><br />
<p><div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Philo#Chronicle|1.2 Chronicle of the philosophical evenings]]</div></p><br />
<br><br />
<br />
==[[Team:Freiburg/HumanPractices/Education|2. Educational Outreach]]==<br />
<br />
<p><br />
<br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#Children|2.1 Children – DNA-Extraction]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2 High school students]]</div></p><p><br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT; text-indent:60px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2.1 Presentation for high school students]]</div></p><p><br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT; text-indent:60px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2.2 Practical training in our lab]]</div></p><p><br />
<div style="color: #1C649F; font-size: 14px;font-family: Gill Sans MT; text-indent:60px;">[[Team:Freiburg/HumanPractices/Education#HighSchool|2.2.3 Synthetic biology and society]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#Seminar|2.3 Undergraduates – Compact seminar: ‘Theories of the Living’]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Education#OpenHouse|2.4 Open house presentation]]</div></p><br />
<br><br />
<br />
==[[Team:Freiburg/HumanPractices/Outreach|3. Public Outreach]]==<br />
<p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Outreach#Poster|3.1 ‘Biotechnologie2020+’ – Poster presentation]]</div></p><p><br />
<div style="color: #1C649F; font-size: 16px;font-family: Gill Sans MT; text-indent:30px;">[[Team:Freiburg/HumanPractices/Outreach#Interview|3.2 Interviews]]</div></p><br />
<br />
<br />
<br />
<br />
<br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-26T11:23:40Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
<div font-size:15xp>'''Strategy 1'''</div><br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
==<div id="GGC">Protocol</div>==<br />
----<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2'''<br><br><br />
The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
:In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
:Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-26T11:23:16Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
<div font-size:15xp>'''Strategy 1'''</div><br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
==<div id="GGC">Protocol</div>==<br />
----<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2'''<br><br />
The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
:In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
:Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/TalTeam:Freiburg/Project/Tal2012-10-25T10:58:25Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Using the Toolkit =<br />
----<br />
<br><br />
<div align="justify">Here, we give you a manual on how to use our toolkit to design TAL proteins. We recommend reading through all of the manual prior to using the toolkit. Also we included a short introductional video on how to use the toolkit.<br />
<br />
<html><br />
<iframe align="center" width="500" height="350" style="margin-left:100px; margin-top:40px ;margin-bottom:50px;"src="http://player.vimeo.com/video/51366791" frameborder="0" webkitAllowFullScreen mozallowfullscreen allowFullScreen></iframe><br />
</html><br />
<br />
= Step 1. Choosing effector and target sequence =<br />
----<br />
<br>First, you need to think about your experimental setup. When working with TAL proteins it's pretty clear you want to target a DNA sequence. To choose your sequence, you need to know some of the operational details of TAL proteins in order to pick it the right way. <br />
<br />
<br />
<b>1. Every TAL binding site starts and ends with a thymine</b><br />
<br />
These thymine binding modules are already inserted in our expression plasmids. So the protein won't bind to other sequences than those which start with a T and end with a T.<br />
<br />
<br />
<b>2. Your sequence must be twelve base pair long</b><br />
<br />
Our toolbox is optimized for sequences of twelve plus two (the thymine at upstream and downstream positions). This lenght guarantees a high specifity and a library size that's good to handle at the same time.<br />
<br />
<br />
You can check out the following online softwares for perfect TAL-TF or TALEN binding sites:<br><br><br />
https://boglab.plp.iastate.edu/node/add/talen (for TALENs)<br><br />
https://boglab.plp.iastate.edu/node/add/single-tale (for TAL-TFs)<br />
<br />
<br><br />
<br />
<br><br />
<br />
= Step 2. Building a TAL =<br />
----<br />
<br>Building your TAL starts with your selected sequence. In this manual, we use a fictive sequence that you can substitute with your own. <p>Our sequence will be as follows:</p><br />
<br />
<br />
[[Image:sequence1.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Because the two thymines are already in the cloning vector, they are of no interest for our TAL protein:<br />
<br />
[[Image:sequence2.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br>To build this sequence from our toolkit we need to split it up in pairs of two:<br />
<br />
<br />
[[Image:sequence3.png|350px|center|no frame|link=]]<br />
<br />
<br>Now we need to give our pairs position numbers inside the TAL protein:<br />
<br />
<br />
[[Image:sequence4.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br />
<br>Now we can start taking the parts out of the toolkit. A short look at the toolkit shows you that for every possible pair of bases, for example AA, we have 6 places. Every place stands for one of the six possible positions of the pair AA inside the TAL protein.<br />
<br />
<br />
[[Image:toolkit3.png|300px|center|no frame|link=]]<br />
<br />
<br />
<br>All you have to do now is pick the six direpeats consistent with the six pairs of your sequence. In our case, we would take the the first one of AA because the first pair of bases in our sequence is AA. Then we take the second one of TG the third of AG and so forth. The idea behind this is that every direpeat knows through his downstream and upstream part at which position of the final TAL protein it ought to be. You can find the exact mechanisms behind this in the [[Team:Freiburg/Project/Overview|'GATE Assembly Kit']] part of our project section. <br><br><br />
<br />
[[Image:sequence5.png|500px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
For lazy iGEM students, we have written a simple program. So you just have to type in your target DNA sequence and we give you a list of parts that you need to pipet into your Golden Gate reaction mix:<br><br><br />
<br />
<br />
<html><br />
<div align="center"><br />
<iframe src="http://omnibus.uni-freiburg.de/~lb125/index.html"; width=80%; frameborder="0"; scrolling="no"><br />
</iframe><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br><br />
<br />
= Step 3. Adding a Function =<br />
----<br />
<br><br />
Now that you have your TAL BioBricks, you are almost done. But targeting a sequence without doing anything is not really helpful, so you need a fusion protein that does something to your DNA. There are a couple of things you could do with your target sequence, and normally you have thought of this before you chose your sequence. With our toolkit you get a transcription factor to turn on or enhance the trancription of a gene and a restriction enzyme to make cuts wherever you want. Every one of these factors is already placed inside the final TAL vector and designed to fit the 3'-end of your TAL BioBricks. Conveniently, you just choose one and put it in your reaction tube along with the other BioBricks.<br />
<br />
<br />
<br />
[[Image:TALfunction.png|600px|center|no frame|link=]]<br />
<br />
<br />
<br />
With the six TAL BioBricks and the fusion enzyme in your reaction tube you now only need the type two restriction enzyme BsmB1 and a T7 Ligase to put all the parts together.<br><br><br />
<br />
[[Image:protocolggc.png|300px|left|no frame|link=]]<br />
<br />
<br><br />
<br />
[[Image:thermocycler.png|200px|center|no frame|link=]]<br />
<br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
= Step 4. Transformation and Use =<br />
----<br />
<br><br />
Transform 5 μl of the GATE assembly product into 50 μl of transformation competent bacteria.<br> <br />
<br>'''Important note:''' Your cells need to be sensitive to the ccdB kill cassette in our TAL expression vectors! Otherwise also bacteria that have taken up plasmids without the six direpeats will form false positive colonies. We used the DH10B E.coli strain.<br><br />
In case you want to express your TALE in bacteria, you need to induce the promoter of our prokaryotic expression plasmid with IPTG. <br>For use in a eukaryotic system, such as HEK 239 cells, perform a midiprep and directly transfect the eukaryotic TAL expression plasmid (or its derivatives pTAL-TF, pTALEN etc.) according to your transfection protocol. <br />
<!--- The Mission, Experiments ---><br />
<br><br><br><br><br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/IntroTeam:Freiburg/Project/Intro2012-10-25T10:57:37Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
<html><br />
<head><br />
<!-- Timeline script adapted from http://www.csslab.cl/2011/08/18/jquery-timelinr/. Thanks!! --><br />
<br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/><br />
<br />
<link rel="stylesheet" href="<br />
http://omnibus.uni-freiburg.de/~lb125/css/style.css" type="text/css" media="screen" /><br />
<br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js" type="text/javascript"></script><br />
<br />
<script src="http://omnibus.uni-freiburg.de/~lb125/js/jquery.timelinr-0.9.51.js" type="text/javascript"></script><br />
<br />
<script type="text/javascript"> <br />
<br />
$(function(){<br />
$().timelinr({<br />
orientation: 'horizontal',<br />
containerDiv: '#timeline',<br />
datesDiv: '#dates',<br />
datesSelectedClass: 'selected',<br />
datesSpeed: 'normal',<br />
issuesDiv : '#issues',<br />
issuesSelectedClass: 'selected',<br />
issuesSpeed: 'fast',<br />
issuesTransparency: 0.2,<br />
issuesTransparencySpeed: 500,<br />
prevButton: '#prev',<br />
nextButton: '#next',<br />
arrowKeys: 'false',<br />
startAt: 1,<br />
autoPlay: 'false',<br />
autoPlayDirection: 'forward',<br />
autoPlayPause: 2000<br />
});<br />
});<br />
<br />
</script><br />
<br />
<!-- End timeline --><br />
<br />
<br />
<style type="text/css"><br />
#ip_quote<br />
{<br />
margin-top:0px;<br />
margin-bottom:0px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
width:75%;<br />
color:#C22227;<br />
font-size:140%;<br />
line-height:140%;<br />
text-align:justify;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
__NOTOC__<br />
= Introduction =<br />
----<br />
<html><br />
<!-- BEGIN TIMELINE WHITEBOX HERE --><br />
<div name="talhistory"><br />
<div id="timeline"><br />
<br />
<ul id="dates"><br />
<li><a href="#" class="dateobject">2009</a></li><br />
<li><a href="#" class="dateobject">2010</a></li><br />
<li><a href="#" class="dateobject">02/11</a></li><br />
<li><a href="#" class="dateobject">10/11</a></li><br />
<li><a href="#" class="dateobject">12/11</a></li><br />
<li><a href="#" class="dateobject">02/12</a></li><br />
<li><a href="#" class="dateobject">04/12</a></li><br />
<li><a href="#" class="dateobject">iGEM'12</a></li><br />
</ul><br />
<br />
<br />
<div id="grad_left"></div><br />
<br />
<div id="grad_right"></div><br />
<br />
<a href="#" id="next">+</a><br />
<br />
<a href="#" id="prev">-</a><br />
<br />
<br />
<ul id="issues"><br />
<br />
<br />
<br />
<li id="#2009"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_09.png" width="256" height="170" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2009</div><br />
<br />
<p>Two research groups publish the TAL Effector codes in the same issue of Science: Amino acid 12 and 13 of every DNA binding module specifically binds to one nucleotide</p><br />
<br />
</li><br />
<br />
<br />
<li id="#2010"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_10.png" width="256" height="200" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2010</div><br />
<br />
<p>Voytas Lab develops TALENs. These fusion proteins of FokI and a TAL protein cut as dimers and allow researchers to cut virtually anywhere in the genome. Since double strand breaks increase efficiency of homologous recombination, TALENS are a powerful tool for genetic engineering and gene therapy</p><br />
<br />
</li><br />
<br />
<li id="#02/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_11.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2011</div><br />
<br />
<p>Based on an exclusive licensing agreement with the University of Minnasota, Cellectis bioresearch launches its TAL effector product line. One TALEN pair currently costs 5000 Euro (6454 US$, 26.10.12).</p><br />
<br />
</li><br />
<br />
<br />
<li id="#10/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2011</div><br />
<br />
<p>The iGEM team from Harvard University employed fancy and expensive techniques to find up to 15 new zinc fingers (each of which binds to 3 bp). There has to be a better way…</p><br />
<br />
</li><br />
<br />
<br />
<li id="#12/2011"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/12_11.png" width="210" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">December 2011</div><br />
<br />
<p>Nature chooses TALENs as the 2011 Method of the year.</p><br />
<br />
</li><br />
<br />
<li id="#02/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/02_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">February 2012</div><br />
<br />
<p>The first two crystal structures of TALE modules bound to DNA published in the same issue of Science. The protein literally wraps itself around the DNA double helix and forms these beautiful symmetric shapes.</p><br />
<br />
</li><br />
<br />
<br />
<br />
<li id="#04/2012"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/04_12.png" width="256" height="256" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">April 2012</div><br />
<br />
<p>Joung lab publishes FLASH assembly in Nature Biotechnology. This first automatable TAL assembly platform facilitates assembly of 96 TAL DNA fragments in less than a day using a pipeting robot.</p><br />
<br />
</li><br />
<br />
<br />
<li id="freiGEM'12"><br />
<br />
<img src="http://omnibus.uni-freiburg.de/~lb125/10_12.png" width="200" height="130" /><br />
<br />
<div class="issuedate" style="font-weight:bold; font-size:1.3em;">October 2012</div><br />
<br />
<p>The Freiburg iGEM team makes TALE technology available to everyone by introducing the GATE assembly kit. For TALEs targeting 14 bp, this platform is currently the fastest, cheapest and easiest method in the world.</p><br />
<br />
</li><br />
<br />
</ul><br />
<br />
<br />
</div><br />
</div><br />
<br />
<!-- END TIMELINE WHITEBOX HERE --><br />
</html><br />
<br />
<p><div align="justify">Originally, TAL proteins are virulence factors of the plant-pathogenic ''Xanthomonas spp.'' that are injected into plant cells via a type III secretion system in order to modulate transcription<sup>1</sup>. For this purpose, their c-terminal end contains a nuclear localisation signal (NLS) and an acidic activation domain. The central part of the TAL protein contains a number of almost similar repeats that mediate specific binding to target loci in the genome.<br />
In 2009, two groups have simultaneously pointed out that each of these repeats specifically binds to one base of the target DNA via two amino acids (aa 12 and 13), named the repeat variable diresidues (RVD)<sup>2</sup>. Moreover, it has been shown that DNA binding of these proteins is highly modular, i.e. the number bases or sequence of the target DNA can be changed by adjusting the number or order of the repeats in the TAL protein, respectively.<br />
It is still unclear, how the sequence of DNA binding modules and TALE activity correlate. The minimal condition for TALE activity is a thymine at the 5’ end of the target sequence. Further target sequence requirements that allow for one TALEN pair binding site every 35 bp (published by the Voytas lab in 2011<sup>3</sup>) have recently been questioned by Reyon et al.<sup>4</sup> In summary, it is very likely that you can find a potential TALE binding site in any sequence you want to target.<br />
This, obviously, is very promising for biotechnological and clinical applications. Thus, two major classes of TAL Effectors have been created by replacing the natural acidic activation domain either by other transcription factors (TALE-TFs)<sup>5</sup> or by – in most cases – a monomer of the non-sequence specific nuclease FokI, resulting in TAL Effector Nucleases (TALENS)<sup>6</sup> A pair of TALENs can be designed to bind adjacent DNA sequences in a way that the two monomers are able to form a functional FokI dimer that produces a double strand break (DBS) within the spacer between the TAL-Effectors (see figure 13). Subsequently, the cell repairs the DBS by either non-homologous end joining (NHEJ, which results in indels at the DSB-site) or homologous recombination of exogenously added genetic material.<br />
TALENs and TALE-TF have successfully been applied for manipulation of a series of genes in different organisms such as yeast<sup>7</sup>, tobacco<sup>3</sup>, fruitflies<sup>6,8</sup>,worms<sup>6,9</sup>, zebrafish<sup>10</sup>, rats<sup>11</sup> and various human cell types, including human stem cells<sup>12</sup>.<br><br><br />
<br />
<br />
<br><br />
<div style="color: #1C649F; font-size: 20px;font-family: Gill Sans MT">References</div><br><br />
1. Scholze, H. & Boch, J. TAL effectors are remote controls for gene activation. ''Current Opinion in Microbiology'' 14, 47–53 (2011).<br><br />
2. Moscou, M. J. & Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effectors. ''Science'' 326, 1501–1501 (2009).<br><br />
3. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucleic Acids Res'' 39, e82 (2011).<br><br />
4. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nature Biotechnology'' 30, 460–465 (2012).<br><br />
5. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nature biotechnology'' 29, 149–153 (2011).<br><br />
6. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nature Biotechnology'' 29, 143–148 (2010).<br><br />
7. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br />
8. Liu, J. et al. Efficient and Specific Modifications of the Drosophila Genome by Means of an Easy TALEN Strategy. ''Journal of Genetics and Genomics'' 39, 209–215 (2012).<br><br />
9. Wood, A. J. et al. Targeted Genome Editing Across Species Using ZFNs and TALENs. ''Science'' 333, 307–307 (2011).<br><br />
10. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol'' 29, 697–698 (2011).<br><br />
11. Tesson, L. et al. Knockout rats generated by embryo microinjection of TALENs. ''Nature Biotechnology'' 29, 695–696 (2011).<br><br />
12. Hockemeyer, D. et al. Genetic engineering of human pluripotent cells using TALE nucleases. ''Nature Biotechnology'' 29, 731–734 (2011)<br />
<br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/OverviewTeam:Freiburg/Project/Overview2012-10-25T10:56:26Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= The GATE Assembly Kit =<br />
----<br />
<br><br />
<div align="justify">TALEs make sequence-specific genome modification much easier that before and therefore attracts great interest in the synbio research community and beyond. Interestingly, many of the researchers who hold the patents on TALEs also released open source toolkits for TALE assembly for academic research. However, most strategies of TALE gene assembly published thus far rely on a hierarchical procedure, that is very time consuming, laborious and not automatable.<br />
Therefore we herein describe the Golden Gate cloning-based TAL Effector (GATE) Assembly platform, which enables literally everyone to produce low-cost, tailored TALEs within a few minutes of labwork and basic lab equipment. Moreover, we have automated this strategy and produced different TAL Effector Transcription Factors with 96 % success rate faster than any other method published before.<br />
<br><br />
<br />
<br />
== Review of existing TALE construction methods ==<br />
<br><br />
<div align="justify"><br />
Although TALE assembly is considerably easier than e.g. screening for novel zinc fingers, the highly repetitive structure of the TALE gene implies some challenges, because conventional PCR or homologous recombination-based gene assembly strategies cannot be applied.<br />
To our knowledge, the numerous approaches TAL-Effector gene assembly, published so far, fall under the following Three categories:<br />
<br />
<br />
<br />
1. Few groups have applied methods called unit assembly<sup>1</sup> or Restriction Enzyme And Ligation (REAL)<sup>2</sup>. In the first step both strategies perform conventional restriction enzyme digestion in order to assemble gene fragments of single repeats. The pairs of repeat gene fragments are subsequently assembled to form tetramers, and this highly hierarchical assembly strategy is continued until the desired number of repeats is assembled. These platforms obviously involve multiple laborious and time consuming rounds of digestion, ligation and isolation of the right ligation products. The recently published fast ligation-based automatable solid-phase high-throughput (FLASH) system circumvents major challenges of REAL by attaching the first repeat to streptavidin-coated magnetic beads and, successively, adding further repeats or oligorepeats from a 376-plasmid library. Although Reyon et al. claim that FLASH can also be performed manually, this probably does not represent the most convenient and low-cost protocol for iGEM students.<br />
<br />
<br />
2. We call the second category of TALE production methods the synthesis optimization approach. The major challenge of TAL synthesis is the highly repetitive amino acid sequence of the DNA binding part. Since synthetic genes are typically produced from overlapping synthesized oligos, overlaps of different pairs of overlapping oligos need to be distinct. The synthesis optimization approach employs a sophisticated computer program that optimizes codon usage in order to reduce repetitiveness of the TAL gene and calculates optimal oligos for synthesis<sup>3,4</sup>. Although this approach might be the method of the future, it is currently too expensive for iGEM teams. <br />
<br />
<br />
3. The third category of TALE assembly protocols applies Golden Gate Cloning (GGC)<sup>5,6,7,8,9</sup> (for details on GGC, see the Golden Gate standard page). In all GGC-based TALE repeat assembly strategies, level 1 modules (i.e. single repeat gene fragments) are flanked by type IIs restriction sites adjacent to their first or last 4 nucleotides, respectively, that produce sticky ends after digestion with the type IIs restriction enzyme. Since each level 1 module codes for the same amino acid sequence (despite of the RVDs), the codon usage must be changed at these 4 external nucleotides for producing unique sticky ends that assemble in the predefined order after digestion. Consequently, the 4 bp overlaps of a level 1 module specify its future position within the TALE gene.<br />
So, in order to be able to target any sequence of DNA, a method that is using GGC requires N x M modules. N signifies the number of level 1 module positions (i.e. number of modules that the TALE should contain after GGC) and M signifies the number of different repeats that the user should be able to put into each of the N positions (in most kits M equals 4, one repeat for each DNA base).<br />
Unfortunately, using GGC, only up to 10 modules <sup>5</sup> can be assembled with high accuracy. So in the GGC-based protocols, level 1 modules get assembled to form level 2 modules (oligorepeats). These level 2 modules need to be amplified and isolated before a second GGC reaction assembles them to form the complete repeat array. The bottleneck of the GGC-based methods is the need for amplification and isolation of level 2 modules, which costs a lot of time, requires some extra knowledge, additional enzymes and lab equipment (we actually tried one of the GGC-based open source kits, but, even after 2.5 weeks, were not able to assemble the whole TALE).<br><br><br />
<br />
== GATE Assembly Kit ==<br />
----<br />
<br><br />
<div align="justify">Right from the beginning, we were very much intrigued by the efficiency of Golden Gate Cloning and hypothesized, that instant TAL assembly would be possible if we overcame the need for a second (or even third) round of GGC. Since we were sure we were not able to improve GGC reaction conditions so much that we could actually assemble all repeats at once, we came up with another solution: Why not use direpeats instead of single repeats as level 1 modules? This would cut the number of level 1 modules half and allow us to perform TAL assembly in one single reaction. Unfortunately, our idea would not only cut half N but would also quadruple M, and thus would double the toolkit size.<br />
<br><br />
<br />
[[Image:Synthese_3.png|200px|center|no frame|link=]]<br />
<br />
<br><br />
So we needed to further reduce N down to 6 to obtain a reasonable toolkit size of 96 level 1 modules. We actually liked the idea that our kit would perfectly fit on a 96 well plate.<br />
<br><br><br />
<br />
[[Image:Toolkit.png|700px|center|no frame|link=]]<br />
<br />
<br><br />
Next, we looked into the literature to check, if TALEs that recognize 14 bp (instead of around 18 bp) are actually functional. We were very fortunate to see that efficiency of TAL transcription factors (TAL-TFs) <sup>10 </sup> and TAL effector nucleases (TALENs)<sup>11 </sup> remains constant between for target sequences between 13 and 20 bp. Moreover, Zhang et al. published splendid results with 14 bp-binding TAL-TFs in a human cell line<sup>7</sup>. <br />
Since we wanted our TALEs to function in both bacteria and eukaryotic systems, while published TAL repeats were always designed for one particular organism, we decided to design the direpeat nucleotide sequences from scratch: We used the amino acid sequence of the hex3 gene of Xanthomonas oryzae to find out the amino acid sequences for the 16 direpeats. Next, we reverse-tanslated the sequences into DNA, codon optimized them for E.coli and human cells and reduced homologies between and within gene fragments (only the extention PCR binding sites were the same for every direpeat gene).<br />
After receiving the sequences that were synthesized as G-blocks by IDT, we performed 6 extention PCRs on every sequence to add 4 bp overlaps, BsmBI restriction sites and iGEM prefix and suffix to the parts. The 4 bp overlaps would later determine the position of the respective direpeat in the repeat array of the TALE.<br />
<br><br><br />
<br />
[[Image:Biobrickfreigem.png|500px|center|no frame|link=]]<br />
<br><br><br><br><br />
<br />
[[Image:Extension3.png|600px|center|no frame|link=]]<br />
<br />
<br><br />
One of the advantages of GGC is that you can insert complete plasmids containing the parts you want to assemble. So we decided to clone all 96 parts into the standard iGEM vector pSB1C3. We hypothesized that the BsmBI restriction site in the chloramphenicol gene would decrease GGC efficiency, so we performed a mutagenesis PCR to introduce the silent mutation (G434C) prior to cloning the 96 PCR products into it. When doing so many cloning experiments at a time, error rate needs to be minimal, so at first, we spent weeks optimizing every single step from the G-block to the Golden Gate standard compatible BioBrick (see [[Team:Freiburg/Project/Golden#GGC|protocol section]]). In the end, we are very happy that we have a full GATE assembly kit with [[Team:Freiburg/Parts|96 unique direpeats]] and 100% accurate sequencing results.<br />
Our first attempts to use the GATE assembly kit were actually very discouraging - no colonies were found on the agar plates after transforming the GGC product into DH10B cells for more than one week - at least, we knew that our ccdb kill cassette was working well (details about the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">expression vector</a></html>). After systematically testing all kinds of buffers and reaction additives, the results where quite overwhelming. We were even able to dramatically reduce GGC reaction time down to 2.5 hours - which is probably the fastest way anyone has ever built a custom tal effector.<br />
<br />
<br><br />
<br />
== References ==<br />
<br><br />
1. Huang, P. et al. Heritable gene targeting in zebrafish using customized TALENs. ''Nat Biotechnol'' 29, 699–700 (2011).<br><br />
2. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol 2''9, 697–698 (2011).<br><br />
3. Hoover, D. M. & Lubkowski, J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. ''Nucl Acids Res'' 30, e43–e43 (2002).<br><br />
4. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nat Biotechnol'' 29, 143–148 (2010).<br><br />
5. Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. Assembly of Custom TALE-Type DNA Binding Domains by Modular Cloning. ''Nucl Acids Res'' 39, 5790–5799 (2011).<br><br />
6. Weber, E., Gruetzner, R., Werner, S., Engler, C. & Marillonnet, S. Assembly of designer TAL effectors by golden gate cloning. ''PloS one'' 6, e19722 (2011).<br><br />
7. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nat Biotechnol'' 29, 149–153 (2011).<br><br />
8. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucl Acids Res'' 39, e82 (2011).<br><br />
9. Li, T. et al. Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes. ''Nucl Acids Res'' 39, 6315–6325 (2011).<br><br />
10. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br><br />
11. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nat Biotechnol'' 30, 460–465 (2012).<br><br />
<br />
<br />
<br />
<br />
<br><br><br><br><br />
[[#top|Back to top]]<br />
<!--- The Mission, Experiments ---></div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/OverviewTeam:Freiburg/Project/Overview2012-10-25T10:55:12Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= The GATE Assembly Kit =<br />
----<br />
<br><br />
<div align="justify">TALEs make sequence-specific genome modification much easier that before and therefore attracts great interest in the synbio research community and beyond. Interestingly, many of the researchers who hold the patents on TALEs also released open source toolkits for TALE assembly for academic research. However, most strategies of TALE gene assembly published thus far rely on a hierarchical procedure, that is very time consuming, laborious and not automatable.<br />
Therefore we herein describe the Golden Gate cloning-based TAL Effector (GATE) Assembly platform, which enables literally everyone to produce low-cost, tailored TALEs within a few minutes of labwork and basic lab equipment. Moreover, we have automated this strategy and produced different TAL Effector Transcription Factors with 96 % success rate faster than any other method published before.<br />
<br><br />
<br />
<br />
== Review of existing TALE construction methods ==<br />
<br><br />
<div align="justify"><br />
Although TALE assembly is considerably easier than e.g. screening for novel zinc fingers, the highly repetitive structure of the TALE gene implies some challenges, because conventional PCR or homologous recombination-based gene assembly strategies cannot be applied.<br />
To our knowledge, the numerous approaches TAL-Effector gene assembly, published so far, fall under the following Three categories:<br />
<br />
<br />
<br />
1. Few groups have applied methods called unit assembly<sup>1</sup> or Restriction Enzyme And Ligation (REAL)<sup>2</sup>. In the first step both strategies perform conventional restriction enzyme digestion in order to assemble gene fragments of single repeats. The pairs of repeat gene fragments are subsequently assembled to form tetramers, and this highly hierarchical assembly strategy is continued until the desired number of repeats is assembled. These platforms obviously involve multiple laborious and time consuming rounds of digestion, ligation and isolation of the right ligation products. The recently published fast ligation-based automatable solid-phase high-throughput (FLASH) system circumvents major challenges of REAL by attaching the first repeat to streptavidin-coated magnetic beads and, successively, adding further repeats or oligorepeats from a 376-plasmid library. Although Reyon et al. claim that FLASH can also be performed manually, this probably does not represent the most convenient and low-cost protocol for iGEM students.<br />
<br />
<br />
2. We call the second category of TALE production methods the synthesis optimization approach. The major challenge of TAL synthesis is the highly repetitive amino acid sequence of the DNA binding part. Since synthetic genes are typically produced from overlapping synthesized oligos, overlaps of different pairs of overlapping oligos need to be distinct. The synthesis optimization approach employs a sophisticated computer program that optimizes codon usage in order to reduce repetitiveness of the TAL gene and calculates optimal oligos for synthesis<sup>3,4</sup>. Although this approach might be the method of the future, it is currently too expensive for iGEM teams. <br />
<br />
<br />
3. The third category of TALE assembly protocols applies Golden Gate Cloning (GGC)<sup>5,6,7,8,9</sup> (for details on GGC, see the Golden Gate standard page). In all GGC-based TALE repeat assembly strategies, level 1 modules (i.e. single repeat gene fragments) are flanked by type IIs restriction sites adjacent to their first or last 4 nucleotides, respectively, that produce sticky ends after digestion with the type IIs restriction enzyme. Since each level 1 module codes for the same amino acid sequence (despite of the RVDs), the codon usage must be changed at these 4 external nucleotides for producing unique sticky ends that assemble in the predefined order after digestion. Consequently, the 4 bp overlaps of a level 1 module specify its future position within the TALE gene.<br />
So, in order to be able to target any sequence of DNA, a method that is using GGC requires N x M modules. N signifies the number of level 1 module positions (i.e. number of modules that the TALE should contain after GGC) and M signifies the number of different repeats that the user should be able to put into each of the N positions (in most kits M equals 4, one repeat for each DNA base).<br />
Unfortunately, using GGC, only up to 10 modules <sup>5</sup> can be assembled with high accuracy. So in the GGC-based protocols, level 1 modules get assembled to form level 2 modules (oligorepeats). These level 2 modules need to be amplified and isolated before a second GGC reaction assembles them to form the complete repeat array. The bottleneck of the GGC-based methods is the need for amplification and isolation of level 2 modules, which costs a lot of time, requires some extra knowledge, additional enzymes and lab equipment (we actually tried one of the GGC-based open source kits, but, even after 2.5 weeks, were not able to assemble the whole TALE).<br><br><br />
<br />
== GATE Assembly Kit ==<br />
----<br />
<br><br />
<div align="justify">Right from the beginning, we were very much intrigued by the efficiency of Golden Gate Cloning and hypothesized, that instant TAL assembly would be possible if we overcame the need for a second (or even third) round of GGC. Since we were sure we were not able to improve GGC reaction conditions so much that we could actually assemble all repeats at once, we came up with another solution: Why not use direpeats instead of single repeats as level 1 modules? This would cut the number of level 1 modules half and allow us to perform TAL assembly in one single reaction. Unfortunately, our idea would not only cut half N but would also quadruple M, and thus would double the toolkit size.<br />
<br><br />
<br />
[[Image:Synthese_3.png|200px|center|no frame|link=]]<br />
<br />
<br><br />
So we needed to further reduce N down to 6 to obtain a reasonable toolkit size of 96 level 1 modules. We actually liked the idea that our kit would perfectly fit on a 96 well plate.<br />
<br><br><br />
<br />
[[Image:Toolkit.png|700px|center|no frame|link=]]<br />
<br />
<br><br />
Next, we looked into the literature to check, if TALEs that recognize 14 bp (instead of around 18 bp) are actually functional. We were very fortunate to see that efficiency of TAL transcription factors (TAL-TFs) <sup>10 </sup> and TAL effector nucleases (TALENs)<sup>11 </sup> remains constant between for target sequences between 13 and 20 bp. Moreover, Zhang et al. published splendid results with 14 bp-binding TAL-TFs in a human cell line<sup>7</sup>. <br />
Since we wanted our TALEs to function in both bacteria and eukaryotic systems, while published TAL repeats were always designed for one particular organism, we decided to design the direpeat nucleotide sequences from scratch: We used the amino acid sequence of the hex3 gene of Xanthomonas oryzae to find out the amino acid sequences for the 16 direpeats. Next, we reverse-tanslated the sequences into DNA, codon optimized them for E.coli and human cells and reduced homologies between and within gene fragments (only the extention PCR binding sites were the same for every direpeat gene).<br />
After receiving the sequences that were synthesized as G-blocks by IDT, we performed 6 extention PCRs on every sequence to add 4 bp overlaps, BsmBI restriction sites and iGEM prefix and suffix to the parts. The 4 bp overlaps would later determine the position of the respective direpeat in the repeat array of the TALE.<br />
<br><br><br />
<br />
[[Image:Biobrickfreigem.png|500px|center|no frame|link=]]<br />
<br><br><br><br><br />
<br />
[[Image:Extension3.png|600px|center|no frame|link=]]<br />
<br />
<br><br />
One of the advantages of GGC is that you can insert complete plasmids containing the parts you want to assemble. So we decided to clone all 96 parts into the standard iGEM vector pSB1C3. We hypothesized that the BsmBI restriction site in the chloramphenicol gene would decrease GGC efficiency, so we performed a mutagenesis PCR to introduce the silent mutation (G434C) prior to cloning the 96 PCR products into it. When doing so many cloning experiments at a time, error rate needs to be minimal, so at first, we spent weeks optimizing every single step from the G-block to the Golden Gate standard compatible BioBrick (see [[Team:Freiburg/Project/Golden/GGC|protocol section]]). In the end, we are very happy that we have a full GATE assembly kit with [[Team:Freiburg/Parts|96 unique direpeats]] and 100% accurate sequencing results.<br />
Our first attempts to use the GATE assembly kit were actually very discouraging - no colonies were found on the agar plates after transforming the GGC product into DH10B cells for more than one week - at least, we knew that our ccdb kill cassette was working well (details about the <html><a href="https://2012.igem.org/Team:Freiburg/Project/Vektor">expression vector</a></html>). After systematically testing all kinds of buffers and reaction additives, the results where quite overwhelming. We were even able to dramatically reduce GGC reaction time down to 2.5 hours - which is probably the fastest way anyone has ever built a custom tal effector.<br />
<br />
<br><br />
<br />
== References ==<br />
<br><br />
1. Huang, P. et al. Heritable gene targeting in zebrafish using customized TALENs. ''Nat Biotechnol'' 29, 699–700 (2011).<br><br />
2. Sander, J. D. et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. ''Nat Biotechnol 2''9, 697–698 (2011).<br><br />
3. Hoover, D. M. & Lubkowski, J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. ''Nucl Acids Res'' 30, e43–e43 (2002).<br><br />
4. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. ''Nat Biotechnol'' 29, 143–148 (2010).<br><br />
5. Morbitzer, R., Elsaesser, J., Hausner, J. & Lahaye, T. Assembly of Custom TALE-Type DNA Binding Domains by Modular Cloning. ''Nucl Acids Res'' 39, 5790–5799 (2011).<br><br />
6. Weber, E., Gruetzner, R., Werner, S., Engler, C. & Marillonnet, S. Assembly of designer TAL effectors by golden gate cloning. ''PloS one'' 6, e19722 (2011).<br><br />
7. Zhang, F. et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. ''Nat Biotechnol'' 29, 149–153 (2011).<br><br />
8. Cermak, T. et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. ''Nucl Acids Res'' 39, e82 (2011).<br><br />
9. Li, T. et al. Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes. ''Nucl Acids Res'' 39, 6315–6325 (2011).<br><br />
10. Boch, J. et al. Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. ''Science'' 326, 1509–1512 (2009).<br><br />
11. Reyon, D. et al. FLASH assembly of TALENs for high-throughput genome editing. ''Nat Biotechnol'' 30, 460–465 (2012).<br><br />
<br />
<br />
<br />
<br />
<br><br><br><br><br />
[[#top|Back to top]]<br />
<!--- The Mission, Experiments ---></div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/ExperimentsTeam:Freiburg/Project/Experiments2012-10-25T10:52:55Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Experiments =<br />
----<br />
<br />
<br />
== Gene activation ==<br />
----<br />
<html><br />
<p><br><br />
<br />
<div align="justify">To show the functionality of our TAL protein as well as the impact of the VP 64 transcription factor fusion protein, we used a TAL-VP64 fusion construct targeting a minimal promotor coupled with the secreted alkaline phosphatase (SEAP). The product of the reporter gene SEAP is - as the name tells - a phosphatase that is secreted by the cells into the surrounding media. The existence of SEAP and therefore the activity of the promotor can be measured by the addition of para-Nitrophenylphosphate (pNPP). The SEAP enzyme catalyzes the reaction from pNPP to para-Nitrophenol, this new product absorps light at 405 nm and can be measured via photometry. <br />
This reporter system gives us a couple of advantages over standard EGFP or luciferase systems. First of all, the SEAP is secreted into the cell culture media, therefore we don't have to lyse our cells for measuring, but just take a sample from the supernatant. <img src="http://imageshack.us/a/img189/6140/seapplasmid.png" align="right" padding:0px width="450px" hspace="20"/> We are also able to measure one culture multiple times, e.g. at two different points in time. Another advantage is the measurement via photometry which makes the samples quantitively comparable. Interestingly, we did not have to clone a TALE binding site upstream of the minimal promoter (which would be required for other DNA binding proteins) but simply produced a TALE that specifically bound to the given sequence.<br />
<br><br><br><br />
</html><br />
<br />
== Experimental design ==<br />
----<br />
<html><br />
<p><br><br />
<img src="http://imageshack.us/a/img268/53/exp1design2.png" align="left" padding:0px width="250px" hspace="20" /><br />
The experiment was done with four different transfections, either no plasmid, only the TAL vector, only the SEAP plasmid or a cotransfection of both plasmids. The cells were seeded on a twelve well plate the day before in 500µl culture media per well. The transfection was done with CaCl2 after a cell culture course protocol written by the lab of Professor Weber. <br />
<br><br><br><br><br><br><br><br><br />
</html><br />
<br />
= Results =<br />
----<br />
<br><div align="justify">The result of our lab work was mainly the GATE assembly toolkit and the corresponding vectors. Further experiments were performed to validate the function of the kit both ''in vitro'' and ''in vivo''. <br />
<br />
<br />
== The Toolkit ==<br />
----<br />
<br><br />
The creation of a toolkit with 96 different parts not only means a lot of labwork but also a lot of organisational tasks, sequencing and analysis. We don't want to bore you with the 96 sequences of our finished BioBricks, but we want to give you one example of a finished BioBrick and highlight some of the interesting and important strips in its sequence. If you are interested in the other sequences, just have a look at our [[Team:Freiburg/Parts|parts section]] or go to the [http://partsregistry.org Registry of Standard Biological Parts].<br />
<br />
<br />
{|align="center"<br />
|[[Image:AA1sequence.png|400px|no frame|link=]]<br />
|}<br />
<br />
<br />
In this sequence of our BioBrick AA1, the main features of all our BioBricks are highlighted. As pointed out in the Golden Gate Standard section of our project description, all direpeat plasmids are submitted in the Golden Gate Standard, that was developed by us and which is fully compatible with existing iGEM standards. In yellow you can see the direpeat gene fragment itself, the green parts are iGEM restriction sites (a requirement for all BioBricks), the sequence written in red is part of the psb1C3 vector, the blue sequences are recognition sites for BsmB1 and the red boxes are the cutting sites of BsmB1.<br />
<br><br><br />
<br />
== Creation of TAL sequences - Golden Gate Cloning ==<br />
----<br />
<br><br />
Admittedly, our GATE assembly kit is a little larger than the kit published from the Zhang kit in Nature this year (the latter comprises 78 parts). But considering that future iGEM teams can easily combine the parts to form more than 67 million different effectors, we believe that it was worth the effort. Now, to get from the toolbox to the finished TAL effector, you only need a few components: six direpeats, one effector backbone plasmid, two enzymes and one buffer. If you mix these components and incubate in your thermocycler for 2.5 hours, you get your custom TAL effector. To put this in perspective: The average turnaround time for TALE construction with conventional kits is about two weeks! In the following sections, we want to show you the efficiency of our GATE assembly platform<br />
<br />
<br><br />
== Varying Cycle number of GATE assembly has limited effect ==<br />
----<br />
Golden Gate protocols published so far for multistep TALE assembly differ significantly in the number of digestion-ligation cycles performed. To asses, whether the cycle number significantly affects outcome, we performed 4 different GATE assemblies, each with three different cycle numbers (50, 25 and 13 cycles). We did not see significant differences in the number of colonies for the three cycle numbers. Consequently, from that point on, we performed GATE assembly with only 13 cycles (which only take approximately 2.5 hours instead of 8.5 hours for 50 cycles).<br><br><br />
{|align="center"<br />
|[[Image:colonies.png|400px|no frame|link=]]<br />
|}<br />
<br><br><br />
<br />
== Direpeat Amplification by Colony PCR ==<br />
----<br />
<br><br />
<html><br />
<div align="justify">To assess if the direpeats have indeed been successfully cloned into our expression vector, we have accomplished colony PCR with a variety of samples. To this end, we have designed primers which bind to both ends of the direpeat region and thus amplify the direpeats of our TAL protein. <br />
The original vector contains a kill cassette which kills bacteria unless it is replaced by the direpeats during the Golden Gate Cloning reaction. <br />
This cassette will also be amplified by the designed primers. A distinction between the amplification of the kill cassette and that of direpeats can be made upon the amplicon length: if the kill cassette is amplified, the resulting amplicon will contain 1527bp, while direpeat amplification will produce amplicons of 1276bp length. The difference between these two amplicons is 251bp, and can be detected by agarose gel electrophoresis. <br />
<br />
<img src="https://static.igem.org/mediawiki/2012/0/04/Direpeat_amp.jpg" align="right" width="400px" hspace="20" vspace="20" alt="Direpeat amplification by colony PCR"/><br />
<br />
The figure clearly demonstrates the difference in size between the amplicons of negative control (kill cassette still in the vector) and positive (direpeats have replaced the cassette) samples. While lane 2 shows a negative result with a single band of bigger size, all the other samples yielded amplicons of smaller length and thus are considered as positive due to amplification of direpeats.<br />
Nevertheless, it is obvious that the colony PCR did not produce one single product when amplifying the direpeats, but rather a smear consisting of amplicons with varying lengths. <br />
This effect is due to numerous homologies within the direpeats and has previously been described by Briggs et al.<sup>1</sup> . <br />
To eliminate those homologies to the greatest extent possible, we changed codon usage within our direpeats. Nevertheless, as the results of our colony PCR demonstrate, there is still a profound amount of homologies left, which imposes difficulties on the amplification of the direpeats array by PCR and instead results in a smear.<br />
Thus, the existence of this smear indicates the presence of direpeats within the expression vector. Moreover, the light bands at 1276 bp indicates, that the right number of direpeats have been inserted into the vector. We performed 30 colony PCRs from colonies of different GATE assemblies and had no negative results (but in some cases, we could not determine the hight of the light band). Since positive results in colony PCR of TALEs do not exclude wrong order of direpeats, we sequenced 28 clones of different GATE assemblies and analyzed the results: in 27 of the 28 clones, sequencing results entirely matched the right sequence. So the efficiency of GATE assembly is approximately 96 %.<br />
<br><br><br><br />
<br><br />
</html><br />
<br />
== Activation of transcription ==<br />
----<br />
<html><br />
<br><br />
<div align="justify">To show that our TAL effectors are actually working, we used our completed toolkit to produce a TAL protein which is fused to a VP64 transcription factor. With this TAL-TF construct we targeted a sequence upstream of a minimal promotor that controls transcription of the enzyme secreted alkaline phosphatase (SEAP).In theory, the TAL domain should bring the fused VP64 domain in close proximity to the minimal promotor to activate the transcription of the repoter gene SEAP. The phosphatase is secreted an acummulates in the cell culture media. After 24 and 48 hours, we took samples from the media, stored them at -20°C, and subjected them two to photometric analysis.<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/84/IGEMres4.png" width="400px" hspace="20" vspace="20" alt="SEAP essay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br><br><br />
As it is observable in the graph, co-transfection of cells with TAL and SEAP plasmids (++) yielded a high increase in SEAP activity, compared to the control samples. The graph shows the average value of three biological replicates with its standard deviation. We further performed a t-test (Table) to prove if our experiment is statistically significant. As it is clearly observable, the p-values range below a value of 0,05, which indicates that our TAL transcription factor is able to elevate the transcription of the SEAP gene in a statistically significant manner.<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Igemres-p.png" width="400px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:170px"/><br />
<br><br />
After addition of pNPP, the substrate of SEAP, the activity of SEAP was measured over a period of time. In the next image, the results of the first nine minutes of this measurement are shown. After this time, the OD of the double transfection (++) rose too high to be measured by our photometer. As it is clearly visible, the sample with the double transfection shows a profound increase in the OD. This points to the fact that great amounts of SEAP have been secreted into the cell culture media due to elevated gene expression. In the other samples almost no SEAP activity was measureable. The sample transfected with only the SEAP plasmid showed the highest OD but this effect was not statistically significant (p-value:0,25/0,51).<br />
<br><br />
In the samples, that had been taken 48h after double transfection, the same effects could be demonstrated. <br />
<br><br />
Furthermore, we reapeated the same experiment for a second time. The corresponding data can be viewed here: <html><div style=text-indent:0px><a href="https://static.igem.org/mediawiki/2012/9/9c/Second_Essay.pdf">Second Experiment.</a><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/TALTF-SEAP-TIME.png" align="middle" width="500px" hspace="20" vspace="20" alt="SEAP assay using the TAL transcription factor plasmid targeting a minimal promotor coupled to a SEAP reporter gene" style="margin-left:120px"/><br />
</html><br />
<br />
== Reference ==<br />
1. Briggs, A. W. et al. Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers. ''Nucl Acids Res'' (2012).doi:10.1093/nar/gks624<br />
<br />
<br><br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:51:39Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
<div font-size:15xp>'''Strategy 1'''</div><br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
==<div id="GGC">Protocol</div>==<br />
----<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2''': The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
:In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
:Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:51:18Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
<div font-size:15xp>'''Strategy 1'''</div><br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
==<div id="GGC">Protocol</div>==<br />
----<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2''': The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
:In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
:Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:49:53Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
'''STRATEGY 1'''<br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
<div id="GGC">'''Protocol:'''</div><br />
<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''STRATEGY 2'''<br><br />
<br />
The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br><br />
:'''Step 2:''' Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br><br />
<br />
:Exceptions:<br><br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
:In case you encounter one of these exceptions, try one of the following overlaps:<br><br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br><br><br />
:Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:49:37Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
'''STRATEGY 1'''<br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
<div id="GGC">'''Protocol:'''</div><br />
<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''STRATEGY 2'''<br><br />
<br />
The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br><br />
:'''Step 2:''' Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br><br />
<br />
:Exceptions:<br><br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
:In case you encounter one of these exceptions, try one of the following overlaps:<br><br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br><br />
:Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:49:00Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
'''STRATEGY 1'''<br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
<div id="GGC">'''Protocol:'''</div><br />
<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''STRATEGY 2'''<br><br />
<br />
The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br><br />
:'''Step 2:''' Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br><br />
<br />
::Exceptions:<br><br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
:In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
:Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:48:35Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
'''STRATEGY 1'''<br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
<div id="GGC">'''Protocol:'''</div><br />
<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''STRATEGY 2'''<br><br />
<br />
The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br><br />
:'''Step 2:''' Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
:In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
:Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:47:43Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
'''STRATEGY 1'''<br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
<div id="GGC">'''Protocol:'''</div><br />
<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''STRATEGY 2'''<br><br />
<br />
The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
:In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
:Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:46:46Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
'''STRATEGY 1'''<br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
<div id="GGC">'''Protocol:'''</div><br />
<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''STRATEGY 2'''<br><br />
The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
:In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
:Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:46:06Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
<div style: "font-size:15xp">'''Strategy 1'''</div><br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
<div id="GGC">'''Protocol:'''</div><br />
<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2''': The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
:In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
:Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:45:40Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
<div font-size:15xp>'''Strategy 1'''</div><br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
<div id="GGC">'''Protocol:'''</div><br />
<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2''': The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
:In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
:Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:44:37Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
'''Strategy 1'''<br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
<div id="GGC">'''Protocol:'''</div><br />
<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2''': The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
:In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
:Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:43:48Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
== Strategy 1 ==<br><br />
<br />
In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
<div id="GGC">'''Protocol:'''</div><br />
<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2''': The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
:In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
:Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:41:00Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
'''Strategy 1''': In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
==<div id="GGC">Protocol:</div>==<br />
----<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2''': The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:'''Step 1:''' Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
:In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
:Usually, you should be able to define your overlaps now.<br><br><br />
<br />
:'''Step 3''': Design your primers:<br><br />
<br />
::Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
::Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
:'''Step 4:''' Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
:'''Step 5:''' Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
:'''Step 6:''' Excise corresponding band and perform gel purification.<br><br />
<br />
:'''Step 7:''' Perform Golden Gate Cloning as described above.<br><br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:38:53Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
'''Strategy 1''': In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
==<div id="GGC">Protocol:</div>==<br />
----<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br><br />
For creating new BioBricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we usually had no colonies on our negative control plate after transformation).<br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br><br><br />
<br />
'''Strategy 2.''' The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scarless products (which is crucial for many applications, such as protein domain assembly). For scarless cloning of BioBricks, we therefore propose the following strategy:<br><br><br />
<br />
:Step 1: Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br><br />
:Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
:Exceptions:<br><br />
::1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
::2. Several parts end with the same 4 bp sequence.<br><br />
::3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
::1. Use the first 4 bp of the downstream part as overlap.<br><br />
::2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
Usually, you should be able to define your overlaps now.<br><br><br />
<br />
Step 3: Design your primers:<br><br />
<br />
Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
Step 4: Perform PCR using a high-fidelity polymerase to amplify the BioBricks with the corresponding primers.<br><br />
<br />
Step 5: Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
Step 6: Excise corresponding band and perform gel purification.<br><br />
<br />
Step 7: Perform Golden Gate Cloning as described above.<br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:34:40Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
'''Strategy 1''': In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
==<div id="GGC">Protocol:</div>==<br />
----<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br />
For creating new biobricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
::1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
::4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we typically had no colonies on our negative control plate after transformation). <br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br />
<br />
2. The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scar less products (which is crucial for many applications, such as protein domain assembly). For scar less cloning of BioBricks, we therefore propose the following strategy:<br />
Step 1: Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br />
Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
Exceptions:<br><br />
1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
2. Several parts end with the same 4 bp sequence.<br><br />
3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
1. Use the first 4 bp of the downstream part as overlap.<br><br />
2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
Usually, you should be able to define your overlaps now.<br><br><br />
<br />
Step 3: Design your primers:<br><br />
<br />
Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
Step 4: Perform PCR using a high-fidelity polymerase to amplify the biobricks with the corresponding primers.<br><br />
<br />
Step 5: Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
Step 6: Excise corresponding band and perform gel purification.<br><br />
<br />
Step 7: Perform Golden Gate Cloning as described above.<br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:32:53Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
'''Strategy 1''': In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br />
We built [[Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
==<div id="GGC">Protocol:</div>==<br />
----<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br />
For creating new biobricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we typically had no colonies on our negative control plate after transformation). <br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br />
<br />
2. The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scar less products (which is crucial for many applications, such as protein domain assembly). For scar less cloning of BioBricks, we therefore propose the following strategy:<br />
Step 1: Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br />
Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
Exceptions:<br><br />
1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
2. Several parts end with the same 4 bp sequence.<br><br />
3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
1. Use the first 4 bp of the downstream part as overlap.<br><br />
2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
Usually, you should be able to define your overlaps now.<br><br><br />
<br />
Step 3: Design your primers:<br><br />
<br />
Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
Step 4: Perform PCR using a high-fidelity polymerase to amplify the biobricks with the corresponding primers.<br><br />
<br />
Step 5: Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
Step 6: Excise corresponding band and perform gel purification.<br><br />
<br />
Step 7: Perform Golden Gate Cloning as described above.<br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:31:49Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts.<br><br><br />
<br />
'''Strategy 1''': In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second, etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br></html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
::1. between prefix/suffix restriction sites and the actual part<br><br />
::2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
::3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following '''Golden Gate Standard''':<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, '''xxxx''' represents the four basepair overlaps and '''NN''' represents two random nucleotides)<br><br />
We built [[#Team:Freiburg/Parts|'''96 BioBricks''']] using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
==<div id="GGC">Protocol:</div>==<br />
----<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br />
For creating new biobricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we typically had no colonies on our negative control plate after transformation). <br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br />
<br />
2. The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scar less products (which is crucial for many applications, such as protein domain assembly). For scar less cloning of BioBricks, we therefore propose the following strategy:<br />
Step 1: Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br />
Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
Exceptions:<br><br />
1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
2. Several parts end with the same 4 bp sequence.<br><br />
3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
1. Use the first 4 bp of the downstream part as overlap.<br><br />
2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
Usually, you should be able to define your overlaps now.<br><br><br />
<br />
Step 3: Design your primers:<br><br />
<br />
Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
Step 4: Perform PCR using a high-fidelity polymerase to amplify the biobricks with the corresponding primers.<br><br />
<br />
Step 5: Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
Step 6: Excise corresponding band and perform gel purification.<br><br />
<br />
Step 7: Perform Golden Gate Cloning as described above.<br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:28:13Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position of the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts. <br><br />
<br />
:'''Strategy 1''': In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
::- Promoters<br><br />
::- Ribosome binding sites (RBS)<br><br />
::- Protein coding regions<br><br />
::- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br> </html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
1. between prefix/suffix restriction sites and the actual part<br><br />
2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following Golden Gate Standard:<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, xxxx represents the four basepair overlaps and NN represents two random nucleotides)<br />
We built 96 BioBricks using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
==<div id="GGC">Protocol:</div>==<br />
----<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br />
For creating new biobricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we typically had no colonies on our negative control plate after transformation). <br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br />
<br />
2. The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scar less products (which is crucial for many applications, such as protein domain assembly). For scar less cloning of BioBricks, we therefore propose the following strategy:<br />
Step 1: Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br />
Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
Exceptions:<br><br />
1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
2. Several parts end with the same 4 bp sequence.<br><br />
3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
1. Use the first 4 bp of the downstream part as overlap.<br><br />
2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
Usually, you should be able to define your overlaps now.<br><br><br />
<br />
Step 3: Design your primers:<br><br />
<br />
Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
Step 4: Perform PCR using a high-fidelity polymerase to amplify the biobricks with the corresponding primers.<br><br />
<br />
Step 5: Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
Step 6: Excise corresponding band and perform gel purification.<br><br />
<br />
Step 7: Perform Golden Gate Cloning as described above.<br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:26:20Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position oft the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts. <br><br />
<br />
1. In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
- Promoters<br><br />
- Ribosome binding sites (RBS)<br><br />
- Protein coding regions<br><br />
- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br> </html><br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
1. between prefix/suffix restriction sites and the actual part<br><br />
2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following Golden Gate Standard:<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, xxxx represents the four basepair overlaps and NN represents two random nucleotides)<br />
We built 96 BioBricks using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
==<div id="GGC">Protocol:</div>==<br />
----<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br />
For creating new biobricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we typically had no colonies on our negative control plate after transformation). <br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br />
<br />
2. The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scar less products (which is crucial for many applications, such as protein domain assembly). For scar less cloning of BioBricks, we therefore propose the following strategy:<br />
Step 1: Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br />
Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
Exceptions:<br><br />
1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
2. Several parts end with the same 4 bp sequence.<br><br />
3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
1. Use the first 4 bp of the downstream part as overlap.<br><br />
2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
Usually, you should be able to define your overlaps now.<br><br><br />
<br />
Step 3: Design your primers:<br><br />
<br />
Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
Step 4: Perform PCR using a high-fidelity polymerase to amplify the biobricks with the corresponding primers.<br><br />
<br />
Step 5: Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
Step 6: Excise corresponding band and perform gel purification.<br><br />
<br />
Step 7: Perform Golden Gate Cloning as described above.<br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:26:05Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position oft the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts. <br><br />
<br />
1. In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
- Promoters<br><br />
- Ribosome binding sites (RBS)<br><br />
- Protein coding regions<br><br />
- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br> <br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
1. between prefix/suffix restriction sites and the actual part<br><br />
2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
3. distal from both RFC 10 restriction sites.<br><br><br />
<html><br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br></html><br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following Golden Gate Standard:<br><br><br />
<br />
<html><img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br></html><br />
<br />
<br />
Prefix: Figure 6 (Standard, xxxx represents the four basepair overlaps and NN represents two random nucleotides)<br />
We built 96 BioBricks using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
==<div id="GGC">Protocol:</div>==<br />
----<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br />
For creating new biobricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we typically had no colonies on our negative control plate after transformation). <br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br />
<br />
2. The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scar less products (which is crucial for many applications, such as protein domain assembly). For scar less cloning of BioBricks, we therefore propose the following strategy:<br />
Step 1: Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br />
Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
Exceptions:<br><br />
1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
2. Several parts end with the same 4 bp sequence.<br><br />
3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
1. Use the first 4 bp of the downstream part as overlap.<br><br />
2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
Usually, you should be able to define your overlaps now.<br><br><br />
<br />
Step 3: Design your primers:<br><br />
<br />
Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
Step 4: Perform PCR using a high-fidelity polymerase to amplify the biobricks with the corresponding primers.<br><br />
<br />
Step 5: Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
Step 6: Excise corresponding band and perform gel purification.<br><br />
<br />
Step 7: Perform Golden Gate Cloning as described above.<br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitushttp://2012.igem.org/Team:Freiburg/Project/GoldenTeam:Freiburg/Project/Golden2012-10-25T10:24:52Z<p>Pablinitus: </p>
<hr />
<div>{{Template:Team:Freiburg}}<br />
__NOTOC__<br />
= Golden Gate Standard =<br />
----<br />
<br><br />
<div align="justify">On this page, we introduce the Golden Gate Standard to the Registry of Standard Biological parts. We explain in detail, how Golden Gate Cloning works and how it can be made compatible with RFC 10 standard. Moreover, we provide step-by-step protocols for using this new standard.<br />
<br />
<br />
==Introduction ==<br />
----<br />
<br><br />
<html><br />
Although BioBrick assembly is a powerful tool for the synbio community because it allows standardized, simple construction of complex genetic constructs from basic genetic modules, it is not the best option when it comes to assembling larger numbers of modules in a short period of time. Furthermore, BioBrick assembly leaves scars between assembled parts, which is not optimal for protein fusion constructs. One popular method which overcomes these obstacles is Gibson Cloning (see figure 1). <br />
This method uses an exonuclease to produce sticky ends on overlapping PCR products, a polymerase to fill up single stranded gaps after annealing and a ligase to connect the different parts.<img src="https://static.igem.org/mediawiki/2012/d/d8/Figure2T.png" align="right" width="400px" style="margin-left:10px; margin-top:10px" ><br />
Gibson cloning allows for assembling whole constructs in one reaction and has been used by many iGEM teams over the past years. However, this technique is not compatible with parts provided by the Registry, unless parts are PCR-amplified in order to linearize them and to add overlapping sequences. Furthermore, Gibson cloning requires three different enzymes and can be very tricky.<br />
We therefore propose another method called Golden Gate Cloning (or ist derivatives MoClo and GoldenBraid). Golden Gate Cloning (GGC) can be used to assemble many fragments with very high efficiency in one reaction . Importantly, insert fragments can be cut out of amplification vectors (such as iGEM standard vectors) and assembled in one single reaction.<br />
</p></html><br><div style="margin-left:460px">Figure 1: Gibson Cloning</div><br />
<br><br />
<br />
== Mechanism ==<br />
----<br />
<br><html><br />
Golden Gate Cloning exploits the ability of type IIs restriction enzymes (such as BsaI, BsmBI or BbsI) to produce 4 bp sticky ends right next to their binding sites, irrespective of the adjacent nucleotide sequence. Importantly, binding sites of type IIs restriction enzymes are not palindromic and therefore are oriented towards the cutting site (figure 2). <br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/72/Bsmb1.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 2: BsmB1 restriction mechanism</div><br><br><br />
<br />
So, if a part is flanked by 4 bp overlaps and two binding sites of a type IIs restriction enzyme, which are oriented towards the centre of the part, digestion will lead to predefined sticky ends at each side of the part. In case multiple parts are designed this way and overlaps at both ends of the parts are chosen carefully, the parts align in a predefined order (figure 3).<br><br><br><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Figure3T.png" width="400px" style="margin-left:150px"/><br><br><div align="center">Figure 3 : Golden Gate mechanism</div><br><br> <br />
<br />
In case a destination vector is added, that contains type IIs restriction sites pointing in opposite directions, the intermediate piece gets replaced by the assembled parts – magic! After transformation, the antibiotic resistance of the destination vector selects for the right clones.<br><br />
Golden Gate Cloning is typically performed as an all-in-one-pot reaction. This means that all DNA parts, the type IIs restriction enzyme and a ligase are mixed in a PCR tube and put into a thermocycler. By cycling back and forth 10 to 50 times between 37°C and 20°C, the DNA parts get digested and ligated over and over again. Digested DNA fragments are either religated into their plasmids or get assembled with other parts as described above. Since assembled parts lack restriction sites for the type IIs enzyme, the parts get “trapped” in the desired construct. This is the reason why Golden Gate Cloning assembles DNA fragments with such exceptional efficiency.<br />
We successfully used this approach to assemble whole TAL effectors vector from six different parts and cloned it into an expression vector – all in one reaction (see below).<br />
<br><br></html><br />
<br />
== Merging BioBrick Standard and Golden Gate Cloning ==<br />
----<br />
<br><br />
As described above, the overlaps flanking a part determine the position oft the particular part within the construct after GGC. We therefore propose the following two strategies for implementing Golden Gate Cloning within the Registry of standard biological parts. <br><br />
<br />
1. In most cases, iGEM teams seek to assemble so called protein generators, which consist of one part of each of the following categories:<br><br><br />
- Promoters<br><br />
- Ribosome binding sites (RBS)<br><br />
- Protein coding regions<br><br />
- and terminators<br><br><br />
Since the order of these parts in a protein generator is always the same (promoter first, RBS second etc.), we can attribute a particular pair of overlaps to each of these categories and thereby define the order of the corresponding parts. From our experience with GGC, we propose the following overlaps which have shown no mispairing in our experiments:<br><br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/2/2a/Figure4.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 4 : Overlaps of GGC</div><br><br> <br />
<br />
We believe that new standards should only be introduced to the Registry of Standard Biological Parts if they are compatible with the existing standards (most importantly with RFC 10). Otherwise, the registry would get functionally split up into smaller part libraries and teams using one standard could not collaborate with teams using another. We therefore were very careful with introducing type IIs restriction sites into iGEM backbones. In this context, choosing the optimal relative position of the type IIs binding site to the BioBrick prefix and suffix restriction sites is essential for preserving idempotency of the RFC 10 standard. Idempotency in this context means that assembling BioBricks results in higher order constructs that meet BioBrick standard requirements (i.e. they are flanked by the four standard restriction sites and do not contain any of them). The type IIs restriction site can principally be placed in three different positions: <br><br><br />
1. between prefix/suffix restriction sites and the actual part<br><br />
2. between the two restriction sites of the prefix and suffix (EcoRI and XbaI or SpeI and PstI, respectively)<br><br />
3. distal from both RFC 10 restriction sites.<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/e/ef/Figure5T.png" width="400px" style="margin-left:150px"/><br><div align="center">Figure 5 : Restriction sites</div><br><br> <br />
<br />
As illustrated in figure 5, only placing the type IIs site between the RFC 10 standard restriction sites maintains idempotency of the BioBrick standard. In each of the other cases, constructs assembled by Golden Gate Cloning are not iGEM standard compatible because they contain RFC 10 standard restriction sites. We therefore propose the following Golden Gate Standard:<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/8/8d/Figure6T.png" width="450px" style="margin-left:130px"/><br><div align="center">Figure 6 : Mammobrick</div><br><br><br />
<br />
<br />
Prefix: Figure 6 (Standard, xxxx represents the four basepair overlaps and NN represents two random nucleotides)<br />
We built 96 BioBricks using this Golden Gate Standard and were able to differentially use RFC 10 or Golden Gate standard<br />
<br><br><br />
<br />
==<div id="GGC">Protocol:</div>==<br />
----<br />
<br><br />
Since most standard iGEM plasmids contain binding sites of the most common two type IIs restriction enzymes (namely BsaI/Eco31I and BsmBI/Esp3I), we propose using BbsI/BpiI. We have tested this enzyme in various reaction conditions with many different reaction additives (such as ATP or DTT). Although ligase buffer worked best with other type IIs restriction enzymes (in those cases, ligase activity probably was the bottleneck), we had best results with G Buffer (Fermantas) plus several additives using BbsI.<br><br />
For creating new biobricks by PCR amplifying the corresponding DNA sequences, we propose the following primers:<br><br><br><br />
<br />
<br />
<br />
1. For '''Promoters''':<br><html><br />
<div style="text-indent:10px">Pro fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT CCTG + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Pro re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
2. For '''RBS''':<html><br />
<div style="text-indent:10px">RBS fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">RBS re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GTCA + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
3. For '''ORF''':<br><html><br />
<div style="text-indent:10px">ORF fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT TGAC + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">ORF re: GATACTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGC + appr. 17 bp overlap (reverse complement)</div></html><br />
<br />
4. For '''Terminators''':<html><br />
<div style="text-indent:10px">Ter fo: GATGAATTCGCGGCCGCTTCTAGAGAAGAC AT GCTT + appr. 17 bp overlap</div></html><html><br />
<div style="text-indent:10px">Ter re: GATCTGCAGCGGCCGCTACTAGTAGAAGAC TA GAGT + appr. 17 bp overlap (reverse complement)</div><br />
</html><br />
<br><br />
After purification of the PCR product, you can digest your linearized iGEM vector and your part with EcoRI and PstI using the following Protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>Purified PCR product</td><td>&#160;30</td><br />
</tr><tr><br />
<td>EcoRI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>PstI</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>BsaI</td><td>&#160;0,5</td> <br />
</tr><tr><br />
<td>NEB buffer 4 (10x)</td><td>&#160;4</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;3,5</td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;40</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 12 hours</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 80°C, 20 minutes</td><br />
</tr></table></html><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
We very much advise you to digest the vector for for 12 hours and purify the product on a gel. This significantly reduces the risk of religation of you vector (we typically had no colonies on our negative control plate after transformation). <br><br />
<br />
For assembling parts that are in Golden Gate standard, we recommend the following protocol:<br><br />
<br><br />
<html><br />
<table align=left border=0 style="margin-left:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Component</td><th>Amount (μl)</td><br />
</tr><tr><br />
<td>BpiI/BbsI (15 U)</td><td>&#160;0,75</td><br />
</tr><tr><br />
<td>T4 Ligase (400 U)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>DTT (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>ATP (10 mM)</td><td>&#160;1</td> <br />
</tr><tr><br />
<td>G-Buffer (10x, Fermentas)</td><td>&#160;1</td><br />
</tr><tr><br />
<td>parts </td><td>&#160;40 fmoles each</td><br />
</tr><tr><br />
<td>ddH2O</td><td>&#160;Fill up to 10 </td><br />
</tr><tr><br />
<td>Total Volume</td><td>&#160;10</td> <br />
</tr></table></html><br />
<br />
<html><br />
<table align=right border=0 style="margin-right:70px; background-color:transparent; color:#1C649F;"><br />
<tr><br />
<th>Thermocycler programm:</th><br />
</tr><tr><br />
<td>1. &#160; &#160; 37°C, 5 min</td><br />
</tr><tr><br />
<td>2. &#160; &#160; 20°C, 5 min</td><br />
</tr><tr><br />
<td>repeat (1. and 2.) 20 times</td><br />
</tr><tr><br />
<td>3. &#160; &#160; 50°C, 10 min</td><br />
</tr><tr><br />
<td>4. &#160; &#160; 80°C, 10 min</td><br />
</tr></table></html><br><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br />
We always used this 8:40 hour thermocycler program to obtain best results. However you can also reduce the number of cycles.<br />
<br />
2. The Golden Gate Standard described above is very efficient, however, it does not exploit the exceptional advantage of GGC to assemble parts in-frame and without a scar. In the past iGEM competitions, several attempts to clone protein modules in-frame have been proposed (see http://partsregistry.org/Help:Standards/Assembly#Registry_Supported_Assembly_Standards), but no standard allows for scar less products (which is crucial for many applications, such as protein domain assembly). For scar less cloning of BioBricks, we therefore propose the following strategy:<br />
Step 1: Define the sequences of DNA that you want to assemble without a scar. In case the sequences contain protein-coding sequences, make sure your sequences are in frame (e.g. the last three bp of the upstream part form a codon and the first three bp of the downstream part form a codon).<br />
Step 2: Choose your 4 bp overlaps: In most cases, you can define the last 4 bp of every part as your overlaps.<br><br />
<br />
Exceptions:<br><br />
1. Overlaps are palindromic (don’t worry, the chance of a palindromic 4 bp sequence is less than 7 %). In this case, the part not only aligns with the downstream part but also with itself.<br><br />
2. Several parts end with the same 4 bp sequence.<br><br />
3. Three out of four base pairs of different parts are similar. In this case, mispairing may occur. However, we tried several 4 bp overhangs that overlap in 3 of 4 bp and haven’t had any false cloning product yet.<br><br><br />
In case you encounter one of these exceptions, try one of the following overlaps:<br><br />
1. Use the first 4 bp of the downstream part as overlap.<br><br />
2. Use 2 bp of the upstream and 2 bp of the downstream part as overlap.<br />
Usually, you should be able to define your overlaps now.<br><br><br />
<br />
Step 3: Design your primers:<br><br />
<br />
Forward primer: GAT GAAGAC CG XXXX first appr. 17 bp of the part (xxxx represents the overlap for the upstream part)<br><br />
Reverse primer: GATCA GAAGAC CG reverse complement of the last appr. 17 bp of the part<br><br />
<br />
Step 4: Perform PCR using a high-fidelity polymerase to amplify the biobricks with the corresponding primers.<br><br />
<br />
Step 5: Load the entire PCR product on a 1,5 % agarose gel and check whether your PCR product has the right size.<br><br />
<br />
Step 6: Excise corresponding band and perform gel purification.<br><br />
<br />
Step 7: Perform Golden Gate Cloning as described above.<br><br />
<br />
We used this approach to built a minimal eukaryotic expression vector that is compatible with RFC 10 standard.<br><br><br><br />
<br><br><br />
[[#top|Back to top]]</div>Pablinitus