http://2012.igem.org/wiki/index.php?title=Special:Contributions/Mo&feed=atom&limit=50&target=Mo&year=&month=2012.igem.org - User contributions [en]2024-03-28T18:38:02ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/File:Bielefeld-Germany_Lacman.jpgFile:Bielefeld-Germany Lacman.jpg2012-10-27T03:43:21Z<p>Mo: uploaded a new version of &quot;File:Bielefeld-Germany Lacman.jpg&quot;</p>
<hr />
<div></div>Mohttp://2012.igem.org/File:Bielefeld-Germany_Lacman.jpgFile:Bielefeld-Germany Lacman.jpg2012-10-27T03:41:24Z<p>Mo: uploaded a new version of &quot;File:Bielefeld-Germany Lacman.jpg&quot;</p>
<hr />
<div></div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/ResultsTeam:Bielefeld-Germany/Amsterdam/Results2012-10-27T03:40:36Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Results since Regionals<br />
</span><br />
</div><br />
<style type="text/css"><br />
<br />
ul {<br />
list-style-image:none;<br />
}<br />
#bodyContent{<br />
background-color: white;<br />
}<br />
<br />
</style><br />
<br />
<br />
<!-- navigator --><br />
<div id="tab"><br />
<br />
<ul style="list-style-type:none"><br />
<li><a href="#1"><strong>Summary</strong></a></li><br />
<li><a href="#2"><strong>Laccases</strong></a></li><br />
<li><a href="#3"><strong>Immobilization</strong></a></li><br />
<li><a href="#4"><strong>Substrate Analysis</strong></a></li><br />
<li><a href="#5"><strong>CBD</strong></a></li><br />
<li><a href="#6"><strong>Shuttle vector</strong></a></li><br />
</ul><br />
</div><br />
<br />
<br />
<!-- tab panes --><br />
<div id="panesresult2"><br />
<br />
<div id="anzeige"><br />
<img src="https://static.igem.org/mediawiki/2012/0/0b/Bielefeld2012_Amsterdamgruppe.jpg" /> <br />
<br />
<br />
<h1>Summary</h1><br />
<br />
</html><br />
<p class="more"><br />
Since the European Jamboree in Amsterdam all four laccases (ECOL, BPUL, TTHL, BHAL) were produced in a 12 L scale and purified to get a high amount of the enzyme for a further characterization. They were analyzed and compared concerning their activity at different pH and temperature effects. Furthermore they were all screened regarding to their ability of estradiol and ethinyl estradiol degradation. The immobilization of the four laccases using CPC-beads was optimized and the activity tested. All of them were active. Additionally a shuttle vector for ''Pichia pastoris'' was constructed, which works as expected. The eukaryotic laccase TVEL5 was successfully cloned into the vector, produced and secreted. Finally lots of efforts were made to construct a protein fused to a cellulose binding domain, but until now, no working fusion protein could be produced.<br />
<br />
<html><br />
</p><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/9/99/Bielefeld-Germany_Lacman.jpg" /> <br />
<br />
<h1>Laccases</h1><br />
<p class="more"><br />
</html><br />
The iGEM Team successfully produced four active bacterial laccases and an eukaryotic laccase (click for the results):<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/coli ''Escherichia coli'' laccase ECOL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi''Bacillus pumilus'' laccase BPUL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo''Bacillus halodurans'' laccase BHAL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo ''Thermus thermophilus'' laccase TTHL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 ''Trametes versicolor'' laccase TVEL5]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison Comparison of the different laccases]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/trametis Purchased positive control ''Trametes versicolor'' laccase TVEL0]<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
All bacterial laccases ([https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Since_Regionals:_12.C2.A0L_Fermentation_E._coli_KRX_with_BBa_K863005 ECOL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Since_Regionals:_12.C2.A0L_Fermentation_E..C2.A0coli_KRX_with_BBa_K863000 BPUL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Since_Regionals:_12L_Fermentation_of_E._coli_Rosetta-Gami_2_with_BBa_K863022 BHAL] and [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Since_Regionals:_12_L_Fermentation_of_E._coli_Rosetta_Gami_2_with_BBa_K863012 TTHL]) were successfully scaled-up to a working volume of 12 L. Additional a optimized medium was chosen in the hope to enhance the protein amount. Activity assays were done for all four laccases ([https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Initial_activity_tests_of_purified_fractions ECOL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Since_Regionals:_Initial_activity_tests_of_purified_fractions BPUL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Since_Regionals:_Initial_activity_tests_of_purified_fractions BHAL] and [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Since_Regionals:_Initial_activity_tests_of_purified_fractions TTHL]), especially in regard to optimal pH and temperature effects. Additionally a [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison comparison] of all four produced laccases concerning their activity has been done. In addition an active eukaryotic laccases of ''Trametes versicolor'' was produced with a self-designed Shuttle-vector in yeast ''Pichia Pastoris''. <br />
<html><br />
</p><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/79/Bielefeld2012_Immosum2.jpg" /><br />
<br />
<h1>Immobilization</h1><br />
<br />
<p class="more"><br />
</html><br />
The immobilization method on CPC-beads was further optimized. It has been proved that an incubation time of 6 hours is actually enough for immobilization. Furthermore, two additional laccases were successfully immobilized: from <br />
<html><br />
</p><br />
</html><br />
:* [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] (named BHAL) and from <br />
:*[http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] (named TTHL).<br />
<html><br />
<p class="more"><br />
</html><br />
Moreover, activity tests were carried out on all four immobilized laccases (ECOL, BPUL, BHAL, and TTHL). All of them showed activity. For immobilization results see [https://2012.igem.org/Team:Bielefeld-Germany/Results/immo#Since_Regionals:_Activity_tests_of_immobilized_ECOL.2C_BPUL.2C_BHAL_and_TTHL here]<br />
<html><br />
</p><br />
</div><br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/f/fa/Bielefeld2012-Estradiol-MS-measurement.JPG" /><br />
<br />
<h1>Substrate Analysis</h1><br />
<p class="more"><br />
</html><br />
After the regional jamboree Team Activity Test, Team Immobilization and Team Substrate Analysis got laccases from the same pool from the Cultivation Team. With these laccases the degradation experiments of estradiol and ethinyl estradiol were repeated for the laccases BPUL and ECOL. The new laccases BHAL and TTHL were characterized for estradiol and ethinyl estradiol degradation too. Estradiol and ethinyl estradiol was futher analyzed on LC-MS/MS<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
For more information about the new results [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Degradation_of_estrogens click here].<br />
Possible resulting degradation products after treatment of estradiol and ethinyl estradiol with TVEL0 were further analyzed via LCMS-MS. The results are shown [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Further_analysis_.28after_Regionals_Amsterdam.29 here].<br />
<html><br />
<br />
</p> <br />
<br />
<br />
</div><br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/b/b4/Bielefeld2012_no_GFP.jpg" /><br />
<br />
<h1>Cellulose binding domain</h1><br />
<br />
<p class="more"><br />
</html><br />
A lot of efforts were made, to change the order of the fusion proteins, to change the promoter and the RBS and to insert a different linker between the cellulose binding domain and the reporter GFP, but to the last day of lab work no green glowing colony to work with and execute the binding assay could be generated.<br />
<p class="more"><br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/cbc#Since_Amsterdam">Read '''the Boston file'''</a><br />
<html><br />
</p><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/a/a5/Bielefeld2012_TVEL5_Eppis.jpg" /><br />
<br />
<h1>Shuttle vector</h1><br />
<p class="more"><br />
</html><br />
The laccase TVEL5 from ''Trametes versicolor'' was successfully cloned via the ''Aar''I restriction sites in the shuttle vector <partinfo>BBa_K863207</partinfo>. We could show that the gene of interest is integrating in yeast genome over site directed recombination and the produced protein of interest is secreted in the cultivation medium and detectable there. With this results we could show that the shuttle vector is working as expected and therefor can be used for the production of any protein of interest.<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector#Since_Regionals:_TVEL5_integrated_in_shuttle_vector For more information read here.]<br />
<html><br />
</p><br />
<br />
</div><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<script><br />
$(function() {<br />
<br />
<br />
$("#tab ul").tabs("#panesresult2 > div", {effect: 'fade', fadeOutSpeed: 400});<br />
});<br />
</script><br />
<br />
</html><br />
<br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/File:Bielefeld-Germany_Lacman.jpgFile:Bielefeld-Germany Lacman.jpg2012-10-27T03:39:41Z<p>Mo: uploaded a new version of &quot;File:Bielefeld-Germany Lacman.jpg&quot;</p>
<hr />
<div></div>Mohttp://2012.igem.org/File:Bielefeld-Germany_Lacman.jpgFile:Bielefeld-Germany Lacman.jpg2012-10-27T03:36:59Z<p>Mo: </p>
<hr />
<div></div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/ResultsTeam:Bielefeld-Germany/Amsterdam/Results2012-10-27T03:26:00Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Results since Regionals<br />
</span><br />
</div><br />
<style type="text/css"><br />
<br />
ul {<br />
list-style-image:none;<br />
}<br />
#bodyContent{<br />
background-color: white;<br />
}<br />
<br />
</style><br />
<br />
<br />
<!-- navigator --><br />
<div id="tab"><br />
<br />
<ul style="list-style-type:none"><br />
<li><a href="#1"><strong>Summary</strong></a></li><br />
<li><a href="#2"><strong>Laccases</strong></a></li><br />
<li><a href="#3"><strong>Immobilization</strong></a></li><br />
<li><a href="#4"><strong>Substrate Analysis</strong></a></li><br />
<li><a href="#5"><strong>CBD</strong></a></li><br />
<li><a href="#6"><strong>Shuttle vector</strong></a></li><br />
</ul><br />
</div><br />
<br />
<br />
<!-- tab panes --><br />
<div id="panesresult2"><br />
<br />
<div id="anzeige"><br />
<h1>Summary</h1><br />
<br />
</html><br />
<p class="more"><br />
Since the European Jamboree in Amsterdam all four laccases (ECOL, BPUL, TTHL, BHAL) were produced in a 12 L scale and purified to get a high amount of the enzyme for a further characterization. They were analyzed and compared concerning their activity at different pH and temperature effects. Furthermore they were all screened regarding to their ability of estradiol and ethinyl estradiol degradation. The immobilization of the four laccases using CPC-beads was optimized and the activity tested. All of them were active. Additionally a shuttle vector for ''Pichia pastoris'' was constructed, which works as expected. The eukaryotic laccase TVEL5 was successfully cloned into the vector, produced and secreted. Finally lots of efforts were made to construct a protein fused to a cellulose binding domain, but until now, no working fusion protein could be produced.<br />
<br />
<html><br />
</p><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg" /> <br />
<br />
<h1>Laccases</h1><br />
<p class="more"><br />
</html><br />
The iGEM Team successfully produced four active bacterial laccases and an eukaryotic laccase (click for the results):<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/coli ''Escherichia coli'' laccase ECOL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi''Bacillus pumilus'' laccase BPUL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo''Bacillus halodurans'' laccase BHAL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo ''Thermus thermophilus'' laccase TTHL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 ''Trametes versicolor'' laccase TVEL5]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison Comparison of the different laccases]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/trametis Purchased positive control ''Trametes versicolor'' laccase TVEL0]<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
All bacterial laccases ([https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Since_Regionals:_12.C2.A0L_Fermentation_E._coli_KRX_with_BBa_K863005 ECOL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Since_Regionals:_12.C2.A0L_Fermentation_E..C2.A0coli_KRX_with_BBa_K863000 BPUL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Since_Regionals:_12L_Fermentation_of_E._coli_Rosetta-Gami_2_with_BBa_K863022 BHAL] and [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Since_Regionals:_12_L_Fermentation_of_E._coli_Rosetta_Gami_2_with_BBa_K863012 TTHL]) were successfully scaled-up to a working volume of 12 L. Additional a optimized medium was chosen in the hope to enhance the protein amount. Activity assays were done for all four laccases ([https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Initial_activity_tests_of_purified_fractions ECOL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Since_Regionals:_Initial_activity_tests_of_purified_fractions BPUL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Since_Regionals:_Initial_activity_tests_of_purified_fractions BHAL] and [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Since_Regionals:_Initial_activity_tests_of_purified_fractions TTHL]), especially in regard to optimal pH and temperature effects. Additionally a [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison comparison] of all four produced laccases concerning their activity has been done. In addition an active eukaryotic laccases of ''Trametes versicolor'' was produced with a self-designed Shuttle-vector in yeast ''Pichia Pastoris''. <br />
<html><br />
</p><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/7/79/Bielefeld2012_Immosum2.jpg" /><br />
<br />
<h1>Immobilization</h1><br />
<br />
<p class="more"><br />
</html><br />
The immobilization method on CPC-beads was further optimized. It has been proved that an incubation time of 6 hours is actually enough for immobilization. Furthermore, two additional laccases were successfully immobilized: from <br />
<html><br />
</p><br />
</html><br />
:* [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] (named BHAL) and from <br />
:*[http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] (named TTHL).<br />
<html><br />
<p class="more"><br />
</html><br />
Moreover, activity tests were carried out on all four immobilized laccases (ECOL, BPUL, BHAL, and TTHL). All of them showed activity. For immobilization results see [https://2012.igem.org/Team:Bielefeld-Germany/Results/immo#Since_Regionals:_Activity_tests_of_immobilized_ECOL.2C_BPUL.2C_BHAL_and_TTHL here]<br />
<html><br />
</p><br />
</div><br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/f/fa/Bielefeld2012-Estradiol-MS-measurement.JPG" /><br />
<br />
<h1>Substrate Analysis</h1><br />
<p class="more"><br />
</html><br />
After the regional jamboree Team Activity Test, Team Immobilization and Team Substrate Analysis got laccases from the same pool from the Cultivation Team. With these laccases the degradation experiments of estradiol and ethinyl estradiol were repeated for the laccases BPUL and ECOL. The new laccases BHAL and TTHL were characterized for estradiol and ethinyl estradiol degradation too. Estradiol and ethinyl estradiol was futher analyzed on LC-MS/MS<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
For more information about the new results [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Degradation_of_estrogens click here].<br />
Possible resulting degradation products after treatment of estradiol and ethinyl estradiol with TVEL0 were further analyzed via LCMS-MS. The results are shown [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Further_analysis_.28after_Regionals_Amsterdam.29 here].<br />
<html><br />
<br />
</p> <br />
<br />
<br />
</div><br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/b/b4/Bielefeld2012_no_GFP.jpg" /><br />
<br />
<h1>Cellulose binding domain</h1><br />
<br />
<p class="more"><br />
</html><br />
A lot of efforts were made, to change the order of the fusion proteins, to change the promoter and the RBS and to insert a different linker between the cellulose binding domain and the reporter GFP, but to the last day of lab work no green glowing colony to work with and execute the binding assay could be generated.<br />
<p class="more"><br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/cbc#Since_Amsterdam">Read '''the Boston file'''</a><br />
<html><br />
</p><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/a/a5/Bielefeld2012_TVEL5_Eppis.jpg" /><br />
<br />
<h1>Shuttle vector</h1><br />
<p class="more"><br />
</html><br />
The laccase TVEL5 from ''Trametes versicolor'' was successfully cloned via the ''Aar''I restriction sites in the shuttle vector <partinfo>BBa_K863207</partinfo>. We could show that the gene of interest is integrating in yeast genome over site directed recombination and the produced protein of interest is secreted in the cultivation medium and detectable there. With this results we could show that the shuttle vector is working as expected and therefor can be used for the production of any protein of interest.<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector#Since_Regionals:_TVEL5_integrated_in_shuttle_vector For more information read here.]<br />
<html><br />
</p><br />
<br />
</div><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<script><br />
$(function() {<br />
<br />
<br />
$("#tab ul").tabs("#panesresult2 > div", {effect: 'fade', fadeOutSpeed: 400});<br />
});<br />
</script><br />
<br />
</html><br />
<br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T03:12:12Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <a href="http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29"> <i>Escherichia coli</i> BL21 (DE3)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 16). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 16). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 17). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 16:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 17:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 18:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 18). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 19:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 19). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T03:10:31Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from [http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29 <i>Escherichia coli</i> BL21 (DE3)]<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 16). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 16). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 17). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 16:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 17:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 15:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 15). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 16:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 16). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Results/SummaryTeam:Bielefeld-Germany/Results/Summary2012-10-27T03:06:43Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Results<br />
</span><br />
</div><br />
<style type="text/css"><br />
<br />
ul {<br />
list-style-image:none;<br />
}<br />
#bodyContent{<br />
background-color: white;<br />
}<br />
<br />
</style><br />
<br />
<br />
<!-- navigator --><br />
<div id="navresult" class="tabs"><br />
<div class="scroller"><br />
<ul style="list-style-type:none"><br />
<li><a href="#1"><strong>Summary</strong></a></li><br />
<li><a href="#2"><strong>Datapage</strong></a></li><br />
<li><a href="#3"><strong>Laccases</strong></a></li><br />
<li><a href="#4"><strong>Immobilization</strong></a></li><br />
<li><a href="#5"><strong>Substrate Analysis</strong></a></li><br />
<li><a href="#6"><strong>CBD</strong></a></li><br />
<li><a href="#7"><strong>Shuttle vector</strong></a></li><br />
<li><a href="#8"><strong>Collaboration with UCL</strong></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
<!-- tab panes --><br />
<div id="panesresult"><br />
<br />
<div id="anzeige"><br />
<h1>Summary</h1><br />
<br />
</html><br />
<div style="text-align:justify;"><br />
<br />
All BioBricks of the iGEM Team Bielefeld were screened to identify the best conditions for protein expression. The first trials were made by shaking flask cultivations with different parameters. These parameters were various shaking flask designs, different temperatures, different concentrations of chloramphenicol, various induction strategies, several cultivation times and some cultivations in absence or presence of CuCl<sub>2</sub>. To detect the produced laccases different analysis methods were performed like SDS-PAGE analysis as well as MALDI-TOF. The iGEM Team successfully produced four active bacterial laccases and accomplished to purify four of them. Besides the successfully scale-up fermentation these laccases could be purified in a high amount to characterize the optimal activity conditions regarding pH, temperature, buffer solutions and organic solvent resistance. Furthermore the iGEM Team Bielefeld demonstrated that the produced laccases can be immobilized maintaining their activity and the degradation capacity was screened for several micro-contaminants. These tests indicate that all of our produced laccases are able to degrade estradiol and the two laccases TTHL and BPUL are able to degrade ethinyl-estradiol in combination with an mediator. At this moment the self-designed Shuttle-vector for the production of eukaryotic laccases in yeast is ready to go. This vectors was tested to integrate by courtesy of homologues recombination genes of eukaryotic laccases into Pichia Pastoris and to produce them in an active form. First experiments shows a successful production of one laccase of ''Trametes versicolor''. A cheap alternative purification and immobilization method via a cellulose binding tag is also close at hand. During our research we cultivated the following BioBricks and produced several laccase. To simplify the presentation of our results we named the produced laccase like the following system.<br />
<br />
</div><br />
{| class="wikitable"<br />
!colspan="5"|Produced and generated BioBricks with the source strain of the DNA-sequence, promoter, protein name and the names given by the iGEM Team Bielefeld<br />
|-<br />
|BioBrick code<br />
|strain<br />
|promoter<br />
|name of protein <br />
|name given by the iGEM Team<br />
|-<br />
|<partinfo>K863000</partinfo><br />
|''Bacillus pumilus'' DSM 27 <br />
|T7 promoter<br />
|align="center"|CotA<br />
|align="center"|'''BPUL'''<br />
|-<br />
|<partinfo>K863005</partinfo><br />
|''E. coli'' BL21(DE3)<br />
| T7 promoter<br />
|align="center"|CueO<br />
|align="center"|'''ECOL'''<br />
|-<br />
| <partinfo>K863010</partinfo><br />
|''Thermus thermophilus'' HB27<br />
| T7 promoter<br />
|align="center"|tthL<br />
|align="center"|'''TTHL'''<br />
|-<br />
| <partinfo>K863012</partinfo><br />
|''Thermus thermophilus'' HB27<br />
| constitutive promoter (<partinfo>BBa_J23100</partinfo>)<br />
|align="center"|tthL<br />
|align="center"|'''TTHL'''<br />
|-<br />
| <partinfo>K863015</partinfo><br />
| ''Xanthomonas campestris pv. campestris'' B100<br />
|T7 <br />
|align="center"|CopA<br />
|align="center"|'''XCCL'''<br />
|-<br />
|<partinfo>K863020</partinfo><br />
|''Bacillus halodurans'' C-125<br />
|T7<br />
|align="center"|Lbh1<br />
|align="center"|'''BHAL'''<br />
|-<br />
|<partinfo>K863022</partinfo><br />
|''Bacillus halodurans'' C-125<br />
| constitutive promoter (<partinfo>BBa_J23100</partinfo>)<br />
|align="center"|Lbh1<br />
|align="center"|'''BHAL'''<br />
|-<br />
| <partinfo>K863030</partinfo><br />
|''Trametes versicolor '' <br />
| AOX1 promoter<br />
|align="center"|TVL5<br />
|align="center"|'''TVEL5'''<br />
|-<br />
|}<br />
<br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div id="anzeige"><br />
<img src="https://static.igem.org/mediawiki/2012/3/3e/Bielefeld2012_Overview.jpg" /><br />
<h1>Datapage</h1><br />
<p class="more"><br />
</html><br />
iGEM Team Bielefeld is developing a biological filter using immobilized laccases, enzymes able to radicalize and break down a broad range of aromatic substances. For the production of laccases from different bacteria, fungi and plants, two expression systems are used: ''Escherichia coli'' and the yeast ''Pichia pastoris''. Immobilization is carried out either by using CPC-silica beads or by fusing the enzymes to cellulose binding domains. The concept could be extended to other toxic pollutants in drinking and wastewater, as well as to industrial applications in paper and textile industries or even for bioremediation of contaminated soil. <br />
<p class="more"><br />
[https://2012.igem.org/Team:Bielefeld-Germany/Results/Datapage Read more.]<br />
</p><br />
<html><br />
</p><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg" /> <br />
<br />
<h1>Laccases</h1><br />
<p class="more"><br />
</html><br />
The iGEM Team successfully produced four active bacterial laccases and an eukaryotic laccase (click for the results):<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/coli ''Escherichia coli'' laccase ECOL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi''Bacillus pumilus'' laccase BPUL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo''Bacillus halodurans'' laccase BHAL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo ''Thermus thermophilus'' laccase TTHL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 ''Trametes versicolor'' laccase TVEL5]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison Comparison of the different laccases]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/trametis Purchased positive control ''Trametes versicolor'' laccaseTVEL0]<br />
<html><br />
<p class="more"><br />
</html><br />
All bacterial laccases (ECOL, BHAL, TTHL and BPUL) we accomplished to purify. Besides the successfully scale-up fermentation these laccases could be purified in a high amount to characterize the optimal activity conditions regarding pH, temperature, buffer solutions and organic solvent resistance. Furthermore the iGEM Team Bielefeld demonstrated that the produced laccases can be immobilized maintaining their activity and the degradation capacity was screened for several micro-contaminants. These tests indicate that they are able to degrade estradiol and ethinyl-estradiol.<br />
<html><br />
</p><br />
</p><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/2/25/Bielefeld2012_Immo.jpeg" /><br />
<br />
<h1>Immobilization</h1><br />
<br />
<p class="more"><br />
</html><br />
'''Using commercially acquired laccases from ''Trametes versicolor'' (named TVEL0) as a standard, it was possible to optimize an immobilization method of the purified laccases from<br />
<html><br />
</p><br />
</html><br />
:* [http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29 ''E. coli'' BL21 (DE3)] (named ECOL)<br />
:* [http://www.dsmz.de/catalogues/details/culture/DSM-27.html ''Bacillus pumilus'' DSM 27 (ATCC7061)] (named BPUL)<br />
:* [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] (named BHAL) and from <br />
:* [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] (named TTHL)<br />
<br />
<html><br />
<p class="more"><br />
</html><br />
on CPC-silica beads. All four purified laccases were successfully immobilized, with ECOL and BPUL showing the highest binding ability to beads. Moreover, all four immobilized laccases showed activity. Whereas immobilized BPUL showed a relatively high activity, the results couldn't be compared to BHAL und TTHL due to the low concentration of the latters. ''' For immobilization results see [https://2012.igem.org/Team:Bielefeld-Germany/Results/immo here]<br />
<html><br />
</p><br />
</div><br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/a/a7/Bielefeld2012-estradiol-control-spectroflurophotometer.JPG" /><br />
<br />
<h1>Substrate Analysis</h1><br />
<br />
</html><br />
<p class="more"><br />
To establish the methods for degradation analysis of different substrates TVEL0 was used as positive control. <br />
After that the four produced bacterial laccases were analyzed. The HPLC results showed that estradiol and ethinyl estradiol ( with addition of ABTS) are degradable with our laccases.To determine degradation products of estradiol and ethinyl estradiol after laccase treatment LCMS-MS analysis were done. For more informations [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate click here].<br />
</p><br />
<html><br />
<br />
</p> <br />
<br />
<br />
</div><br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/6/6d/Bielefeld2012_GFP.jpg" /><br />
<br />
<h1>Cellulose binding domain</h1><br />
<br />
<p class="more"><br />
</html><br />
A cheap alternative purification method combined with a powerful immobilization tool could be the solution to prevail over other more expensive water cleaning methods like oxidization with ozone or using tons of activated carbon which just capture microcontaminates, but does not dismantle them. A promising solution to this could be cellulose binding domains (CBDs). Cellulose is ubiquitous and sustainable. Following this idea fusion-protein-constructs with cellulose binding domains have been made. To characterize a GFP has been introduced as a C or N-terminal domain of the cellulose binding protein. After delays in cloning the constructs for two fusion proteins with a T7-promoter could be finished, but did not express the protein in ''E. coli'' KRX and BL21. An alternative construct with a constitutive promoter could also be finished, but gave the same results. Changing the order of CBD and GFP was carried out, but was hampered by a base deletion in the GFP gene causing a frame shift and could not be redone in time.<br />
<p class="more"><br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/cbc">Read more</a><br />
<html><br />
</p><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/17/Bielefeld2012_PECPP11JS.JPG" /><br />
<br />
<h1>Shuttle vector</h1><br />
<p class="more"><br />
</html><br />
A shuttle vector for site-directed recombination into the yeast ''P. pastoris'' does not exist in the parts registry and could be developed by our team. With this system it is possible to recombine a protein of interest with a N-terminal mating factor alpha 1 for secretion the protein into the media. This protein of interest could be cloned in frame with one restriction ligate cloning step. The selection depends not on an antibiotic resistance like zeocine, but on a complementation of histidine auxotrophy. This system is for us important because some of our laccases can not be expressed in the prokaryotic expression system ''E. coli'', because the protein needs glycosylation.<br />
[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector Read more.]<br />
</p><br />
<html><br />
<br />
</p> <br />
</div><br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/5/56/Bielefeld2012_UCL.jpg" /><br />
<br />
<h1>Collaboration with UCL</h1><br />
<p class="more"><br />
<br />
</html><br />
The BioBrick [http://partsregistry.org/wiki/index.php?title=Part:BBa_K729006 BBa_K729006] from the [https://2012.igem.org/Team:University_College_London University&nbsp;College&nbsp;London] was characterized by us. Therefore ''E. coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K729006 BBa_K729006] and ''E. coli'' KRX as a negative control were cultivated in shaking flasks and a growth kinetic was determined. The harvested cells were lysed via sonication and substances with a low molecular weight were seperated out of the supernatant. After purification the sample was analyzed by SDS-PAGE and MALDI-TOF.<br />
For a comparison ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K7863005] was cultivated and analysed by SDS-PAGE as well as tested with a laccase activity assay. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K729006 BBa_K729006] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K7863005] showed a similar behaviour in oxidizing ABTS.<br />
[https://2012.igem.org/Team:Bielefeld-Germany/Results/london Read more.]<br />
<html><br />
</p><br />
</div> <br />
</div><br />
<br />
<br />
<br />
<br />
<script><br />
$(function() {<br />
<br />
<br />
$("#navresult ul").tabs("#panesresult > div", {effect: 'fade', fadeOutSpeed: 400});<br />
});<br />
</script><br />
<br />
</html><br />
<br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Results/SummaryTeam:Bielefeld-Germany/Results/Summary2012-10-27T03:03:54Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Results<br />
</span><br />
</div><br />
<style type="text/css"><br />
<br />
ul {<br />
list-style-image:none;<br />
}<br />
#bodyContent{<br />
background-color: white;<br />
}<br />
<br />
</style><br />
<br />
<br />
<!-- navigator --><br />
<div id="navresult" class="tabs"><br />
<div class="scroller"><br />
<ul style="list-style-type:none"><br />
<li><a href="#1"><strong>Summary</strong></a></li><br />
<li><a href="#2"><strong>Datapage</strong></a></li><br />
<li><a href="#3"><strong>Laccases</strong></a></li><br />
<li><a href="#4"><strong>Immobilization</strong></a></li><br />
<li><a href="#5"><strong>Substrate Analysis</strong></a></li><br />
<li><a href="#6"><strong>CBD</strong></a></li><br />
<li><a href="#7"><strong>Shuttle vector</strong></a></li><br />
<li><a href="#8"><strong>Collaboration with UCL</strong></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
<!-- tab panes --><br />
<div id="panesresult"><br />
<br />
<div id="anzeige"><br />
<h1>Summary</h1><br />
<br />
</html><br />
<div style="text-align:justify;"><br />
<br />
All BioBricks of the iGEM Team Bielefeld were screened to identify the best conditions for protein expression. The first trials were made by shaking flask cultivations with different parameters. These parameters were various shaking flask designs, different temperatures, different concentrations of chloramphenicol, various induction strategies, several cultivation times and some cultivations in absence or presence of CuCl<sub>2</sub>. To detect the produced laccases different analysis methods were performed like SDS-PAGE analysis as well as MALDI-TOF. The iGEM Team successfully produced four active bacterial laccases and accomplished to purify four of them. Besides the successfully scale-up fermentation these laccases could be purified in a high amount to characterize the optimal activity conditions regarding pH, temperature, buffer solutions and organic solvent resistance. Furthermore the iGEM Team Bielefeld demonstrated that the produced laccases can be immobilized maintaining their activity and the degradation capacity was screened for several micro-contaminants. These tests indicate that all of our produced laccases are able to degrade estradiol and the two laccases TTHL and BPUL are able to degrade ethinyl-estradiol in combination with an mediator. At this moment the self-designed Shuttle-vector for the production of eukaryotic laccases in yeast is ready to go. This vectors was tested to integrate by courtesy of homologues recombination genes of eukaryotic laccases into Pichia Pastoris and to produce them in an active form. First experiments shows a successful production of one laccase of ''Trametes versicolor''. A cheap alternative purification and immobilization method via a cellulose binding tag is also close at hand. During our research we cultivated the following BioBricks and produced several laccase. To simplify the presentation of our results we named the produced laccase like the following system.<br />
<br />
</div><br />
{| class="wikitable"<br />
!colspan="5"|Produced and generated BioBricks with the source strain of the DNA-sequence, promoter, protein name and the names given by the iGEM Team Bielefeld<br />
|-<br />
|BioBrick code<br />
|strain<br />
|promoter<br />
|name of protein <br />
|name given by the iGEM Team<br />
|-<br />
|<partinfo>K863000</partinfo><br />
|''Bacillus pumilus'' DSM 27 <br />
|T7 promoter<br />
|align="center"|CotA<br />
|align="center"|'''BPUL'''<br />
|-<br />
|<partinfo>K863005</partinfo><br />
|''E. coli'' BL21(DE3)<br />
| T7 promoter<br />
|align="center"|CueO<br />
|align="center"|'''ECOL'''<br />
|-<br />
| <partinfo>K863010</partinfo><br />
|''Thermus thermophilus'' HB27<br />
| T7 promoter<br />
|align="center"|tthL<br />
|align="center"|'''TTHL'''<br />
|-<br />
| <partinfo>K863012</partinfo><br />
|''Thermus thermophilus'' HB27<br />
| constitutive promoter (<partinfo>BBa_J23100</partinfo>)<br />
|align="center"|tthL<br />
|align="center"|'''TTHL'''<br />
|-<br />
| <partinfo>K863015</partinfo><br />
| ''Xanthomonas campestris pv. campestris'' B100<br />
|T7 <br />
|align="center"|CopA<br />
|align="center"|'''XCCL'''<br />
|-<br />
|<partinfo>K863020</partinfo><br />
|''Bacillus halodurans'' C-125<br />
|T7<br />
|align="center"|Lbh1<br />
|align="center"|'''BHAL'''<br />
|-<br />
|<partinfo>K863022</partinfo><br />
|''Bacillus halodurans'' C-125<br />
| constitutive promoter (<partinfo>BBa_J23100</partinfo>)<br />
|align="center"|Lbh1<br />
|align="center"|'''BHAL'''<br />
|-<br />
| <partinfo>K863030</partinfo><br />
|''Trametes versicolor '' <br />
| AOX1 promoter<br />
|align="center"|TVL5<br />
|align="center"|'''TVEL5'''<br />
|-<br />
|}<br />
<br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div id="anzeige"><br />
<img src="https://static.igem.org/mediawiki/2012/3/3e/Bielefeld2012_Overview.jpg" /><br />
<h1>Datapage</h1><br />
<p class="more"><br />
</html><br />
iGEM Team Bielefeld is developing a biological filter using immobilized laccases, enzymes able to radicalize and break down a broad range of aromatic substances. For the production of laccases from different bacteria, fungi and plants, two expression systems are used: ''Escherichia coli'' and the yeast ''Pichia pastoris''. Immobilization is carried out either by using CPC-silica beads or by fusing the enzymes to cellulose binding domains. The concept could be extended to other toxic pollutants in drinking and wastewater, as well as to industrial applications in paper and textile industries or even for bioremediation of contaminated soil. <br />
<p class="more"><br />
[https://2012.igem.org/Team:Bielefeld-Germany/Results/Datapage Read more.]<br />
</p><br />
<html><br />
</p><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg" /> <br />
<br />
<h1>Laccases</h1><br />
<p class="more"><br />
</html><br />
The iGEM Team successfully produced four active bacterial laccases and an eukaryotic laccase (click for the results):<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/coli ''Escherichia coli'' laccase ECOL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi''Bacillus pumilus'' laccase BPUL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo''Bacillus halodurans'' laccase BHAL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo ''Thermus thermophilus'' laccase TTHL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 ''Trametes versicolor'' laccase TVEL5]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison Comparison of the different laccases]<br />
<html><br />
<p class="more"><br />
</html><br />
All bacterial laccases (ECOL, BHAL, TTHL and BPUL) we accomplished to purify. Besides the successfully scale-up fermentation these laccases could be purified in a high amount to characterize the optimal activity conditions regarding pH, temperature, buffer solutions and organic solvent resistance. Furthermore the iGEM Team Bielefeld demonstrated that the produced laccases can be immobilized maintaining their activity and the degradation capacity was screened for several micro-contaminants. These tests indicate that they are able to degrade estradiol and ethinyl-estradiol.<br />
<html><br />
</p><br />
</p><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/2/25/Bielefeld2012_Immo.jpeg" /><br />
<br />
<h1>Immobilization</h1><br />
<br />
<p class="more"><br />
</html><br />
'''Using commercially acquired laccases from ''Trametes versicolor'' (named TVEL0) as a standard, it was possible to optimize an immobilization method of the purified laccases from<br />
<html><br />
</p><br />
</html><br />
:* ''E. coli'' BL21 (DE3) (named ECOL)<br />
:* [http://www.dsmz.de/catalogues/details/culture/DSM-27.html ''Bacillus pumilus'' DSM 27 (ATCC7061)] (named BPUL)<br />
:* [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] (named BHAL) and from <br />
:* [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] (named TTHL)<br />
<br />
<html><br />
<p class="more"><br />
</html><br />
on CPC-silica beads. All four purified laccases were successfully immobilized, with ECOL and BPUL showing the highest binding ability to beads. Moreover, all four immobilized laccases showed activity. Whereas immobilized BPUL showed a relatively high activity, the results couldn't be compared to BHAL und TTHL due to the low concentration of the latters. ''' For immobilization results see [https://2012.igem.org/Team:Bielefeld-Germany/Results/immo here]<br />
<html><br />
</p><br />
</div><br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/a/a7/Bielefeld2012-estradiol-control-spectroflurophotometer.JPG" /><br />
<br />
<h1>Substrate Analysis</h1><br />
<br />
</html><br />
<p class="more"><br />
To establish the methods for degradation analysis of different substrates TVEL0 was used as positive control. <br />
After that the four produced bacterial laccases were analyzed. The HPLC results showed that estradiol and ethinyl estradiol ( with addition of ABTS) are degradable with our laccases.To determine degradation products of estradiol and ethinyl estradiol after laccase treatment LCMS-MS analysis were done. For more informations [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate click here].<br />
</p><br />
<html><br />
<br />
</p> <br />
<br />
<br />
</div><br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/6/6d/Bielefeld2012_GFP.jpg" /><br />
<br />
<h1>Cellulose binding domain</h1><br />
<br />
<p class="more"><br />
</html><br />
A cheap alternative purification method combined with a powerful immobilization tool could be the solution to prevail over other more expensive water cleaning methods like oxidization with ozone or using tons of activated carbon which just capture microcontaminates, but does not dismantle them. A promising solution to this could be cellulose binding domains (CBDs). Cellulose is ubiquitous and sustainable. Following this idea fusion-protein-constructs with cellulose binding domains have been made. To characterize a GFP has been introduced as a C or N-terminal domain of the cellulose binding protein. After delays in cloning the constructs for two fusion proteins with a T7-promoter could be finished, but did not express the protein in ''E. coli'' KRX and BL21. An alternative construct with a constitutive promoter could also be finished, but gave the same results. Changing the order of CBD and GFP was carried out, but was hampered by a base deletion in the GFP gene causing a frame shift and could not be redone in time.<br />
<p class="more"><br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/cbc">Read more</a><br />
<html><br />
</p><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/17/Bielefeld2012_PECPP11JS.JPG" /><br />
<br />
<h1>Shuttle vector</h1><br />
<p class="more"><br />
</html><br />
A shuttle vector for site-directed recombination into the yeast ''P. pastoris'' does not exist in the parts registry and could be developed by our team. With this system it is possible to recombine a protein of interest with a N-terminal mating factor alpha 1 for secretion the protein into the media. This protein of interest could be cloned in frame with one restriction ligate cloning step. The selection depends not on an antibiotic resistance like zeocine, but on a complementation of histidine auxotrophy. This system is for us important because some of our laccases can not be expressed in the prokaryotic expression system ''E. coli'', because the protein needs glycosylation.<br />
[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector Read more.]<br />
</p><br />
<html><br />
<br />
</p> <br />
</div><br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/5/56/Bielefeld2012_UCL.jpg" /><br />
<br />
<h1>Collaboration with UCL</h1><br />
<p class="more"><br />
<br />
</html><br />
The BioBrick [http://partsregistry.org/wiki/index.php?title=Part:BBa_K729006 BBa_K729006] from the [https://2012.igem.org/Team:University_College_London University&nbsp;College&nbsp;London] was characterized by us. Therefore ''E. coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K729006 BBa_K729006] and ''E. coli'' KRX as a negative control were cultivated in shaking flasks and a growth kinetic was determined. The harvested cells were lysed via sonication and substances with a low molecular weight were seperated out of the supernatant. After purification the sample was analyzed by SDS-PAGE and MALDI-TOF.<br />
For a comparison ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K7863005] was cultivated and analysed by SDS-PAGE as well as tested with a laccase activity assay. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K729006 BBa_K729006] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K7863005] showed a similar behaviour in oxidizing ABTS.<br />
[https://2012.igem.org/Team:Bielefeld-Germany/Results/london Read more.]<br />
<html><br />
</p><br />
</div> <br />
</div><br />
<br />
<br />
<br />
<br />
<script><br />
$(function() {<br />
<br />
<br />
$("#navresult ul").tabs("#panesresult > div", {effect: 'fade', fadeOutSpeed: 400});<br />
});<br />
</script><br />
<br />
</html><br />
<br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/ResultsTeam:Bielefeld-Germany/Amsterdam/Results2012-10-27T02:56:20Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Results since Regionals<br />
</span><br />
</div><br />
<style type="text/css"><br />
<br />
ul {<br />
list-style-image:none;<br />
}<br />
#bodyContent{<br />
background-color: white;<br />
}<br />
<br />
</style><br />
<br />
<br />
<!-- navigator --><br />
<div id="tab"><br />
<br />
<ul style="list-style-type:none"><br />
<li><a href="#1"><strong>Summary</strong></a></li><br />
<li><a href="#2"><strong>Laccases</strong></a></li><br />
<li><a href="#3"><strong>Immobilization</strong></a></li><br />
<li><a href="#4"><strong>Substrate Analysis</strong></a></li><br />
<li><a href="#5"><strong>CBD</strong></a></li><br />
<li><a href="#6"><strong>Shuttle vector</strong></a></li><br />
</ul><br />
</div><br />
<br />
<br />
<!-- tab panes --><br />
<div id="panesresult"><br />
<br />
<div id="anzeige"><br />
<h1>Summary</h1><br />
<br />
</html><br />
coming soon<br />
<br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg" /> <br />
<br />
<h1>Laccases</h1><br />
<p class="more"><br />
</html><br />
The iGEM Team successfully produced four active bacterial laccases and an eukaryotic laccase (click for the results):<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/coli ''Escherichia coli'' laccase ECOL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi''Bacillus pumilus'' laccase BPUL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo''Bacillus halodurans'' laccase BHAL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo ''Thermus thermophilus'' laccase TTHL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 ''Trametes versicolor'' laccase TVEL5]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison Comparison of the different laccases]<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
All bacterial laccases ([https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Since_Regionals:_12.C2.A0L_Fermentation_E._coli_KRX_with_BBa_K863005 ECOL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Since_Regionals:_12.C2.A0L_Fermentation_E..C2.A0coli_KRX_with_BBa_K863000 BPUL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Since_Regionals:_12L_Fermentation_of_E._coli_Rosetta-Gami_2_with_BBa_K863022 BHAL] and [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Since_Regionals:_12_L_Fermentation_of_E._coli_Rosetta_Gami_2_with_BBa_K863012 TTHL]) were successfully scaled-up to a working volume of 12 L. Additional a optimized medium was chosen in the hope to enhance the protein amount. Activity assays were done for all four laccases ([https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Initial_activity_tests_of_purified_fractions ECOL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Since_Regionals:_Initial_activity_tests_of_purified_fractions BPUL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Since_Regionals:_Initial_activity_tests_of_purified_fractions BHAL] and [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Since_Regionals:_Initial_activity_tests_of_purified_fractions TTHL]), especially in regard to optimal pH and temperature effects. Additionally a [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison comparison] of all four produced laccases concerning their activity has been done. In addition an active eukaryotic laccases of ''Trametes versicolor'' was produced with a self-designed Shuttle-vector in yeast ''Pichia Pastoris''. <br />
<html><br />
</p><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/2/25/Bielefeld2012_Immo.jpeg" /><br />
<br />
<h1>Immobilization</h1><br />
<br />
<p class="more"><br />
</html><br />
The immobilization method on CPC-beads was further optimized. It has been proved that an incubation time of 6 hours is actually enough for immobilization. Furthermore, two additional laccases were successfully immobilized: from <br />
<html><br />
</p><br />
</html><br />
:* [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] (named BHAL) and from <br />
:*[http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] (named TTHL).<br />
<html><br />
<p class="more"><br />
Moreover, activity tests were carried out on all four immobilized laccases (ECOL, BPUL, BHAL, and TTHL). All of them showed activity. <br />
For immobilization results see [https://2012.igem.org/Team:Bielefeld-Germany/Results/immo/Since_Regionals:_Activity_tests_of_immobilized_ECOL.2C_BPUL.2C_BHAL_and_TTHL here]<br />
<br />
<html><br />
</p><br />
</div><br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/f/fa/Bielefeld2012-Estradiol-MS-measurement.JPG" /><br />
<br />
<h1>Substrate Analysis</h1><br />
<p class="more"><br />
</html><br />
After the regional jamboree Team Activity Test, Team Immobilization and Team Substrate Analysis got laccases from the same pool from the Cultivation Team. With these laccases the degradation experiments of estradiol and ethinyl estradiol were repeated for the laccases BPUL and ECOL. The new laccases BHAL and TTHL were characterized for estradiol and ethinyl estradiol degradation too. Estradiol and ethinyl estradiol was futher analyzed on LC-MS/MS<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
For more information about the new results [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Degradation_of_estrogens click here].<br />
Possible resulting degradation products after treatment of estradiol and ethinyl estradiol with TVEL0 were further analyzed via LCMS-MS. The results are shown [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Further_analysis_.28after_Regionals_Amsterdam.29 here].<br />
<html><br />
<br />
</p> <br />
<br />
<br />
</div><br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/b/b4/Bielefeld2012_no_GFP.jpg" /><br />
<br />
<h1>Cellulose binding domain</h1><br />
<br />
<p class="more"><br />
</html><br />
A lot of efforts were made, to change the order of the fusion proteins, to change the promoter and the RBS and to insert a different linker between the cellulose binding domain and the reporter GFP, but to the last day of lab work no green glowing colony to work with and execute the binding assay could be generated.<br />
<p class="more"><br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/cbc#Since_Amsterdam">Read '''the Boston file'''</a><br />
<html><br />
</p><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/17/Bielefeld2012_PECPP11JS.JPG" /><br />
<br />
<h1>Shuttle vector</h1><br />
<p class="more"><br />
</html><br />
The laccase TVEL5 from ''Trametes versicolor'' was successfully cloned via the ''Aar''I restriction sites in the shuttle vector <partinfo>BBa_K863207</partinfo>. We could show that the gene of interest is integrating in yeast genome over site directed recombination and the produced protein of interest is secreted in the cultivation medium and detectable there. With this results we could show that the shuttle vector is working as expected and therefor can be used for the production of any protein of interest.<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector#Since_Regionals:_TVEL5_integrated_in_shuttle_vector For more information read here.]<br />
<html><br />
</p><br />
<br />
</div><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<script><br />
$(function() {<br />
<br />
<br />
$("#tab ul").tabs("#panesresult > div", {effect: 'fade', fadeOutSpeed: 400});<br />
});<br />
</script><br />
<br />
</html><br />
<br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Results/immoTeam:Bielefeld-Germany/Results/immo2012-10-27T02:53:54Z<p>Mo: /* Immobilization of purified ECOL, BPUL, BHAL and TTHL and Activity Tests */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#4"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Immobilization<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
<br />
<br />
</html><br />
__TOC__<br />
<br />
<div style="text-align:justify;"><br />
==First Approach==<br />
<br />
<br />
[[File:Bielefeld2012-Overview_Immobilization.jpg|400px|right|thumb|'''Fig. 1: Immobilization of laccases on CPC-beads.''' Using glutaraldehyde as a crosslinker, laccases can covalently bind to CPC-beads. ]]<br />
<br />
The initial step was to find out a convenient method of immobilization using commercially acquired laccases from ''Trametes versicolor'' (named TVEL0) as a standard. The first alternative was the use of silica dioxide beads from the lab. Different bead concentrations were used (ratio 1:500, 1:1000 and 1:1500) and different buffers (HBSS buffer, recrystallization buffer and Britton-Robinson buffer). However, no significant activity could be detected. Hence, it was agreed to try out CPC-(controlled pore carrier) silica beads, to which laccases covalently bind, especially that some papers provide protocols and activity tests which prove the efficiency of these beads (see Fig. 1).<br />
<br />
<br style="clear: both" /><br />
<br />
== Immobilization Strategy and Optimization of CPC-beads: ==<br />
<br />
<br />
In order to identify the best conditions for TVEL0, different bead concentrations: 0.01, 0.02, 0.04, 0.06, and 0.08 g mL<sup>-1</sup>, as well as different incubation time periods: 18 h and 36 h were examined. Britton-Robinson buffer (pH 5) was used, since TVEL0 showed the highest activity in pH 5. The beads were first immersed in 2.5 % glutaraldehyde and incubated for two hours under light vacuum in order to allow as much beads’ surface area to be coated with aldehyde groups, which crosslink the laccases to the beads. After that, the beads were washed 3 times with [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials Britton-Robinson Buffer] and then immersed in 1mg mL<sup>-1</sup> laccases from TVEL0 and placed on a rotator at 4 °C for 18 h and 36 h respectively. These time periods were selected according to different protocols describing this immobilization method. After incubation, the supernatants were gathered to be tested for laccase activity. The beads were then washed with [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials Britton-Robinson Buffer], then with 0.5 M NaCl solution in order to wash away all noncovalently bound laccases and again twice with the same buffer. Subsequently, the beads were immersed in 2.5 mg <sup>-1</sup> glycine for 18 h at 4 °C. Finally, the beads were rinsed again with [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials Britton-Robinson Buffer], then with 0.5 M NaCl solution and again twice with the same buffer.<br />
<br />
To figure out the amount of protein bound to the beads after several incubation periods of time, the protein concentration in the supernatant was measured using Roti®-Nanoquant. After comparing the results, it was noticeable that after 10 hours, the maximum amount of bound proteins to beads could be achieved (see Fig. 2). This remained relatively constant over the remaining incubation period, although an incubation time of at least 18 hours was recommended in all protocols. Therefore, another experiment was carried out to test the protein binding within the first 10 hours. The results showed that 6 hours were actually enough to reach a maximum binding (see Fig. 3). <br />
<br />
[[File:Bielefeld2012-Malak-Incubation_time_alt.jpg|400px|left|thumb|'''Fig. 2: The mass of bound TVEL0 to beads (µg TVEL0/g beads) over different incubation periods of time.''' The maximum protein binding to laccases is already achieved after an incubation period of 10 hours.]]<br />
<br />
[[File:Bielefeld2012-Malak-Zeitverlauf_neu.jpg|400px|right|thumb|'''Fig. 3: The mass of bound TVEL0 to beads (µg TVEL0/g beads) over different incubation periods of time.''' After 6 hours incubation, a maximum protein binding to laccases is achieved.]]<br />
<br style="clear: both" /> <br />
<br />
On the other hand, the activity of the nonbound laccases present in the supernatant was measured using [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics ABTS as substrate] to find out the most convenient bead concentration. According to the results, the activity decreased upon increasing the concentration of the beads without reaching a saturation level (see Fig. 4). Therefore, another experiment was carried out with higher bead concentrations. The same experiment was carried out with the following bead concentrations: 0.06, 0.08, 0.1, 0.12, 0.14 and 0.16 g mL<sup>-1</sup>. Based on the results of the previous experiment, the samples were incubated with 1 mg mL<sup>-1</sup> TVEL0 for 36 h.<br />
The results showed no significant change in the laccase activity upon increasing the concentration of beads above 0.06 g ml<sup>-1</sup> (see Fig. 5), a saturation level has been achieved. <br />
<br />
[[Image:Bielefeld2012Malak2Graf.jpg|400px|left|thumb|'''Fig. 4: Enzymatic activity of TVEL0 supernatant gathered after immobilization with different bead concentrations (ranging from 0.01 to 0.08 g mL<sup>-1</sup>), measured using 0.1 mM ABTS at 25 °C over a time period of 5 minutes.''' The graph shows a decreasing laccase activity with increasing bead concentrations, which indicates that the higher the bead concentration, the more laccases immobilized.]]<br />
<br />
[[Image:Bielefeld2012Malak22Graf.jpg|400px|right|thumb|'''Fig 5: Enzymatic activity of TVEL0 supernatant gathered after immobilization with different bead concentrations (ranging from 0.06 to 0.16 g mL<sup>-1</sup>), measured using 0.1 mM ABTS at 25 °C over a time period of five minutes.''' The graph shows no significant change in the laccase activity with increasing bead concentration; a saturation level has been achieved.]]<br />
<br style="clear: both" /> <br />
<br />
Since the activity of laccases can be affected by other conditions and can not be directly correlated to protein binding, another immobilization experiment was carried out and the protein concentration was measured using Roti®-Nanoquant. Again different bead concentrations were used: 0.08, 0.1, 0.12 and 0.14 g/ml. In order to determine the optimal ratio of CPC-beads to protein, the binding capacity (Bc) was determined as follows:<br />
<br />
[[File:Bielefeld2012_Immobilisierung_bindingcapacity.jpg|150px|center]]<br />
<br />
<br style="clear: both" /> <br />
<br />
<br />
The results were almost consistent with the activity tests performed previously. The most convenient bead concentration was 0.12 g mL<sup>-1</sup> (see Fig.6).<br />
<br />
However, as expected, it was not possible to measure the activity of laccases bound to beads using the Tecan. The beads were probably disturbing the Tecan’s laser, and centrifugation wasn´t an option because it would have simply taken too long and wouldn’t stop the reaction at a precise point of time. Therefore, multi-well membrane-bottom filter plates were considered to be a solution. These plates work in a similar way to the regular plates used for the Tecan but furthermore they contain a membrane that sieves the liquid through the filter. Thus the beads are separated and the ABTS buffer solution can be analyzed at 420 nm for oxidized ABTS.<br />
<br />
The ability of the “multi-well membrane-bottom filter plates” to measure the activity of laccases bound to beads was tested with TVEL0 laccases. The results were promising (for further information see labjournal).<br />
Subsequently, after receiving the laccases purified from ''E. coli'' BL21 (DE3) (named ECOL), the same procedures were followed to optimize the best conditions. However, the activity was measured over a longer period of time (35 min). The results indicated a similar behavior of ECOL to TVEL0 (see Fig. 7). Consequently, the same approach was followed for the immobilization of the next laccases.<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld2012-Malak-Beadconcentration_Bc.jpg|350px|left|thumb|'''Fig. 6: The binding capacity of TVEL0 to different CPC-beads concentration.''' The highest capacity is achieved with a bead concentration of 0.12 g mL<sup>-1</sup>.]]<br />
[[Image:Bielefeld2012-Malak-Konz-Optimierung.jpg|350px|right|thumb|'''Fig. 7: Enzymatic activity of ECOL supernatant gathered after immobilization with different bead concentrations, measured using 0.1 mM ABTS at 25 °C over a time period of 30 minutes.''' The graph shows no significant change in the laccase activity with increasing bead concentration; a saturation level has been achieved. The behavior is similar to that of TVEL0 (see Fig. 4).]]<br />
<br style="clear: both" /><br />
<br />
==Immobilization of purified ECOL, BPUL, BHAL and TTHL and Activity Tests==<br />
<br />
After optimizing the immobilization conditions for TVEL0 and ECOL, and proving their ability to bind to beads and preserve part of their activity, it was interesting to find out the percentage of laccases that bind to the beads, as well as the activity preserved by these laccases. <br />
<br />
Accordingly, an immobilization experiment was carried out using TVEL0, ECOL, purified laccases from ''Escherichia coli'' BL21 DE3 (named ECOL), [http://www.dsmz.de/catalogues/details/culture/DSM-27.html|thumb|300px|left| ''Bacillus pumilus'' DSM 27 (ATCC7061)] (named BPUL), [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] (named BHAL) and from [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] (named TTHL) with a bead concentration of 0.12 g and over an incubation period of 14 hours. <br />
The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The percentage of bound laccases relative to the original concentration is presented in Fig. 8. <br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|350px|thumb|right|'''Fig. 8: The percentage of laccases immobilized to CPC-Beads.''' 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
The results showed that the four different purified laccases bind very well to the beads. ECOL and BPUL were perfectly immobilized (99% and 97% respectively) and showed a higher binding ability than the standard laccase TVEL0. 79 % of BHAL and TTHL could be immobilized on the CPC-beads. <br />
<br />
After the successful immobilization, the second step was to test the activity of the immobilized laccases. The activity of laccases in the supernatant was also measured using [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics ABTS as substrate] and compared to the activity of nontreated laccases (Fig. 9-11). The results show that TVEL0 almost preserve their activity in the supernatant, whereas the activity of ECOL dramatically decreases compared to a slight decrease in the activity of BPUL. <br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld2012_trametes.jpg|400px|thumb|left|'''Fig. 9: Enzymatic activity of TVEL0 supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25 °C over a time period of 40 minutes.''' The results show that TVEL0 almost preserve their activity in the supernatant.]]<br />
[[File:Bielefeld2012_ecoli.jpg|400px|thumb|'''Fig. 10: Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25 °C over a time period of 12 hours.''' The results show a dramatic decrease of ECOL in the supernatant.]]<br />
[[File:Bielefeld2012_bpumi.jpg|400px|thumb|left|'''Fig. 11: Enzymatic activity of BPUL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25 °C over a time period of 12 hours.''' The results show a slight decrease in the activity of BPUL in the supernatant.]]<br />
<br />
[[File:Bielefeld2012-Immob.jpg|400px|right|thumb|'''Fig. 12: Percentage of specific enzyme activity of immobilized BPUL and ECOL relative to the nonimmobilized laccases.''' Immobilized BPUL preserved 44 % of its activity, whereas ECOL didn't show a significant activity after immobilization.]]<br />
<br style="clear: both" /><br />
On the other hand, the specific enzyme activity of immobilized laccases from ECOL and BPUL was also measured using [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics ABTS as substrate] and compared to that of nonimmobilized laccases (Fig. 12). The results showed that immobilized BPUL preserved 44 % of its activity, whereas ECOL didn't show a significant activity after immobilization.<br />
<br style="clear: both" /><br />
<br />
== Since Regionals: Activity tests of immobilized ECOL, BPUL, BHAL and TTHL==<br />
<br />
<br />
[[File:Bielefeld2012-Beadsbild.jpg|500px|left|thumb|'''Fig. 13: Enzymatic activity of the purified laccases BPUL, BHAL and TTHL illustrated by the oxidation of ABTS.''' BPUL shows a very high activity whereas the activity of BHAL and TTHL isn't so high, probably due to the low laccase concentration (4 μg ml<sup>-1</sup>). Yet, BHAL shows a higher activity than TTHL.]]<br />
<br />
After the Regional Europe Jamboree, further experiments were carried out. However, less amounts of purified laccases were available. Since activity tests of immobilized laccases using the “multi-well membrane-bottom filter plates” in Tecan require higher amounts of laccases, due to the fact that every period of time is measured separately, another method was to be used. The only alternative was a "Thermo Biomate 3 UV-Vis Spektrophotometer", in which the same solution can be continuosly vortexed and measured over a period of time. However, only the results of immobilized ECOL could be compared to those of nonimmobilzed. Immobilized ECOL could preserve 21 % of its initial activity (results not shown). The activity of purified nonimmobilized BPUL was so high, that even a 1:500 dilution wasn't enough to show significant results using the photometer. The concentration of purified BHAL and TTHL was too low (4 μg ml<sup>-1</sup>) to yield comparable results. Yet, BHAL showed a higher activity than TTHL. However, all four purified laccases showed indeed an activity (see Fig. 13). An illustration of ABTS oxidation with time compared to the negative control could also show an activity of the laccases (see Fig. 14-17).<br />
<br />
<br />
<br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|400px|left|thumb|'''Fig. 14: Illustration of ABTS oxidation by ECOL with time compared to the negative control.''' The increase in ABTS oxidized proves laccase activity.]]<br />
[[File:Bielefeld2012-Graphen_Bead_BPUL.jpg|400px|rigth|thumb|'''Fig. 15: Illustration of ABTS oxidation by BPUL with time compared to the negative control.''' The increase in ABTS oxidized proves laccase activity.]]<br />
[[File:Bielefeld2012-Graphen_Bead_Halo.jpg|400px|left|thumb|'''Fig. 16: Illustration of ABTS oxidation by BHAL with time compared to the negative control.''' The increase in ABTS oxidized proves laccase activity.]]<br />
[[File:Bielefeld2012-Graphen_Bead_Thermo.jpg|400px|right|thumb|'''Fig. 17: Illustration of ABTS oxidation by TTHL with time compared to the negative control.''' The increase in ABTS oxidized proves laccase activity.]]<br />
<br />
<br style="clear: both" /><br />
<br />
</div><br />
<br />
==Literature==<br />
<br />
[1]Fernández-Fernández M ''et al''. (2012) Recent developments and applications of immobilized laccase. ''Biotechnol Adv.'' 2012 Feb 28. [Epub ahead of print] <br />
<br />
[2]P.-P. Champagne and J.A. Ramsay (2007) Reactive blue 19 decolouration by laccase immobilized on silica beads. ''Appl Microbiol Biotechnol''. Oct;77:819–823<br />
<br />
[3]Chantale Cardinal-Watkins and Jim A. Nicell (2011)Enzyme-Catalyzed Oxidation of 17ß-Estradiol Using Immobilized Laccase from Trametes versicolor.'' Enzyme Research,'' vol. 2011, Article ID 725172, 11 pages<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/ResultsTeam:Bielefeld-Germany/Amsterdam/Results2012-10-27T02:51:47Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Results since Regionals<br />
</span><br />
</div><br />
<style type="text/css"><br />
<br />
ul {<br />
list-style-image:none;<br />
}<br />
#bodyContent{<br />
background-color: white;<br />
}<br />
<br />
</style><br />
<br />
<br />
<!-- navigator --><br />
<div id="tab"><br />
<br />
<ul style="list-style-type:none"><br />
<li><a href="#1"><strong>Summary</strong></a></li><br />
<li><a href="#2"><strong>Laccases</strong></a></li><br />
<li><a href="#3"><strong>Immobilization</strong></a></li><br />
<li><a href="#4"><strong>Substrate Analysis</strong></a></li><br />
<li><a href="#5"><strong>CBD</strong></a></li><br />
<li><a href="#6"><strong>Shuttle vector</strong></a></li><br />
</ul><br />
</div><br />
<br />
<br />
<!-- tab panes --><br />
<div id="panesresult"><br />
<br />
<div id="anzeige"><br />
<h1>Summary</h1><br />
<br />
</html><br />
coming soon<br />
<br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg" /> <br />
<br />
<h1>Laccases</h1><br />
<p class="more"><br />
</html><br />
The iGEM Team successfully produced four active bacterial laccases and an eukaryotic laccase (click for the results):<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/coli ''Escherichia coli'' laccase ECOL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi''Bacillus pumilus'' laccase BPUL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo''Bacillus halodurans'' laccase BHAL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo ''Thermus thermophilus'' laccase TTHL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 ''Trametes versicolor'' laccase TVEL5]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison Comparison of the different laccases]<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
All bacterial laccases ([https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Since_Regionals:_12.C2.A0L_Fermentation_E._coli_KRX_with_BBa_K863005 ECOL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Since_Regionals:_12.C2.A0L_Fermentation_E..C2.A0coli_KRX_with_BBa_K863000 BPUL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Since_Regionals:_12L_Fermentation_of_E._coli_Rosetta-Gami_2_with_BBa_K863022 BHAL] and [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Since_Regionals:_12_L_Fermentation_of_E._coli_Rosetta_Gami_2_with_BBa_K863012 TTHL]) were successfully scaled-up to a working volume of 12 L. Additional a optimized medium was chosen in the hope to enhance the protein amount. Activity assays were done for all four laccases ([https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Initial_activity_tests_of_purified_fractions ECOL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Since_Regionals:_Initial_activity_tests_of_purified_fractions BPUL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Since_Regionals:_Initial_activity_tests_of_purified_fractions BHAL] and [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Since_Regionals:_Initial_activity_tests_of_purified_fractions TTHL]), especially in regard to optimal pH and temperature effects. Additionally a [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison comparison] of all four produced laccases concerning their activity has been done. In addition an active eukaryotic laccases of ''Trametes versicolor'' was produced with a self-designed Shuttle-vector in yeast ''Pichia Pastoris''. <br />
<html><br />
</p><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/2/25/Bielefeld2012_Immo.jpeg" /><br />
<br />
<h1>Immobilization</h1><br />
<br />
<p class="more"><br />
</html><br />
The immobilization method on CPC-beads was further optimized. It has been proved that an incubation time of 6 hours is actually enough for immobilization. Furthermore, two additional laccases were successfully immobilized: from <br />
:* [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] (named BHAL) and from <br />
:*[http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] (named TTHL).<br />
Moreover, activity tests were carried out on all four immobilized laccases (ECOL, BPUL, BHAL, and TTHL). All of them showed activity. <br />
<p class="more"><br />
For immobilization results see [https://2012.igem.org/Team:Bielefeld-Germany/Results/immo#Since_Regionals:_Activity_tests_of_immobilized_ECOL.2C_BPUL.2C_BHAL_and_TTHL here]<br />
</p><br />
<html><br />
</p><br />
</div><br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/f/fa/Bielefeld2012-Estradiol-MS-measurement.JPG" /><br />
<br />
<h1>Substrate Analysis</h1><br />
<p class="more"><br />
</html><br />
After the regional jamboree Team Activity Test, Team Immobilization and Team Substrate Analysis got laccases from the same pool from the Cultivation Team. With these laccases the degradation experiments of estradiol and ethinyl estradiol were repeated for the laccases BPUL and ECOL. The new laccases BHAL and TTHL were characterized for estradiol and ethinyl estradiol degradation too. Estradiol and ethinyl estradiol was futher analyzed on LC-MS/MS<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
For more information about the new results [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Degradation_of_estrogens click here].<br />
Possible resulting degradation products after treatment of estradiol and ethinyl estradiol with TVEL0 were further analyzed via LCMS-MS. The results are shown [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Further_analysis_.28after_Regionals_Amsterdam.29 here].<br />
<html><br />
<br />
</p> <br />
<br />
<br />
</div><br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/b/b4/Bielefeld2012_no_GFP.jpg" /><br />
<br />
<h1>Cellulose binding domain</h1><br />
<br />
<p class="more"><br />
</html><br />
A lot of efforts were made, to change the order of the fusion proteins, to change the promoter and the RBS and to insert a different linker between the cellulose binding domain and the reporter GFP, but to the last day of lab work no green glowing colony to work with and execute the binding assay could be generated.<br />
<p class="more"><br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/cbc#Since_Amsterdam">Read '''the Boston file'''</a><br />
<html><br />
</p><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/17/Bielefeld2012_PECPP11JS.JPG" /><br />
<br />
<h1>Shuttle vector</h1><br />
<p class="more"><br />
</html><br />
The laccase TVEL5 from ''Trametes versicolor'' was successfully cloned via the ''Aar''I restriction sites in the shuttle vector <partinfo>BBa_K863207</partinfo>. We could show that the gene of interest is integrating in yeast genome over site directed recombination and the produced protein of interest is secreted in the cultivation medium and detectable there. With this results we could show that the shuttle vector is working as expected and therefor can be used for the production of any protein of interest.<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector For more information read here.]<br />
<html><br />
</p><br />
<br />
</div><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<script><br />
$(function() {<br />
<br />
<br />
$("#tab ul").tabs("#panesresult > div", {effect: 'fade', fadeOutSpeed: 400});<br />
});<br />
</script><br />
<br />
</html><br />
<br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/ResultsTeam:Bielefeld-Germany/Amsterdam/Results2012-10-27T02:51:09Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Results since Regionals<br />
</span><br />
</div><br />
<style type="text/css"><br />
<br />
ul {<br />
list-style-image:none;<br />
}<br />
#bodyContent{<br />
background-color: white;<br />
}<br />
<br />
</style><br />
<br />
<br />
<!-- navigator --><br />
<div id="tab"><br />
<br />
<ul style="list-style-type:none"><br />
<li><a href="#1"><strong>Summary</strong></a></li><br />
<li><a href="#2"><strong>Laccases</strong></a></li><br />
<li><a href="#3"><strong>Immobilization</strong></a></li><br />
<li><a href="#4"><strong>Substrate Analysis</strong></a></li><br />
<li><a href="#5"><strong>CBD</strong></a></li><br />
<li><a href="#6"><strong>Shuttle vector</strong></a></li><br />
</ul><br />
</div><br />
<br />
<br />
<!-- tab panes --><br />
<div id="panesresult"><br />
<br />
<div id="anzeige"><br />
<h1>Summary</h1><br />
<br />
</html><br />
coming soon<br />
<br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg" /> <br />
<br />
<h1>Laccases</h1><br />
<p class="more"><br />
</html><br />
The iGEM Team successfully produced four active bacterial laccases and an eukaryotic laccase (click for the results):<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/coli ''Escherichia coli'' laccase ECOL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi''Bacillus pumilus'' laccase BPUL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo''Bacillus halodurans'' laccase BHAL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo ''Thermus thermophilus'' laccase TTHL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 ''Trametes versicolor'' laccase TVEL5]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison Comparison of the different laccases]<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
All bacterial laccases ([https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Since_Regionals:_12.C2.A0L_Fermentation_E._coli_KRX_with_BBa_K863005 ECOL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Since_Regionals:_12.C2.A0L_Fermentation_E..C2.A0coli_KRX_with_BBa_K863000 BPUL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Since_Regionals:_12L_Fermentation_of_E._coli_Rosetta-Gami_2_with_BBa_K863022 BHAL] and [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Since_Regionals:_12_L_Fermentation_of_E._coli_Rosetta_Gami_2_with_BBa_K863012 TTHL]) were successfully scaled-up to a working volume of 12 L. Additional a optimized medium was chosen in the hope to enhance the protein amount. Activity assays were done for all four laccases ([https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Initial_activity_tests_of_purified_fractions ECOL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Since_Regionals:_Initial_activity_tests_of_purified_fractions BPUL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Since_Regionals:_Initial_activity_tests_of_purified_fractions BHAL] and [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Since_Regionals:_Initial_activity_tests_of_purified_fractions TTHL]), especially in regard to optimal pH and temperature effects. Additionally a [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison comparison] of all four produced laccases concerning their activity has been done. In addition an active eukaryotic laccases of ''Trametes versicolor'' was produced with a self-designed Shuttle-vector in yeast ''Pichia Pastoris''. <br />
<html><br />
</p><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/2/25/Bielefeld2012_Immo.jpeg" /><br />
<br />
<h1>Immobilization</h1><br />
<br />
<p class="more"><br />
</html><br />
The immobilization method on CPC-beads was further optimized. It has been proved that an incubation time of 6 hours is actually enough for immobilization. Furthermore, two additional laccases were successfully immobilized: from <br />
:* [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] (named BHAL) and from <br />
:*[http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] (named TTHL). Moreover, activity tests were carried out on all four immobilized laccases (ECOL, BPUL, BHAL, and TTHL). All of them showed activity. <br />
<p class="more"><br />
For immobilization results see https://2012.igem.org/Team:Bielefeld-Germany/Results/immo#Since_Regionals:_Activity_tests_of_immobilized_ECOL.2C_BPUL.2C_BHAL_and_TTHL here]<br />
</p><br />
<html><br />
</p><br />
</div><br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/f/fa/Bielefeld2012-Estradiol-MS-measurement.JPG" /><br />
<br />
<h1>Substrate Analysis</h1><br />
<p class="more"><br />
</html><br />
After the regional jamboree Team Activity Test, Team Immobilization and Team Substrate Analysis got laccases from the same pool from the Cultivation Team. With these laccases the degradation experiments of estradiol and ethinyl estradiol were repeated for the laccases BPUL and ECOL. The new laccases BHAL and TTHL were characterized for estradiol and ethinyl estradiol degradation too. Estradiol and ethinyl estradiol was futher analyzed on LC-MS/MS<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
For more information about the new results [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Degradation_of_estrogens click here].<br />
Possible resulting degradation products after treatment of estradiol and ethinyl estradiol with TVEL0 were further analyzed via LCMS-MS. The results are shown [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Further_analysis_.28after_Regionals_Amsterdam.29 here].<br />
<html><br />
<br />
</p> <br />
<br />
<br />
</div><br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/b/b4/Bielefeld2012_no_GFP.jpg" /><br />
<br />
<h1>Cellulose binding domain</h1><br />
<br />
<p class="more"><br />
</html><br />
A lot of efforts were made, to change the order of the fusion proteins, to change the promoter and the RBS and to insert a different linker between the cellulose binding domain and the reporter GFP, but to the last day of lab work no green glowing colony to work with and execute the binding assay could be generated.<br />
<p class="more"><br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/cbc#Since_Amsterdam">Read '''the Boston file'''</a><br />
<html><br />
</p><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/17/Bielefeld2012_PECPP11JS.JPG" /><br />
<br />
<h1>Shuttle vector</h1><br />
<p class="more"><br />
</html><br />
The laccase TVEL5 from ''Trametes versicolor'' was successfully cloned via the ''Aar''I restriction sites in the shuttle vector <partinfo>BBa_K863207</partinfo>. We could show that the gene of interest is integrating in yeast genome over site directed recombination and the produced protein of interest is secreted in the cultivation medium and detectable there. With this results we could show that the shuttle vector is working as expected and therefor can be used for the production of any protein of interest.<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector For more information read here.]<br />
<html><br />
</p><br />
<br />
</div><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<script><br />
$(function() {<br />
<br />
<br />
$("#tab ul").tabs("#panesresult > div", {effect: 'fade', fadeOutSpeed: 400});<br />
});<br />
</script><br />
<br />
</html><br />
<br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/ResultsTeam:Bielefeld-Germany/Amsterdam/Results2012-10-27T02:46:42Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Results since Regionals<br />
</span><br />
</div><br />
<style type="text/css"><br />
<br />
ul {<br />
list-style-image:none;<br />
}<br />
#bodyContent{<br />
background-color: white;<br />
}<br />
<br />
</style><br />
<br />
<br />
<!-- navigator --><br />
<div id="tab"><br />
<br />
<ul style="list-style-type:none"><br />
<li><a href="#1"><strong>Summary</strong></a></li><br />
<li><a href="#2"><strong>Laccases</strong></a></li><br />
<li><a href="#3"><strong>Immobilization</strong></a></li><br />
<li><a href="#4"><strong>Substrate Analysis</strong></a></li><br />
<li><a href="#5"><strong>CBD</strong></a></li><br />
<li><a href="#6"><strong>Shuttle vector</strong></a></li><br />
</ul><br />
</div><br />
<br />
<br />
<!-- tab panes --><br />
<div id="panesresult"><br />
<br />
<div id="anzeige"><br />
<h1>Summary</h1><br />
<br />
</html><br />
coming soon<br />
<br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg" /> <br />
<br />
<h1>Laccases</h1><br />
<p class="more"><br />
</html><br />
The iGEM Team successfully produced four active bacterial laccases and an eukaryotic laccase (click for the results):<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/coli ''Escherichia coli'' laccase ECOL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi''Bacillus pumilus'' laccase BPUL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo''Bacillus halodurans'' laccase BHAL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo ''Thermus thermophilus'' laccase TTHL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 ''Trametes versicolor'' laccase TVEL5]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison Comparison of the different laccases]<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
All bacterial laccases ([https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Since_Regionals:_12.C2.A0L_Fermentation_E._coli_KRX_with_BBa_K863005 ECOL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Since_Regionals:_12.C2.A0L_Fermentation_E..C2.A0coli_KRX_with_BBa_K863000 BPUL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Since_Regionals:_12L_Fermentation_of_E._coli_Rosetta-Gami_2_with_BBa_K863022 BHAL] and [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Since_Regionals:_12_L_Fermentation_of_E._coli_Rosetta_Gami_2_with_BBa_K863012 TTHL]) were successfully scaled-up to a working volume of 12 L. Additional a optimized medium was chosen in the hope to enhance the protein amount. Activity assays were done for all four laccases ([https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Initial_activity_tests_of_purified_fractions ECOL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Since_Regionals:_Initial_activity_tests_of_purified_fractions BPUL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Since_Regionals:_Initial_activity_tests_of_purified_fractions BHAL] and [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Since_Regionals:_Initial_activity_tests_of_purified_fractions TTHL]), especially in regard to optimal pH and temperature effects. Additionally a [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison comparison] of all four produced laccases concerning their activity has been done. In addition an active eukaryotic laccases of ''Trametes versicolor'' was produced with a self-designed Shuttle-vector in yeast ''Pichia Pastoris''. <br />
<html><br />
</p><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/2/25/Bielefeld2012_Immo.jpeg" /><br />
<br />
<h1>Immobilization</h1><br />
<br />
<p class="more"><br />
</html><br />
The immobilization method on CPC-beads was further optimized. It has been proved that an incubation time of 6 hours is actually enough for immobilization. Furthermore, two additional laccases were successfully immobilized: from [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] (named BHAL) and from [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] (named TTHL). Moreover, activity tests were carried out on all four immobilized laccases (ECOL, BPUL, BHAL, and TTHL). All of them showed activity. <br />
<p class="more"><br />
For immobilization results see [https://2012.igem.org/Team:Bielefeld-Germany/Results/immo here]<br />
</p><br />
<html><br />
</p><br />
</div><br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/f/fa/Bielefeld2012-Estradiol-MS-measurement.JPG" /><br />
<br />
<h1>Substrate Analysis</h1><br />
<p class="more"><br />
</html><br />
After the regional jamboree Team Activity Test, Team Immobilization and Team Substrate Analysis got laccases from the same pool from the Cultivation Team. With these laccases the degradation experiments of estradiol and ethinyl estradiol were repeated for the laccases BPUL and ECOL. The new laccases BHAL and TTHL were characterized for estradiol and ethinyl estradiol degradation too. Estradiol and ethinyl estradiol was futher analyzed on LC-MS/MS<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
For more information about the new results [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Degradation_of_estrogens click here].<br />
Possible resulting degradation products after treatment of estradiol and ethinyl estradiol with TVEL0 were further analyzed via LCMS-MS. The results are shown [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Further_analysis_.28after_Regionals_Amsterdam.29 here].<br />
<html><br />
<br />
</p> <br />
<br />
<br />
</div><br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/b/b4/Bielefeld2012_no_GFP.jpg" /><br />
<br />
<h1>Cellulose binding domain</h1><br />
<br />
<p class="more"><br />
</html><br />
A lot of efforts were made, to change the order of the fusion proteins, to change the promoter and the RBS and to insert a different linker between the cellulose binding domain and the reporter GFP, but to the last day of lab work no green glowing colony to work with and execute the binding assay could be generated.<br />
<p class="more"><br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/cbc#Since_Amsterdam">Read '''the Boston file'''</a><br />
<html><br />
</p><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/17/Bielefeld2012_PECPP11JS.JPG" /><br />
<br />
<h1>Shuttle vector</h1><br />
<p class="more"><br />
</html><br />
The laccase TVEL5 from ''Trametes versicolor'' was successfully cloned via the ''Aar''I restriction sites in the shuttle vector <partinfo>BBa_K863207</partinfo>. We could show that the gene of interest is integrating in yeast genome over site directed recombination and the produced protein of interest is secreted in the cultivation medium and detectable there. With this results we could show that the shuttle vector is working as expected and therefor can be used for the production of any protein of interest.<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector For more information read here.]<br />
<html><br />
</p><br />
<br />
</div><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<script><br />
$(function() {<br />
<br />
<br />
$("#tab ul").tabs("#panesresult > div", {effect: 'fade', fadeOutSpeed: 400});<br />
});<br />
</script><br />
<br />
</html><br />
<br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/ResultsTeam:Bielefeld-Germany/Amsterdam/Results2012-10-27T02:45:41Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Results since Regionals<br />
</span><br />
</div><br />
<style type="text/css"><br />
<br />
ul {<br />
list-style-image:none;<br />
}<br />
#bodyContent{<br />
background-color: white;<br />
}<br />
<br />
</style><br />
<br />
<br />
<!-- navigator --><br />
<div id="tab"><br />
<br />
<ul style="list-style-type:none"><br />
<li><a href="#1"><strong>Summary</strong></a></li><br />
<li><a href="#2"><strong>Laccases</strong></a></li><br />
<li><a href="#3"><strong>Immobilization</strong></a></li><br />
<li><a href="#4"><strong>Substrate Analysis</strong></a></li><br />
<li><a href="#5"><strong>CBD</strong></a></li><br />
<li><a href="#6"><strong>Shuttle vector</strong></a></li><br />
</ul><br />
</div><br />
<br />
<br />
<!-- tab panes --><br />
<div id="panesresult"><br />
<br />
<div id="anzeige"><br />
<h1>Summary</h1><br />
<br />
</html><br />
coming soon<br />
<br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg" /> <br />
<br />
<h1>Laccases</h1><br />
<p class="more"><br />
</html><br />
The iGEM Team successfully produced four active bacterial laccases and an eukaryotic laccase (click for the results):<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/coli ''Escherichia coli'' laccase ECOL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi''Bacillus pumilus'' laccase BPUL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo''Bacillus halodurans'' laccase BHAL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo ''Thermus thermophilus'' laccase TTHL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 ''Trametes versicolor'' laccase TVEL5]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison Comparison of the different laccases]<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
All bacterial laccases ([https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Since_Regionals:_12.C2.A0L_Fermentation_E._coli_KRX_with_BBa_K863005 ECOL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Since_Regionals:_12L_Fermentation_of_E._coli_Rosetta-Gami_2_with_BBa_K863022 BHAL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Since_Regionals:_12_L_Fermentation_of_E._coli_Rosetta_Gami_2_with_BBa_K863012 TTHL] and [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Since_Regionals:_12.C2.A0L_Fermentation_E..C2.A0coli_KRX_with_BBa_K863000 BPUL]) were successfully scaled-up to a working volume of 12 L. Additional a optimized medium was chosen in the hope to enhance the protein amount. Activity assays were done for all four laccases ([https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Initial_activity_tests_of_purified_fractions ECOL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Since_Regionals:_Initial_activity_tests_of_purified_fractions BPUL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Since_Regionals:_Initial_activity_tests_of_purified_fractions BHAL] and [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Since_Regionals:_Initial_activity_tests_of_purified_fractions TTHL]), especially in regard to optimal pH and temperature effects. Additionally a [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison comparison] of all four produced laccases concerning their activity has been done. In addition an active eukaryotic laccases of ''Trametes versicolor'' was produced with a self-designed Shuttle-vector in yeast ''Pichia Pastoris''. <br />
<html><br />
</p><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/2/25/Bielefeld2012_Immo.jpeg" /><br />
<br />
<h1>Immobilization</h1><br />
<br />
<p class="more"><br />
</html><br />
The immobilization method on CPC-beads was further optimized. It has been proved that an incubation time of 6 hours is actually enough for immobilization. Furthermore, two additional laccases were successfully immobilized: from [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] (named BHAL) and from [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] (named TTHL). Moreover, activity tests were carried out on all four immobilized laccases (ECOL, BPUL, BHAL, and TTHL). All of them showed acrtivity. <br />
<p class="more"><br />
For immobilization results see [https://2012.igem.org/Team:Bielefeld-Germany/Results/immo here]<br />
</p><br />
<html><br />
</p><br />
</div><br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/f/fa/Bielefeld2012-Estradiol-MS-measurement.JPG" /><br />
<br />
<h1>Substrate Analysis</h1><br />
<p class="more"><br />
</html><br />
After the regional jamboree Team Activity Test, Team Immobilization and Team Substrate Analysis got laccases from the same pool from the Cultivation Team. With these laccases the degradation experiments of estradiol and ethinyl estradiol were repeated for the laccases BPUL and ECOL. The new laccases BHAL and TTHL were characterized for estradiol and ethinyl estradiol degradation too. Estradiol and ethinyl estradiol was futher analyzed on LC-MS/MS<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
For more information about the new results [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Degradation_of_estrogens click here].<br />
Possible resulting degradation products after treatment of estradiol and ethinyl estradiol with TVEL0 were further analyzed via LCMS-MS. The results are shown [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Further_analysis_.28after_Regionals_Amsterdam.29 here].<br />
<html><br />
<br />
</p> <br />
<br />
<br />
</div><br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/b/b4/Bielefeld2012_no_GFP.jpg" /><br />
<br />
<h1>Cellulose binding domain</h1><br />
<br />
<p class="more"><br />
</html><br />
A lot of efforts were made, to change the order of the fusion proteins, to change the promoter and the RBS and to insert a different linker between the cellulose binding domain and the reporter GFP, but to the last day of lab work no green glowing colony to work with and execute the binding assay could be generated.<br />
<p class="more"><br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/cbc#Since_Amsterdam">Read '''the Boston file'''</a><br />
<html><br />
</p><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/17/Bielefeld2012_PECPP11JS.JPG" /><br />
<br />
<h1>Shuttle vector</h1><br />
<p class="more"><br />
</html><br />
The laccase TVEL5 from ''Trametes versicolor'' was successfully cloned via the ''Aar''I restriction sites in the shuttle vector <partinfo>BBa_K863207</partinfo>. We could show that the gene of interest is integrating in yeast genome over site directed recombination and the produced protein of interest is secreted in the cultivation medium and detectable there. With this results we could show that the shuttle vector is working as expected and therefor can be used for the production of any protein of interest.<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector For more information read here.]<br />
<html><br />
</p><br />
<br />
</div><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<script><br />
$(function() {<br />
<br />
<br />
$("#tab ul").tabs("#panesresult > div", {effect: 'fade', fadeOutSpeed: 400});<br />
});<br />
</script><br />
<br />
</html><br />
<br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/ResultsTeam:Bielefeld-Germany/Amsterdam/Results2012-10-27T02:38:58Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Results since Regionals<br />
</span><br />
</div><br />
<style type="text/css"><br />
<br />
ul {<br />
list-style-image:none;<br />
}<br />
#bodyContent{<br />
background-color: white;<br />
}<br />
<br />
</style><br />
<br />
<br />
<!-- navigator --><br />
<div id="tab"><br />
<br />
<ul style="list-style-type:none"><br />
<li><a href="#1"><strong>Summary</strong></a></li><br />
<li><a href="#2"><strong>Laccases</strong></a></li><br />
<li><a href="#3"><strong>Immobilization</strong></a></li><br />
<li><a href="#4"><strong>Substrate Analysis</strong></a></li><br />
<li><a href="#5"><strong>CBD</strong></a></li><br />
<li><a href="#6"><strong>Shuttle vector</strong></a></li><br />
</ul><br />
</div><br />
<br />
<br />
<!-- tab panes --><br />
<div id="panesresult"><br />
<br />
<div id="anzeige"><br />
<h1>Summary</h1><br />
<br />
</html><br />
coming soon<br />
<br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg" /> <br />
<br />
<h1>Laccases</h1><br />
<p class="more"><br />
</html><br />
The iGEM Team successfully produced four active bacterial laccases and an eukaryotic laccase (click for the results):<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/coli ''Escherichia coli'' laccase ECOL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi''Bacillus pumilus'' laccase BPUL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo''Bacillus halodurans'' laccase BHAL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo ''Thermus thermophilus'' laccase TTHL]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 ''Trametes versicolor'' laccase TVEL5]<br />
:* [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison Comparison of the different laccases]<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
All bacterial laccases (ECOL, BHAL, TTHL and BPUL) were successfully scaled-up to a working volume of 12 L. Additional a optimized medium was chosen in the hope to enhance the protein amount. Activity assays were done for all four laccases ([https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Initial_activity_tests_of_purified_fractions ECOL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Since_Regionals:_Initial_activity_tests_of_purified_fractions BPUL], [https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Since_Regionals:_Initial_activity_tests_of_purified_fractions BHAL] and [https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Since_Regionals:_Initial_activity_tests_of_purified_fractions TTHL]), especially in regard to optimal pH and temperature effects. Additionally a [https://2012.igem.org/Team:Bielefeld-Germany/Results/comparison comparison] of all four produced laccases concerning their activity has been done. In addition an active eukaryotic laccases of ''Trametes versicolor'' was produced with a self-designed Shuttle-vector in yeast ''Pichia Pastoris''. <br />
<html><br />
</p><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/2/25/Bielefeld2012_Immo.jpeg" /><br />
<br />
<h1>Immobilization</h1><br />
<br />
<p class="more"><br />
</html><br />
Coming soon!<br />
<p class="more"><br />
For immobilization results see [https://2012.igem.org/Team:Bielefeld-Germany/Results/immo here]<br />
</p><br />
<html><br />
</p><br />
</div><br />
<br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/f/fa/Bielefeld2012-Estradiol-MS-measurement.JPG" /><br />
<br />
<h1>Substrate Analysis</h1><br />
<p class="more"><br />
</html><br />
After the regional jamboree Team Activity Test, Team Immobilization and Team Substrate Analysis got laccases from the same pool from the Cultivation Team. With these laccases the degradation experiments of estradiol and ethinyl estradiol were repeated for the laccases BPUL and ECOL. The new laccases BHAL and TTHL were characterized for estradiol and ethinyl estradiol degradation too. Estradiol and ethinyl estradiol was futher analyzed on LC-MS/MS<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
For more information about the new results [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Degradation_of_estrogens click here].<br />
Possible resulting degradation products after treatment of estradiol and ethinyl estradiol with TVEL0 were further analyzed via LCMS-MS. The results are shown [https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate#Further_analysis_.28after_Regionals_Amsterdam.29 here].<br />
<html><br />
<br />
</p> <br />
<br />
<br />
</div><br />
<br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/b/b4/Bielefeld2012_no_GFP.jpg" /><br />
<br />
<h1>Cellulose binding domain</h1><br />
<br />
<p class="more"><br />
</html><br />
A lot of efforts were made, to change the order of the fusion proteins, to change the promoter and the RBS and to insert a different linker between the cellulose binding domain and the reporter GFP, but to the last day of lab work no green glowing colony to work with and execute the binding assay could be generated.<br />
<p class="more"><br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/cbc#Since_Amsterdam">Read '''the Boston file'''</a><br />
<html><br />
</p><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="anzeige"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/1/17/Bielefeld2012_PECPP11JS.JPG" /><br />
<br />
<h1>Shuttle vector</h1><br />
<p class="more"><br />
</html><br />
The laccase TVEL5 from ''Trametes versicolor'' was successfully cloned via the ''Aar''I restriction sites in the shuttle vector <partinfo>BBa_K863207</partinfo>. We could show that the gene of interest is integrating in yeast genome over site directed recombination and the produced protein of interest is secreted in the cultivation medium and detectable there. With this results we could show that the shuttle vector is working as expected and therefor can be used for the production of any protein of interest.<br />
<html><br />
</p><br />
<p class="more"><br />
</html><br />
[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector For more information read here.]<br />
<html><br />
</p><br />
<br />
</div><br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<script><br />
$(function() {<br />
<br />
<br />
$("#tab ul").tabs("#panesresult > div", {effect: 'fade', fadeOutSpeed: 400});<br />
});<br />
</script><br />
<br />
</html><br />
<br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/AcknowledgementsTeam:Bielefeld-Germany/Acknowledgements2012-10-27T02:07:30Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<div id=page-title><br />
<span id=page-title-text><br />
Acknowledgements<br />
</span><br />
</div><br />
<br />
</html><br />
<html><br />
<div id="grey_bg"><br />
</html><br />
<br />
<br />
<div style="text-align:justify;"><br />
The idea for this project arose from countless discussions, researches and presentations in team meetings (done by team members). So was the complete planning, and realization done by the students of iGEM Bielefeld Team 2012 with some tips from the advisers to avoid problems that came up in the years before. The whole lab work was executed by the student members of the team (and really everyone had their part to do to the last day).<br />
To get this big project organized we divided the team in small sub teams (operating units):<br />
<br />
<center><br />
{|class="wikitable"<br />
| '''Sponsoring''' and fancy stuff || '''Kevin Jarosch, Robert Braun, Moritz Müller'''<br />
|-<br />
| '''Human practice''' and east-German-accent-PR-bitch || '''Robert Braun''' (Rooobert!)<br />
|-<br />
| Chief of Lab, cloning princess and jack of all trades || '''Isabel Huber''' (Hubba, Hubba!)<br />
|-<br />
| '''Cloning bacterial laccases''' || '''Isabel Huber, Hakan Geyik'''<br />
|-<br />
| '''Cloning fungal laccases''' || '''Isabel Huber, Julia Schirmacher'''<br />
|-<br />
| '''Generating cDNA''' and putting a "Sch" in front of everyone || '''Saskia Scheibler, Agatha Walla''' (Sagatha)<br />
|-<br />
| '''Shuttle vector''', yeast and methanol metabolism || '''Julia Schirmacher''' (Juschi)<br />
|-<br />
| '''Cellulose binding domain''' and endless cloning || '''Moritz Müller''' (mo)<br />
|-<br />
| '''Site directed mutagenesis''' and owner of the "finger of guilt" || '''Moritz Müller'''<br />
|-<br />
| '''Sequencing''', technical issues and call center || '''Derya Kirasi'''<br />
|-<br />
| '''Cultivation of cells and capturing of proteins''' || '''Kevin Jarosch, Miriam Fougeras, Gabi Kleiner'''<br />
|-<br />
| '''Immobilization''' and shift work || Sch'''Malak Fawaz''', Sch'''Nadine Legros'''<br />
|-<br />
| '''Activity Test''' and baking || '''Saskia Scheibler, Agatha Walla'''<br />
|-<br />
| '''MALDI''' and schedule fights|| '''Julia Voss''' (Juvoss aka U-force)<br />
|-<br />
| '''Substrate Analysis''' and funky pictures || '''Hakan Geyik, Sebastian Wiebe'''<br />
|-<br />
| '''Modeling''' and mate-tea || '''Sebastian Wiebe'''<br />
|-<br />
| '''Wiki design''' and wake up calls in the middle of the night|| '''Julia Voss'''<br />
|}<br />
</center><br />
Actually everybody of the team was involved in the human practice. Robert Braun was just head and contact. Public appearance (in newspaper and radio interviews) was mainly given by Kevin Jarosch and Robert Braun, but everybody had their (bigger or smaller) part in every event and every time their own opinion to represent. All funds for the project were solicited by the the sponsoring team (for sure team members and advisers gave suggestions where to ask).<br />
<br />
However there are some people without whom we could not have done all this work. People who gave us advise, helped us out with materials or simply cheered us up during some long days in the lab.<br />
(This page is constantly updated just to make sure we wont forget anyone.)<br />
<br />
*Our Instructor Dr. Jörn Kalinowski for providing us with an own laboratory room and supporting us with paper work, scientific guidance and financing. Furthermore we could use all of his equipment and materials.<br />
*Prof. Dr. rer. nat. Erwin Flaschel for providing us with lab space. We were able to use all the fermentation equipment we needed in his Fermentation Engineering lab. As well, he helped us with the sponsoring.<br />
*Our Instructor Dr. Christian Rückert always gave great advice for our scientific problems. He helped us with ordering materials, drove for us to the Teacher´s workshop in Paris and gave a lot of helpful suggestions.<br />
*Nils Lübke and Timo Wolf as former iGEM team members helped us with their experience, listened to our endless discussions and problems during our weekly team meetings and adviced us on our public relations work.<br />
*Dominik Cholewa aided us with his knowledge considering our large-scale fermentations and various purification methods.<br />
*Michael Limberg who is sharing a lab with us and is therefore always our first try when having a question.<br />
*Maurice Telaar gave us pMTE cp46 His and helped us with questions about purification<br />
*Thomas Hug helped us with questions about Pichia pastoris vector design and fermentation.<br />
*We want to thank Prof. Dr. Alfred Pühler for promoting our work and always answering our questions.<br />
*Nikolas Kessler as a former iGEM team member gave us guidance especially with web and graphic design.<br />
*Armin Neshat as a former iGEM team member helped us with our everyday questions and ordered all our chemicals and primers.<br />
*Prof. Dr. Uwe Bornscheuer, leader of the working group from the Institute of Biochemistry, Dept. of Biotechnology & Enzyme Catalysis at Ernst-Moritz-Arndt-University in Greifswald (Germany), send us the sequences and plasmids containing four sequences of different laccases of ''Trametes versicolor'' and the sequence of one ''Pycnoporus cinnabarinus'' laccase. <br />
*Prof. Dr. Thomas Noll helped us finding sponsors by mediating contacts.<br />
<!--*Dr. Werner Selbitschka for inviting us to and organizing the CeBiTec symposium. </li>--><br />
*Thorsten Seidel for advice with GFP-linkers, helping us with ''A. thaliana'' and supplying us with some "spare parts".<br />
*Patrick Treffon for providing us with lovely ''A. thaliana'' plants.<br />
*Marten Moore for providing us with some ''A. thaliana'' cDNA for some pre-tests.<br />
*Katharina Thiedig for giving help and advice in Site Directed Mutagensis and with Clonemanager. <br />
*Nina Probst for blessing us with some actin primers.<br />
*Dr. Marcus Persicke for measuring our LC-MS preparations and his advises <br />
*Lovely Kordula Puls for supplying us with as well lovely ''Volvox carteri'' to present it at our Street Science day.<br />
*All members of the Coryne AG for sharing the lab and equipment with us as well as helping us with our everyday questions.<br />
*All members of the Fermentation Engineering AG for sharing the lab and equipment with us as well as helping us with our everyday questions.<br />
*Michael Epp for our "A Case for Laccase" video.<br />
*Prof. Dr. Dietmar Kuck for giving ideas of stable degradation products regarding the MS/MS of estradiol and ethinyl-estradiol<br />
<br />
</div><br />
<br />
<html><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/OutlookTeam:Bielefeld-Germany/Outlook2012-10-27T01:57:47Z<p>Mo: /* Cellulose Binding Domain */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<div id=page-title><br />
<span id=page-title-text><br />
Outlook<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
</html><br />
<br />
== Going large-scale? ==<br />
<br />
After having developed a plan for a potential application of our project we now plan to test our system in a real sewage treatment plant under strict safety regulations. Furthermore a [https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant#Conclusion lab-scale waste water system] could be used to measure the enzyme activity of our immobilized laccases in active sludge and in a fixed bed reactor under realistic conditions.<br />
<br />
== Shuttle vector ==<br />
<br />
The [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 shuttle vector (pECPP11JS)] <partinfo>BBa_K863204</partinfo> could be constructed and it was shown that an active protein (TVEL5) could be secreted into the medium.<br />
<br />
The following step will be the site directed mutagenesis to eliminate the illegal ''Xba''I restriction site in the ''his4'' gene.<br />
Afterwards the laccases from [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863030 ''Trametes versiculor'' TVEL35] and [http://partsregistry.org/Part:BBa_K500002 K500002] have to be integrated into the shuttle vector and afterwards into the genome of the yeast. The next step will be the optimization of the cultivation and purification of the protein. Furthermore the immobilization and measurement of the activity have to be done.<br />
<br />
== Cellulose Binding Domain ==<br />
A favorable alternative to conventional immobilization and purification methods is still a key factor to the feasibility of our project. Many different BioBricks including a cellulose binding domain (CBD) could be constructed and cloned. Beneath them three different constructs to express reporter proteins, but a detectable fusion-protein with a CBD and a green fluorescent protein (GFP) to characterize the binding capacity of the CBDs in a detectable scale could not be produced. The switching from an inducible T7-promoter to a constitutive promoter (J23100/J61101) did not show a detectable expression either. Future research could focus on the linker between CBDs and the reporter GFP or the order of CBD and GFP.<br />
<br />
==Cultivation and Purification==<br />
<br />
<div style="text-align:justify;"> <br />
Until now, the laccases from ''E. coli'' (ECOL), ''B. pumilis'' (BPUL), ''B. halodurans'' (BHAL) and ''T. thermophilus'' (TTHL) were produced and purified. As a first approach a batch cultivation and a quick and efficient purification procedure was chosen. The next steps will be a scale up for the ''B. halodurans'' laccase (BHAL) and a screening for cultivation conditions for the laccase from ''X. campestris'' in ''E. coli'' Rosetta-Gami 2.<br />
Due to the successful production of an eucaryotic laccase in ''Pichia pastoris'', following cultivation experiments are planed to get a higher protein amounts. The produced eucaryotic laccase from ''T. versicolor'' (TVEL5) will be used to establish a purification procedure with a capture step based on an Ion-Exchange-Chromatography and following with an Hydrophob-Interaction-Chromatography. The purified protein could be used for characterizing the crystalline structure and the properties of the enzyme. <br />
<br />
To improve the production and to produce a higher amount of bacterial laccases several screening approaches, like the cultivation in another medium (e.g. HSG-medium) as well as the establishment of a fed-batch cultivation with different feeding strategies to increase the durance of protein expression, are possible. Additional different fermentation condition can be proved to identify the best fermentation parameters like: pO<sub>2</sub>, agitation control, pH, temperature, air composition, etc. <br />
<br />
For an improvement of the purification various possibilities exist. During our research the laccases were captured by a Ni-NTA resin and eluted with two elution strategies. To enhance the effectiveness of the purification procedure different elution strategies could be screened with varying elution gradients. The purification of the laccases can be expanded by 2 or 3 more steps for a better purification and a final polishing. Potential steps could be an Ion Exchange Chromatography with a following Size Exclusion Chromatography. Furthermore different buffers and so called wash buffers could be tested including different concentration of CuCl<html><sub>2</sub></html> to prove if this has a positive influence on the purification procedure.<br />
<br />
==Activity Tests==<br />
<br />
Four different laccases have been produced via heterologous expression which showed the ability to oxidize ABTS. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863010 TTHL] activities have been characterized further to gain information about optimal pH or ideal CuCl<sub>2</sub> concentration. Still there are some measurements that would help to characterize these laccases in more detail. One important aspect is the stability of our gained enzymes. This would help us to define the duration that our laccases are active in the waste water treatment plants before they have to be exchanged by new active ones.<br />
<br />
==Immobilization==<br />
<br />
An immobilization of Trametes versicolor- Laccase (named TVEL0), E. coli BL21- Laccase (CueO named ECOL) and Bacillus pumilus DSM 27 -Laccase (CotA named BPUL) on CPC-beads was successfully achieved. The next step would be to immobilize the laccases Lbh1 from Bacillus halodurans C-125 (named BHAL) and Ltth from Thermus thermophilus HB27 (named TTHL) and develop an optimal immobilization strategy for them. Another aspect would be to consider a method to increase the enzymatic activity of immobilized ECOL, as well as to raise the binding capacity of BPUL to the beads.<br />
<br />
== Substrate Analysis == <br />
The HPLC results showed that ECOL, BPUL, TTHL and BHAL are able to degrade estradiol in the presence and absence of ABTS. Ethinyl estradiol is not degraded by the bacterial laccases. Just TTHL showed little degradation activities on ethinyl estradiol in presence of ABTS.<br />
Due to time reasons and the decay of PAHs in Britton Robinson buffer, the analyses of the PAHs and the analgesics with the HPLC and the LC-MS methods could not been carried out. It would be interesting to analyze the produced laccases with the PAHs and analgesics. <br />
Degradation products were found after treatment of estradiol and ethinyl estradiol with TVEL0 with LC-MS. The next step would be to analyze the possible degradation of PAHs, analgesics and estrone and detect degradation products after treatment with the produced bacterial laccases and TVEL5 from ''Trametes versicolor''.<br />
<br />
</div><br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Project/AchievmentsTeam:Bielefeld-Germany/Project/Achievments2012-10-27T01:24:40Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Project Achievements<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
<br />
<b><br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]]<br />
::We successfully produced purified and identified active laccases of ''E. coli'' BL21(CueO named ECOL), ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL), ''Bacillus halodurans'' C-125 laccase (Lbh1 named BHAL) and ''Thermus thermophilus'' HB27 (tthL named TTHL).<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli Results ECOL] <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo Results BHAL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully designed a shuttle vector for site-directed integration in ''P. pastoris'' which allows the production and secretion of a protein of interest. We were able to show that the vector is functioning as expected. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully produced the laccase TVEL5 from ''Trametes versicolor'' in ''P. pastoris'' and showed the activity of the produced enzymes.<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::Successful characterization of the activity of all four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Activity_Analysis_of_ECOL Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Activity_analysis_of_BPUL Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Activity_analysis_of_TTHL Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Activity_Analysis_of_BHAL Results BHAL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We established a method for the degradation of several compounds with the help of our self-produced laccases. The HPLC analysis showed that our produced bacterial laccases are able to degrade estradiol with and without addition of ABTS. BPUL is able to degrade ethinyl estradiol with addition of ABTS. LC-MS measurements showed degradation products which could not be identified but were further analyzed using MS/MS. The resulting products have been discussed with an organic chemist.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/substrate Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully immobilized ''Trametes versicolor'' laccase (named TVEL0), ''E. coli'' BL21 laccase (CueO named ECOL) and ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL) and measured their activity. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results TVEL0]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo#Immobilization_of_purified_ECOL.2C_BPUL.2C_BHAL_and_TTHL_and_Activity_Tests Results ECOL, BPUL, BHAL and TTHL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created a model which simulates the required laccase amount to degraded harmful substances under real sewage plant conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Modell Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We conducted a feasibility study of our project with sewage plant experts.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created our own database to organize our samples.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Project/Database Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully improved a BioBrick by clarifying its true function. <br />
<br />
::[http://partsregistry.org/Part:BBa_K392014:Experience#User_Reviews Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We did an outstanding outreach work.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview Results]<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|60px|frameless|left]] <br />
:::We won a gold medal.<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|60px|frameless|left]] <br />
:::We qualified for the world campionships<br />
<br style="clear: both" /><br />
</b><br />
<br />
<br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Project/AchievmentsTeam:Bielefeld-Germany/Project/Achievments2012-10-27T01:23:24Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Project Achievements<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
<br />
<b><br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]]<br />
::We successfully produced purified and identified active laccases of ''E. coli'' BL21(CueO named ECOL), ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL), ''Bacillus halodurans'' C-125 laccase (Lbh1 named BHAL) and ''Thermus thermophilus'' HB27 (tthL named TTHL).<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli Results ECOL] <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo Results BHAL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully designed a shuttle vector for site-directed integration in ''P. pastoris'' which allows the production and secretion of a protein of interest. We were able to show that the vector is functioning as expected. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully produced the laccase TVEL5 from ''Trametes versicolor'' in ''P. pastoris'' and showed the activity of the produced enzymes.<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::Successful characterization of the activity of all four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Activity_Analysis_of_ECOL Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Activity_analysis_of_BPUL Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Activity_analysis_of_TTHL Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Activity_Analysis_of_BHAL Results BHAL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We established a method for the degradation of several compounds with the help of our self-produced laccases. The HPLC analysis showed that our produced bacterial laccases are able to degrade estradiol with and without addition of ABTS. BPUL is able to degrade ethinyl estradiol with addition of ABTS. LC-MS measurements showed degradation products which could not be identified but were further analyzed using MS/MS. The resulting products have been discussed with an organic chemist.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#5 Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully immobilized ''Trametes versicolor'' laccase (named TVEL0), ''E. coli'' BL21 laccase (CueO named ECOL) and ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL) and measured their activity. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results TVEL0]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo#Immobilization_of_purified_ECOL.2C_BPUL.2C_BHAL_and_TTHL_and_Activity_Tests Results ECOL, BPUL, BHAL and TTHL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created a model which simulates the required laccase amount to degraded harmful substances under real sewage plant conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Modell Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We conducted a feasibility study of our project with sewage plant experts.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created our own database to organize our samples.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Project/Database Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully improved a BioBrick by clarifying its true function. <br />
<br />
::[http://partsregistry.org/Part:BBa_K392014:Experience#User_Reviews Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We did an outstanding outreach work.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview Results]<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|60px|frameless|left]] <br />
:::We won a gold medal.<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|60px|frameless|left]] <br />
:::We qualified for the world campionships<br />
<br style="clear: both" /><br />
</b><br />
<br />
<br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Project/AchievmentsTeam:Bielefeld-Germany/Project/Achievments2012-10-27T01:22:26Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Project Achievements<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
<br />
<b><br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]]<br />
::We successfully produced purified and identified active laccases of ''E. coli'' BL21(CueO named ECOL), ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL), ''Bacillus halodurans'' C-125 laccase (Lbh1 named BHAL) and ''Thermus thermophilus'' HB27 (tthL named TTHL).<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli Results ECOL] <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo Results BHAL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully designed a shuttle vector for site-directed integration in ''P. pastoris'' which allows the production and secretion of a protein of interest. We were able to show that the vector is functioning as expected. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully produced the laccase TVEL5 from ''Trametes versicolor'' in ''P. pastoris'' and showed the activity of the produced enzymes.<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::Successful characterization of the activity of all four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Activity_Analysis_of_ECOL Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Activity_analysis_of_BPUL Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Activity_analysis_of_TTHL Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Activity_Analysis_of_BHAL Results BHAL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We established a method for the degradation of several compounds with the help of our self-produced laccases. The HPLC analysis showed that our produced bacterial laccases are able to degrade estradiol with and without addition of ABTS. BPUL is able to degrade ethinyl estradiol with addition of ABTS. LC-MS measurements showed degradation products which could not be identified but were further analyzed using MS/MS. The resulting products have been discussed with an organic chemist.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#5 Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully immobilized ''Trametes versicolor'' laccase (named TVEL0), ''E. coli'' BL21 laccase (CueO named ECOL) and ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL) and measured their activity. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results TVEL0]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo#3 Results ECOL, BPUL, BHAL and TTHL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created a model which simulates the required laccase amount to degraded harmful substances under real sewage plant conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Modell Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We conducted a feasibility study of our project with sewage plant experts.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created our own database to organize our samples.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Project/Database Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully improved a BioBrick by clarifying its true function. <br />
<br />
::[http://partsregistry.org/Part:BBa_K392014:Experience#User_Reviews Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We did an outstanding outreach work.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview Results]<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|60px|frameless|left]] <br />
:::We won a gold medal.<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|60px|frameless|left]] <br />
:::We qualified for the world campionships<br />
<br style="clear: both" /><br />
</b><br />
<br />
<br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Results/immoTeam:Bielefeld-Germany/Results/immo2012-10-27T01:19:28Z<p>Mo: /* Immobilization of purified ECOL, BPUL, BHAL and TTHL and Activity Tests */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#4"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Immobilization<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
<br />
<br />
</html><br />
__TOC__<br />
<br />
<div style="text-align:justify;"><br />
==First Approach==<br />
The initial step was to find out a convenient method of immobilization using commercially acquired laccases from ''Trametes versicolor'' (named TVEL0) as a standard. The first alternative was the use of silica dioxide beads from the lab. Different bead concentrations were used (ratio 1:500, 1:1000 and 1:1500) and different buffers (HBSS buffer, recrystallization buffer and Britton-Robinson buffer). However, no significant activity could be detected. Hence, it was agreed to try out CPC-(controlled pore carrier) silica beads, to which laccases covalently bind, especially that some papers provide protocols and activity tests which prove the efficiency of these beads.<br />
<br />
== Immobilization Strategy and Optimization of CPC-beads: ==<br />
<br />
<br />
In order to identify the best conditions for TVEL0, different bead concentrations: 0.01, 0.02, 0.04, 0.06, and 0.08 g mL<sup>-1</sup>, as well as different incubation time periods: 18 h and 36 h were examined. Britton-Robinson buffer (pH 5) was used, since TVEL0 showed the highest activity in pH 5. The beads were first immersed in 2.5 % glutaraldehyde and incubated for two hours under light vacuum in order to allow as much beads’ surface area to be coated with aldehyde groups, which crosslink the laccases to the beads. After that, the beads were washed 3 times with [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials Britton-Robinson Buffer] and then immersed in 1mg mL<sup>-1</sup> laccases from TVEL0 and placed on a rotator at 4 °C for 18 h and 36 h respectively. These time periods were selected according to different protocols describing this immobilization method. After incubation, the supernatants were gathered to be tested for laccase activity. The beads were then washed with [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials Britton-Robinson Buffer], then with 0.5 M NaCl solution in order to wash away all noncovalently bound laccases and again twice with the same buffer. Subsequently, the beads were immersed in 2.5 mg <sup>-1</sup> glycine for 18 h at 4 °C. Finally, the beads were rinsed again with with [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials Britton-Robinson Buffer], then with 0.5 M NaCl solution and again twice with the same buffer.<br />
<br />
To figure out the amount of protein bound to the beads after several incubation periods of time, the protein concentration in the supernatant was measured using Roti®-Nanoquant. After comparing the results, it was noticeable that after 10 hours, the maximum amount of bound proteins to beads could be achieved (see Fig. 1). This remained relatively constant over the remaining incubation period, although an incubation time of at least 18 hours was recommended in all protocols. Therefore, another experiment was carried out to test the protein binding within the first 10 hours. The results showed that 6 hours were actually enough to reach a maximum binding (see Fig. 2) <br />
<br />
[[File:Bielefeld2012-Malak-Incubation_time_alt.jpg|400px|right|thumb|'''Fig. 1: The mass of bound TVEL0 to beads (µg TVEL0/g beads) over different incubation periods of time.''' The maximum protein binding to laccases is already achieved after an incubation period of 10 hours.]]<br />
<br />
[[File:Bielefeld2012-Malak-Zeitverlauf_neu.jpg|400px|left|thumb|'''Fig. 2: The mass of bound TVEL0 to beads (µg TVEL0/g beads) over different incubation periods of time.''' After 6 hours incubation, a maximum protein binding to laccases is achieved.]]<br />
<br />
<br />
<br />
On the other hand, the activity of the nonbound laccases present in the supernatant was measured using [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics ABTS as substrate] to find out the most convenient bead concentration. According to the results, the activity decreased upon increasing the concentration of the beads without reaching a saturation level (see Fig. 3). Therefore, another experiment was carried out with higher bead-concentrations.<br />
<br />
[[Image:Bielefeld2012Malak2Graf.jpg|500px|left|thumb|'''Fig. 3: Enzymatic activity of TVEL0 supernatant gathered after immobilization with different bead concentrations, measured using 0.1 mM ABTS at 25 °C over a time period of 5 minutes.''' The graph shows a decreasing laccase activity with increasing bead concentrations, which indicates that the higher the bead concentration, the more laccases immobilized.]]<br />
<br />
<br style="clear: both" /> <br />
<br />
The same experiment was carried out with the following bead concentrations: 0.06, 0.08, 0.1, 0.12, 0.14 and 0.16 g mL<sup>-1</sup>. Based on the results of the previous experiment, the samples were incubated with 1 mg mL<sup>-1</sup> TVEL0 for 36 h.<br />
The results showed no significant change in the laccase activity upon increasing the concentration of beads above 0.06 g ml<sup>-1</sup> (see Fig. 4), a saturation level has been achieved. <br />
<br />
<br />
[[Image:Bielefeld2012Malak22Graf.jpg|500px|left|thumb|'''Fig 4: Enzymatic activity of TVEL0 supernatant gathered after immobilization with different bead concentrations, measured using 0.1 mM ABTS at 25 °C over a time period of five minutes.''' The graph shows no significant change in the laccase activity with increasing bead concentration; a saturation level has been achieved.]]<br />
<br />
<br style="clear: both" /> <br />
<br />
Since the activity of laccases can be affected by other conditions, and can not be directly correlated to protein binding, another immobilization experiment was carried out and the protein concentration was measured using Roti®-Nanoquant. Again different bead concentrations were used: 0.08, 0.1, 0.12 and 0.14 g/ml. In order to determine the optimal ratio of CPC-beads to protein, the binding capacity (Bc) was determined as follows:<br />
<br />
[[File:Bielefeld2012_Immobilisierung_bindingcapacity.jpg|150px|center]]<br />
<br />
<br style="clear: both" /> <br />
<br />
The results were almost consistent with the activity tests performed previously. The most convenient bead concentration was 0.12 g/ml (see Fig.5).<br />
<br />
[[File:Bielefeld2012-Malak-Beadconcentration_Bc.jpg|500px|left|thumb|'''Fig. 5: The binding capacity of TVEL0 to different CPC-beads concentration.''' The highest capacity is achieved with a bead concentration of 0.12g mL<sup>-1</sup>.]]<br />
<br />
<br style="clear: both" /> <br />
<br />
<br />
However, as expected, it was not possible to measure the activity of laccases bound to beads using the Tecan. The beads were probably disturbing the Tecan’s laser, and centrifugation wasn´t an option because it would have simply taken too long and wouldn’t stop the reaction at a precise point of time. Therefore, multi-well membrane-bottom filter plates was considered to be a solution. These plates work in a similar way to the regular plates used for the Tecan but furthermore they contain a membrane that sieves the liquid through the filter. Thus the beads are separated and the ABTS-Buffer solution can be analyzed at 420 nm for oxidized ABTS.<br />
<br />
The ability of the “multi-well membrane-bottom filter plates” to measure the activity of laccases bound to beads was tested with TVEL0 laccases. The results were promising (for further Information see labjournal.<br />
Subsequently, after receiving the laccases purified from ''E. coli'' BL21 (DE3) (named ECOL), the same procedures were followed to optimize the best conditions. However, the activity was measured over a longer period of time (35 min). The results indicated a similar behavior of ECOL to TVEL0 (see Fig. 6). Consequently, the same approach was followed for the immobilization of the next laccases.<br />
<br />
<br />
[[Image:Bielefeld2012-Malak-Konz-Optimierung.jpg|500px|left|thumb|'''Fig. 6: Enzymatic activity of ECOL supernatant gathered after immobilization with different bead concentrations, measured using 0.1 mM ABTS at 25 °C over a time period of 30 minutes.''' The graph shows no significant change in the laccase activity with increasing bead concentration; a saturation level has been achieved. The behavior is similar to that of TVEL0 (see Fig. 4).]]<br />
<br />
<br style="clear: both" /><br />
<br />
==Immobilization of purified ECOL, BPUL, BHAL and TTHL and Activity Tests==<br />
<br />
After optimizing the immobilization conditions for TVEL0 and ECOL, and proving their ability to bind to beads and preserve part of their activity, it was interesting to find out the percentage of laccases that bind to the beads, as well as the activity preserved by these laccases. <br />
<br />
Accordingly, an immobilization experiment was carried out using TVEL0, ECOL, purified laccases from [http://www.dsmz.de/catalogues/details/culture/DSM-27.html|thumb|300px|left| ''Bacillus pumilus'' DSM 27 (ATCC7061)] (named BPUL), [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] (named BHAL) and from [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] (named TTHL) with a bead concentration of 0.12 g and over an incubation period of 14 hours. <br />
The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The percentage of bound laccases relative to the original concentration is presented in Fig. 7. The results showed that the four different purified laccases bind very well to the beads. ECOL and BPUL were perfectly immobilized (99% and 97% respectively) and showed a higher binding ability than the standard laccase TVEL0. 79 % of BHAL and TTHL could be immobilized on the CPC-beads. <br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|350px|thumb|left|'''Fig. 7: The percentage of laccases immobilized to CPC-Beads.''' 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<br />
After the successful immobilization, the second step was to test the activity of the immobilized laccases. The activity of laccases in the supernatant was also measured using [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics ABTS as substrate] and compared to the activity of nontreated laccases (Fig. 8-10). The results show that TVEL0 almost preserve their activity in the supernatant, whereas the activity of ECOL dramatically decreases compared to a slight decrease in the activity of BPUL. <br />
<br />
<br />
[[File:Bielefeld2012_trametes.jpg|350px|thumb|left|'''Fig. 8: Enzymatic activity of TVEL0 supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25 °C over a time period of 40 minutes.''' The results show that TVEL0 almost preserve their activity in the supernatant.]]<br />
<br />
<br />
<br />
[[File:Bielefeld2012_ecoli.jpg|350px|thumb|right|'''Fig. 9: Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25 °C over a time period of 12 hours.''' The results show a dramatic decrease of ECOL in the supernatant.]]<br />
<br />
<br />
[[File:Bielefeld2012_bpumi.jpg|350px|thumb|left|'''Fig. 10: Enzymatic activity of BPUL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25 °C over a time period of 12 hours.''' The results show a slight decrease in the activity of BPUL in the supernatant.]]<br />
<br />
<br />
On the other hand, the specific enzyme activity of immobilized laccases from ECOL and BPUL was also measured using [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics ABTS as substrate] and compared to that of nonimmobilized laccases (Fig. 11). The results showed that immobilized BPUM preserved 44 % of its activity, whereas ECOL didn't show a significant activity after immobilization.<br />
<br />
[[File:Bielefeld2012-Immob.jpg|400px|right|thumb|'''Fig. 11: Percentage of specific enzyme activity of immobilized BPUL and ECOL relative to the nonimmobilized laccases.''' Immobilized BPUM preserved 44 % of its activity, whereas ECOL didn't show a significant activity after immobilization.]]<br />
<br />
<br style="clear: both" /><br />
<br />
== Since Regionals: Activity tests of immobilized ECOL, BPUL, BHAL and TTHL==<br />
<br />
After the Regional Europe Jamboree, further experiments were carried out. However, less amounts of purified laccases were available. Since activity tests of immobilized laccases using the “multi-well membrane-bottom filter plates” in Tecan require higher amounts of laccases, due to the fact that every period of time is measured separately, another method was to be used. The only alternative was a "Thermo Biomate 3 UV-Vis Spektrophotometer", in which the same solution can be continuosly vortexed and measured over a period of time. However, only the results of immobilized ECOL could be compared to those of nonimmobilzed. Immobilized ECOL could preserve 21% of its initial activity (results not shown). The activity of purified nonimmobilized BPUL was so high, that even a 1:500 dilution wasn't enough to show significant results using the photometer. The concentration of purified BHAL and TTHL was so low (4 μg ml<sup>-1</sup>) to yield comparable results. Yet, BHAL showed a higher activity than TTHL. However, all four purified laccases showed indeed an activity (see Fig. 12). An illustration of ABTS oxidation with time compared to the negative control could also show an activity of the laccases (see Fig. 13-16).<br />
<br />
[[File:Bielefeld2012-Beadsbild.jpg|500px|left|thumb|'''Fig. 12: Enzymatic activity of the purified laccases BPUL, BHAL and TTHL illustrated by the oxidation of ABTS.''' BPUL shows a very high activity whereas the activity of BHAL and TTHL isn't so high, probably due to the low laccase concentration (4 μg.ml-1)Yet, BHAL shows a higher activity than TTHL.]]<br />
<br />
<br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Fig. 13: Illustration of ABTS oxidation by ECOL with time compared to the negative control.''' The increase in ABTS oxidized proves laccase activity.]]<br />
<br />
<br />
[[File:Bielefeld2012-Graphen_Bead_BPUL.jpg|500px|left|thumb|'''Fig. 14: Illustration of ABTS oxidation by BPUL with time compared to the negative control.''' The increase in ABTS oxidized proves laccase activity.]]<br />
<br />
<br />
[[File:Bielefeld2012-Graphen_Bead_Halo.jpg|500px|left|thumb|'''Fig. 15: Illustration of ABTS oxidation by BHAL with time compared to the negative control.''' The increase in ABTS oxidized proves laccase activity.]]<br />
<br />
<br />
[[File:Bielefeld2012-Graphen_Bead_Thermo.jpg|500px|left|thumb|'''Fig. 16: Illustration of ABTS oxidation by TTHL with time compared to the negative control.''' The increase in ABTS oxidized proves laccase activity.]]<br />
<br />
<br style="clear: both" /><br />
<br />
</div><br />
<br />
==Literature==<br />
<br />
[1]Fernández-Fernández M ''et al''. (2012) Recent developments and applications of immobilized laccase. ''Biotechnol Adv.'' 2012 Feb 28. [Epub ahead of print] <br />
<br />
[2]P.-P. Champagne and J.A. Ramsay (2007) Reactive blue 19 decolouration by laccase immobilized on silica beads. ''Appl Microbiol Biotechnol''. Oct;77:819–823<br />
<br />
[3]Chantale Cardinal-Watkins and Jim A. Nicell (2011)Enzyme-Catalyzed Oxidation of 17ß-Estradiol Using Immobilized Laccase from Trametes versicolor.'' Enzyme Research,'' vol. 2011, Article ID 725172, 11 pages<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Project/AchievmentsTeam:Bielefeld-Germany/Project/Achievments2012-10-27T01:18:27Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Project Achievements<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
<br />
<b><br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]]<br />
::We successfully produced purified and identified active laccases of ''E. coli'' BL21(CueO named ECOL), ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL), ''Bacillus halodurans'' C-125 laccase (Lbh1 named BHAL) and ''Thermus thermophilus'' HB27 (tthL named TTHL).<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli Results ECOL] <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo Results BHAL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully designed a shuttle vector for site-directed integration in ''P. pastoris'' which allows the production and secretion of a protein of interest. We were able to show that the vector is functioning as expected. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully produced the laccase TVEL5 from ''Trametes versicolor'' in ''P. pastoris'' and showed the activity of the produced enzymes.<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::Successful characterization of the activity of all four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Activity_Analysis_of_ECOL Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Activity_analysis_of_BPUL Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Activity_analysis_of_TTHL Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Activity_Analysis_of_BHAL Results BHAL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We established a method for the degradation of several compounds with the help of our self-produced laccases. The HPLC analysis showed that our produced bacterial laccases are able to degrade estradiol with and without addition of ABTS. BPUL is able to degrade ethinyl estradiol with addition of ABTS. LC-MS measurements showed degradation products which could not be identified but were further analyzed using MS/MS. The resulting products have been discussed with an organic chemist.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#5 Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully immobilized ''Trametes versicolor'' laccase (named TVEL0), ''E. coli'' BL21 laccase (CueO named ECOL) and ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL) and measured their activity. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results TVEL0]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo#Immobilization_of_purified_ECOL,_BPUL,_BHAL_and_TTHL_and_Activity_Tests Results ECOL, BPUL, BHAL and TTHL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created a model which simulates the required laccase amount to degraded harmful substances under real sewage plant conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Modell Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We conducted a feasibility study of our project with sewage plant experts.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created our own database to organize our samples.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Project/Database Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully improved a BioBrick by clarifying its true function. <br />
<br />
::[http://partsregistry.org/Part:BBa_K392014:Experience#User_Reviews Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We did an outstanding outreach work.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview Results]<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|60px|frameless|left]] <br />
:::We won a gold medal.<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|60px|frameless|left]] <br />
:::We qualified for the world campionships<br />
<br style="clear: both" /><br />
</b><br />
<br />
<br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Project/AchievmentsTeam:Bielefeld-Germany/Project/Achievments2012-10-27T01:13:52Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Project Achievements<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
<br />
<b><br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]]<br />
::We successfully produced purified and identified active laccases of ''E. coli'' BL21(CueO named ECOL), ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL), ''Bacillus halodurans'' C-125 laccase (Lbh1 named BHAL) and ''Thermus thermophilus'' HB27 (tthL named TTHL).<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli Results ECOL] <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo Results BHAL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully designed a shuttle vector for site-directed integration in ''P. pastoris'' which allows the production and secretion of a protein of interest. We were able to show that the vector is functioning as expected. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully produced the laccase TVEL5 from ''Trametes versicolor'' in ''P. pastoris'' and showed the activity of the produced enzymes.<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::Successful characterization of the activity of all four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Activity_Analysis_of_ECOL Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Activity_analysis_of_BPUL Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Activity_analysis_of_TTHL Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Activity_Analysis_of_BHAL Results BHAL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We established a method for the degradation of several compounds with the help of our self-produced laccases. The HPLC analysis showed that our produced bacterial laccases are able to degrade estradiol with and without addition of ABTS. BPUL is able to degrade ethinyl estradiol with addition of ABTS. LC-MS measurements showed degradation products which could not be identified but were further analyzed using MS/MS. The resulting products have been discussed with an organic chemist.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#5 Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully immobilized ''Trametes versicolor'' laccase (named TVEL0), ''E. coli'' BL21 laccase (CueO named ECOL) and ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL) and measured their activity. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results TVEL0]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results BPUL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created a model which simulates the required laccase amount to degraded harmful substances under real sewage plant conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Modell Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We conducted a feasibility study of our project with sewage plant experts.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created our own database to organize our samples.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Project/Database Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully improved a BioBrick by clarifying its true function. <br />
<br />
::[http://partsregistry.org/Part:BBa_K392014:Experience#User_Reviews Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We did an outstanding outreach work.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview Results]<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|60px|frameless|left]] <br />
:::We won a gold medal.<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|60px|frameless|left]] <br />
:::We qualified for the world campionships<br />
<br style="clear: both" /><br />
</b><br />
<br />
<br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T01:09:15Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <i>Escherichia coli</i> BL21 (DE3)<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;3. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 3 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 3 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 3.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019.jpg|600px|thumb|left|'''Figure 1:''' SDS-Page of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BBa_K863000] '''A''', [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] '''D''') and 10/12 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 BBa_K863012] '''B''', <partinfo>BBa_K863022</partinfo> '''C'''). Purification of the supernatant via microfiltration, diafiltration and His-trap column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer). The red arrow shows ECOL.]]<br />
<br />
The SDS-Page showed ECOL ('''D''') after purification via His-trap column. Charged are selected samples where peaks were seen in the chromatogram.<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 7 and 8 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 7: The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.''']][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 8: Part of MALDI-TOF Evaluation''']]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 9). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 9:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 10. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 11 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 12 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 10:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 11:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 12:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 13). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 12). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 14). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 13:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 14:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 15:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 15). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 16:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 16). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure x:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 ('''Fig. x, Fig. y, Fig. z'''). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs ('''Fig. x'''). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure x''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure x''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C were analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. X). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Figure X). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012_ percentage.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases in the supernatant relative to the original concentration. The results show that only 0.2% of ECOL laccases are still present in the supernatant, whereas 75% of BPUL remained in the supernatant. This illustrate that almost all ECOL were bound to the beads. On the contrary, only 25% of BPUL laccases were able to bind.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases in the supernatant after incubation with CPC-beads, relative to the original concentration . The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results show that only 0.2% of ECOL laccases are still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012_immo-bpumicoli.jpg|500px|left|thumb|'''Figure 22''': Enzymatic activity of immobilized laccases compared to nontreated laccases.]]<br />
<div style="text-align:justify;"><br />
Figure 22 presents the enzymatic activity of immobilized laccases compared to nontreated laccases. The activity of bound ECOL is very low, even lower than that in the supernatant.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-GermanyTeam:Bielefeld-Germany2012-10-27T00:28:33Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<html><br />
<br />
<!-- Flexslider CSS and JS --><br />
<link rel="stylesheet" href="http://2012.igem-bielefeld.de/includes/wiki/flex/css/flexslider.css" type="text/css"><br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js"></script><br />
<script src="http://2012.igem-bielefeld.de/includes/wiki/flex/js/jquery.flexslider.js"></script><br />
<br />
<!-- Load the flexslider --><br />
<script type="text/javascript" charset="utf-8"><br />
$(window).load(function() {<br />
$('.flexslider').flexslider({<br />
animation: "fade", // slide or fade<br />
controlsContainer: ".flex-container" // the container that holds the flexslider<br />
});<br />
});<br />
</script><br />
<br />
<!-- Slider Container and Images --><br />
<div style="padding:5px; z-index:1;"><br />
<br />
<div class="flexslider"><br />
<ul class="slides"><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Our Plan<br />
</div><br />
<br />
TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE <br><br />
The goal is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds.<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Appoach"><br />
Click here to read more</a> about our project<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/Bielefeld2012_Realization.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Realization<br />
</div><br />
<br />
To realize our plans we first produce the laccases in the different clades and purify them. After this we immobilized and tested their acitivity. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary"><br />
Click here to read more </a> about our methodes...<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d8/Bielefeld2012_Potential.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Potential<br />
</div><br />
<br />
While working with two different clarification plants we confirmed that our project has the opportunity to solve problems with micro contaminations. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant"><br />
Click here to read more</a> about the usage in a clarification plants and micro conterminations...</p> <br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Bielefeld2012_Trametes_Laccase.JPG"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Laccases - Our Teammate<br />
</div><br />
Laccases have the ability to oxidize phenolic and nonphenolic lignin related compounds as well as highly recalcitrant environmental pollutants. This makes them very useful for applications concerning several biotechnological processes. <br />
<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Background#3"><br />
Click here to read more</a> about laccases...<br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class=clear></div><br />
</div><br />
</li><br />
<br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
</div><br />
<br />
<div class=frontpage-content-left><br />
<div id=page-title><br />
<span id=page-title-text><br />
Welcome<br />
</span><br />
</div><br />
<br />
<p align=justify><br />
The birth control pill is a widespread contraception method. However, large amounts of these modified estrogens leave the body again in urine. The conventional methods in sewage treatment plants are unable to treat waste water sufficiently because the most frequently used estrogen ethinyl estradiol is very difficult to break down. As a result, the hormone finds its way into rivers and lakes and accumulates in drinking water with serious consequences for fish and other aquatic life. These range from reproductive and severe developmental disorders to the formation of female sexual characteristics in males. The long-term consequences of increasing estrogen pollution for human beings are still largely unknown. Nonetheless, declining sperm counts and thereby increasing infertility in men living in industrial nations may well relate to this hormonal pollution. In addition, testicular and prostate cancers as well as osteoporosis could be a consequence of overly high concentrations of estrogen in the human body.<br><br><br />
The goal of Bielefeld’s iGEM team is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds. Laccases are copper-containing oxidase enzymes found in many organisms, and one of their properties is the ability to break down a wide range of aromatic and phenolic compounds. For this purpose, genes of various bacterial and eukaryotic laccases should be isolated and expressed in <i>Escherichia coli</i> and <i>Pichia pastoris</i>. The team is aiming to manufacture this enzyme economically and safely with the help of methods from synthetic biology. It should also be possible to extend the concept to other, in part poisonous and carcinogenic pollutants in drinking and waste water, as well as into industrial application, such as in paper and textile industries or even for bioremediation of contaminated soil. </p><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
A Case for Laccase!<br />
</span><br />
</div><br />
<iframe width="550" height="350" align="center" src="http://www.youtube.com/embed/qKOCKYnBsB8" frameborder="0" allowfullscreen></iframe><br />
<br />
<br />
</div><br />
<div class=frontpage-content-right><br />
<div id=page-title><br />
<span id=page-title-text><br />
iGEM Team Bielefeld 2012<br />
</span><br />
</div><br />
<br />
<div align="center" style="z-index:0;"><object width="375" height="220"><param name="movie" value="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><param name="wmode" value="opaque" /><embed src="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="375" height="220" wmode="opaque"></embed></object></div><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Achievements<br />
</span><br />
</div><br />
</html><br />
<p><br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|100px|left]]<br />
<br />
<br />
:::Gold medal at the Europe Regional Jamboree<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|100px|left]]<br />
<br />
<br />
:::Qualified for the World Championships<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of four active bacterial laccases.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Designed and assembled a shuttle vector for site-directed integration in ''P. pastoris''<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of an active fungal laccase (TVEL5).<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful characterization of the activity of four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of the ''Trametes versicolor''-laccase (named TVEL0) and measurement of its activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of four bacterial laccases and measurement of their activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful creation of a model which simulates the required laccase amount to degraded harmful substances under real sewage plant conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Feasibility study of our project.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Creation of a database to organize our samples.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]]<br />
:Improved a BioBrick by clarifying its true function.<br />
</p><br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div class=frontpage-content-full><br />
<div id=page-title><br />
<span id=page-title-text><br />
Our Partners<br />
</span><br />
</div><br />
</div><br />
</body><br />
</html><br />
{| cellspacing="30"<br />
| [[File:Promega logo 180x109.gif|120px|link=http://www.promega.com/]] || <br />
| [[Image:Logo merck.jpg|100px|link=http://www.merckgroup.com/en/index.html]] ||<br />
| [[File:BioCircle.JPG|100px|link=http://www.bio-circle.de/home.html]] || <br />
| [[File:Bielefeld2012 Evonik.jpg|140px|link=http://www.evonik.de]] ||<br />
| [[File:Bielefeld2012_Baxter.png|100px|link=http://www.baxter.de]] <br />
|-<br />
| [[File:Logo knauer.jpg|100px|link=http://www.knauer.net/]] || <br />
| [[File:Logo iit.jpg|100px|link=http://www.iit-biotech.de]] ||<br />
| [[File:logo biometra.jpg|150px|link=http://www.biometra.de ]] ||<br />
| [[File:Bielefeld2012_BIEKUBA.jpg|100px|link=http://www.iit-unibi.de/]] ||<br />
| [[File:Bielefeld2012_Logo_ERASynbio.jpg|100px|link=http://www.erasynbio.net/]]<br />
|- <br />
| [[File:Logo bio-nrw.png|100px|link=http://www.bio.nrw.de/en]] || <br />
| [[File:Bielefeld-Germany-CeBiTec.jpg|100px|link=http://www.cebitec.uni-bielefeld.de/]] || <br />
| [[File: IgemBielefeld_2011_Logo_uni.jpg|100px|link=http://www.uni-bielefeld.de]] || <br />
| [[File:IgemBielefeld_Logo_biofak.jpg|100px|link=http://www.uni-bielefeld.de/biologie]] || <br />
| [[File:Bielefeld-Uniersity-techfak.gif|100px|link=http://www.techfak.uni-bielefeld.de/web/ ]]<br />
|}<br />
<br />
<br />
<br />
<html><br />
<div id="content-footer-box"><br />
<div class="content-footer-box-left"><br />
<div class="about"><br />
<p>About our Wiki</p><br />
<p>Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach. </p><br />
</div><br />
<div class="contact"><br />
<p>Contact Us</p><br />
<p>Universität Bielefeld<br><br />
Universitätsstraße 25<br><br />
D-33615 Bielefeld<br><br><a href="mailto:info@igem-bielefeld.de">info(at)igem-bielefeld.de</a></p><br />
</div><br />
</div><br />
<div class="content-footer-box-right"><br />
<div class="navigate"><br />
<p>Navigate our Wiki</p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany'>Start</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Members'>Team</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Description">Project</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary">Results</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Results">Since Regionals</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview">Human Practice</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Safety'>Safety</a><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Judging'>Judging</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Partner'>Partner</a></p><br />
</div><br />
<div class="facebook"><br />
<div id="fb_bg"><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fpages%2FiGEM_Bielefeld%2F244094752286371&amp;width=292&amp;height=300&amp;colorscheme=light&amp;show_faces=false&amp;border_color&amp;stream=true&amp;header=false" scrolling="no" frameborder="0" style="border:0px; overflow:hidden; width:292px; height:300px;" allowTransparency="false"></iframe><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</html></div>Mohttp://2012.igem.org/Team:Bielefeld-GermanyTeam:Bielefeld-Germany2012-10-27T00:26:43Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<html><br />
<br />
<!-- Flexslider CSS and JS --><br />
<link rel="stylesheet" href="http://2012.igem-bielefeld.de/includes/wiki/flex/css/flexslider.css" type="text/css"><br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js"></script><br />
<script src="http://2012.igem-bielefeld.de/includes/wiki/flex/js/jquery.flexslider.js"></script><br />
<br />
<!-- Load the flexslider --><br />
<script type="text/javascript" charset="utf-8"><br />
$(window).load(function() {<br />
$('.flexslider').flexslider({<br />
animation: "fade", // slide or fade<br />
controlsContainer: ".flex-container" // the container that holds the flexslider<br />
});<br />
});<br />
</script><br />
<br />
<!-- Slider Container and Images --><br />
<div style="padding:5px; z-index:1;"><br />
<br />
<div class="flexslider"><br />
<ul class="slides"><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Our Plan<br />
</div><br />
<br />
TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE <br><br />
The goal is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds.<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Appoach"><br />
Click here to read more</a> about our project<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/Bielefeld2012_Realization.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Realization<br />
</div><br />
<br />
To realize our plans we first produce the laccases in the different clades and purify them. After this we immobilized and tested their acitivity. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary"><br />
Click here to read more </a> about our methodes...<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d8/Bielefeld2012_Potential.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Potential<br />
</div><br />
<br />
While working with two different clarification plants we confirmed that our project has the opportunity to solve problems with micro contaminations. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant"><br />
Click here to read more</a> about the usage in a clarification plants and micro conterminations...</p> <br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Bielefeld2012_Trametes_Laccase.JPG"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Laccases - Our Teammate<br />
</div><br />
Laccases have the ability to oxidize phenolic and nonphenolic lignin related compounds as well as highly recalcitrant environmental pollutants. This makes them very useful for applications concerning several biotechnological processes. <br />
<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Background#3"><br />
Click here to read more</a> about laccases...<br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class=clear></div><br />
</div><br />
</li><br />
<br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
</div><br />
<br />
<div class=frontpage-content-left><br />
<div id=page-title><br />
<span id=page-title-text><br />
Welcome<br />
</span><br />
</div><br />
<br />
<p align=justify><br />
The birth control pill is a widespread contraception method. However, large amounts of these modified estrogens leave the body again in urine. The conventional methods in sewage treatment plants are unable to treat waste water sufficiently because the most frequently used estrogen ethinyl estradiol is very difficult to break down. As a result, the hormone finds its way into rivers and lakes and accumulates in drinking water with serious consequences for fish and other aquatic life. These range from reproductive and severe developmental disorders to the formation of female sexual characteristics in males. The long-term consequences of increasing estrogen pollution for human beings are still largely unknown. Nonetheless, declining sperm counts and thereby increasing infertility in men living in industrial nations may well relate to this hormonal pollution. In addition, testicular and prostate cancers as well as osteoporosis could be a consequence of overly high concentrations of estrogen in the human body.<br><br><br />
The goal of Bielefeld’s iGEM team is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds. Laccases are copper-containing oxidase enzymes found in many organisms, and one of their properties is the ability to break down a wide range of aromatic and phenolic compounds. For this purpose, genes of various bacterial and eukaryotic laccases should be isolated and expressed in <i>Escherichia coli</i> and <i>Pichia pastoris</i>. The team is aiming to manufacture this enzyme economically and safely with the help of methods from synthetic biology. It should also be possible to extend the concept to other, in part poisonous and carcinogenic pollutants in drinking and waste water, as well as into industrial application, such as in paper and textile industries or even for bioremediation of contaminated soil. </p><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
A Case for Laccase!<br />
</span><br />
</div><br />
<iframe width="550" height="350" align="center" src="http://www.youtube.com/embed/qKOCKYnBsB8" frameborder="0" allowfullscreen></iframe><br />
<br />
<br />
</div><br />
<div class=frontpage-content-right><br />
<div id=page-title><br />
<span id=page-title-text><br />
iGEM Team Bielefeld 2012<br />
</span><br />
</div><br />
<br />
<div align="center" style="z-index:0;"><object width="375" height="220"><param name="movie" value="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><param name="wmode" value="opaque" /><embed src="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="375" height="220" wmode="opaque"></embed></object></div><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Achievements<br />
</span><br />
</div><br />
</html><br />
<p><br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|100px|left]]<br />
<br />
<br />
:::Gold medal at the Europe Regional Jamboree<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|100px|left]]<br />
<br />
<br />
:::Qualified for the World Championships<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of four active bacterial laccases.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Designed and assembled a shuttle vector for site-directed integration in ''P. pastoris''<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of a active fungal laccase (TVEL5).<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful characterization of the activity of four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of the ''Trametes versicolor''-laccase (named TVEL0) and measurement of its activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of four bacterial laccases and measurement of their activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful creation of a model which simulates the required laccase amount to degraded harmful substances under real sewage plant conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Feasibility study of our project.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Creation of a database to organize our samples.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]]<br />
:Improved a BioBrick by clarifying its true function.<br />
</p><br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div class=frontpage-content-full><br />
<div id=page-title><br />
<span id=page-title-text><br />
Our Partners<br />
</span><br />
</div><br />
</div><br />
</body><br />
</html><br />
{| cellspacing="30"<br />
| [[File:Promega logo 180x109.gif|120px|link=http://www.promega.com/]] || <br />
| [[Image:Logo merck.jpg|100px|link=http://www.merckgroup.com/en/index.html]] ||<br />
| [[File:BioCircle.JPG|100px|link=http://www.bio-circle.de/home.html]] || <br />
| [[File:Bielefeld2012 Evonik.jpg|140px|link=http://www.evonik.de]] ||<br />
| [[File:Bielefeld2012_Baxter.png|100px|link=http://www.baxter.de]] <br />
|-<br />
| [[File:Logo knauer.jpg|100px|link=http://www.knauer.net/]] || <br />
| [[File:Logo iit.jpg|100px|link=http://www.iit-biotech.de]] ||<br />
| [[File:logo biometra.jpg|150px|link=http://www.biometra.de ]] ||<br />
| [[File:Bielefeld2012_BIEKUBA.jpg|100px|link=http://www.iit-unibi.de/]] ||<br />
| [[File:Bielefeld2012_Logo_ERASynbio.jpg|100px|link=http://www.erasynbio.net/]]<br />
|- <br />
| [[File:Logo bio-nrw.png|100px|link=http://www.bio.nrw.de/en]] || <br />
| [[File:Bielefeld-Germany-CeBiTec.jpg|100px|link=http://www.cebitec.uni-bielefeld.de/]] || <br />
| [[File: IgemBielefeld_2011_Logo_uni.jpg|100px|link=http://www.uni-bielefeld.de]] || <br />
| [[File:IgemBielefeld_Logo_biofak.jpg|100px|link=http://www.uni-bielefeld.de/biologie]] || <br />
| [[File:Bielefeld-Uniersity-techfak.gif|100px|link=http://www.techfak.uni-bielefeld.de/web/ ]]<br />
|}<br />
<br />
<br />
<br />
<html><br />
<div id="content-footer-box"><br />
<div class="content-footer-box-left"><br />
<div class="about"><br />
<p>About our Wiki</p><br />
<p>Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach. </p><br />
</div><br />
<div class="contact"><br />
<p>Contact Us</p><br />
<p>Universität Bielefeld<br><br />
Universitätsstraße 25<br><br />
D-33615 Bielefeld<br><br><a href="mailto:info@igem-bielefeld.de">info(at)igem-bielefeld.de</a></p><br />
</div><br />
</div><br />
<div class="content-footer-box-right"><br />
<div class="navigate"><br />
<p>Navigate our Wiki</p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany'>Start</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Members'>Team</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Description">Project</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary">Results</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Results">Since Regionals</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview">Human Practice</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Safety'>Safety</a><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Judging'>Judging</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Partner'>Partner</a></p><br />
</div><br />
<div class="facebook"><br />
<div id="fb_bg"><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fpages%2FiGEM_Bielefeld%2F244094752286371&amp;width=292&amp;height=300&amp;colorscheme=light&amp;show_faces=false&amp;border_color&amp;stream=true&amp;header=false" scrolling="no" frameborder="0" style="border:0px; overflow:hidden; width:292px; height:300px;" allowTransparency="false"></iframe><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</html></div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Project/AchievmentsTeam:Bielefeld-Germany/Project/Achievments2012-10-27T00:21:21Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Project Achievements<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
<br />
<b><br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]]<br />
::We successfully produced purified and identified active laccases of ''E. coli'' BL21(CueO named ECOL), ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL), ''Bacillus halodurans'' C-125 laccase (Lbh1 named BHAL) and ''Thermus thermophilus'' HB27 (tthL named TTHL).<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli Results ECOL] <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo Results BHAL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully designed a shuttle vector for site-directed integration in ''P. pastoris'' which allows the production and secretion of a protein of interest. We were able to show that the vector is functioning as expected. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully produced the laccase TVEL5 from ''Trametes versicolor'' in ''P. pastoris'' and showed the activity of the produced enzymes.<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::Successful characterization of the activity of all four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Activity_Analysis_of_ECOL Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Activity_analysis_of_BPUL Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Activity_analysis_of_TTHL Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Activity_Analysis_of_BHAL Results BHAL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We established a method for the degradation of several compounds with the help of our self-produced laccases. The HPLC analysis showed that our produced bacterial laccases are able to degrade estradiol with and without addition of ABTS. BPUL is able to degrade ethinyl estradiol with addition of ABTS. LC-MS measurements showed degradation products which could not be identified but were further analyzed using MS/MS. The resulting products have been discussed with an organic chemist.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#6 Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully immobilized ''Trametes versicolor'' laccase (named TVEL0), ''E. coli'' BL21 laccase (CueO named ECOL) and ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL) and measured their activity. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results TVEL0]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results BPUL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created a model which simulates the required laccase amount to degraded harmful substances under real sewage plant conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Modell Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We conducted a feasibility study of our project with sewage plant experts.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created our own database to organize our samples.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Project/Database Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully improved a BioBrick by clarifying its true function. <br />
<br />
::[http://partsregistry.org/Part:BBa_K392014:Experience#User_Reviews Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We did an outstanding outreach work.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview Results]<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|60px|frameless|left]] <br />
:::We won a gold medal.<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|60px|frameless|left]] <br />
:::We qualified for the world campionships<br />
<br style="clear: both" /><br />
</b><br />
<br />
<br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Project/AchievmentsTeam:Bielefeld-Germany/Project/Achievments2012-10-27T00:20:13Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Project Achievements<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
<br />
<b><br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]]<br />
::We successfully produced purified and identified active laccases of ''E. coli'' BL21(CueO named ECOL), ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL), ''Bacillus halodurans'' C-125 laccase (Lbh1 named BHAL) and ''Thermus thermophilus'' HB27 (tthL named TTHL).<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli Results ECOL] <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo Results BHAL]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully designed a shuttle vector for site-directed integration in ''P. pastoris'' which allows the production and secretion of a protein of interest. We were able to show that the vector is functioning as expected. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully produced the laccase TVEL5 from ''Trametes versicolor'' in ''P. pastoris'' and showed the activity of the produced enzymes.<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::Successful characterization of the activity of all four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Activity_Analysis_of_ECOL Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Activity_analysis_of_BPUL Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Activity_analysis_of_TTHL Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Activity_Analysis_of_BHAL Results BHAL]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We established a method for the degradation of several compounds with the help of our self-produced laccases. The HPLC analysis showed that our produced bacterial laccases are able to degrade estradiol with and without addition of ABTS. BPUL is able to degrade ethinyl estradiol with addition of ABTS. LC-MS measurements showed degradation products which could not be identified but were further analyzed using MS/MS. The resulting products have been discussed with an organic chemist.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#6 Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully immobilized ''Trametes versicolor'' laccase (named TVEL0), ''E. coli'' BL21 laccase (CueO named ECOL) and ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL) and measured their activity. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results TVEL0]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results BPUL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created a model which simulates the required laccase amount to degraded harmful substances under real sewage plant conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Modell Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We conducted a feasibility study of our project with sewage plant experts.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created our own database to organize our samples.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Project/Database Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully improved a BioBrick by clarifying its true function. <br />
<br />
::[http://partsregistry.org/Part:BBa_K392014:Experience#User_Reviews Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We did an outstanding outreach work.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview Results]<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|60px|frameless|left]] <br />
:::We won a gold medal.<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|60px|frameless|left]] <br />
:::We qualified for the world campionships<br />
<br style="clear: both" /><br />
</b><br />
<br />
<br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-GermanyTeam:Bielefeld-Germany2012-10-27T00:17:17Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<html><br />
<br />
<!-- Flexslider CSS and JS --><br />
<link rel="stylesheet" href="http://2012.igem-bielefeld.de/includes/wiki/flex/css/flexslider.css" type="text/css"><br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js"></script><br />
<script src="http://2012.igem-bielefeld.de/includes/wiki/flex/js/jquery.flexslider.js"></script><br />
<br />
<!-- Load the flexslider --><br />
<script type="text/javascript" charset="utf-8"><br />
$(window).load(function() {<br />
$('.flexslider').flexslider({<br />
animation: "fade", // slide or fade<br />
controlsContainer: ".flex-container" // the container that holds the flexslider<br />
});<br />
});<br />
</script><br />
<br />
<!-- Slider Container and Images --><br />
<div style="padding:5px; z-index:1;"><br />
<br />
<div class="flexslider"><br />
<ul class="slides"><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Our Plan<br />
</div><br />
<br />
TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE <br><br />
The goal is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds.<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Appoach"><br />
Click here to read more</a> about our project<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/Bielefeld2012_Realization.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Realization<br />
</div><br />
<br />
To realize our plans we first produce the laccases in the different clades and purify them. After this we immobilized and tested their acitivity. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary"><br />
Click here to read more </a> about our methodes...<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d8/Bielefeld2012_Potential.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Potential<br />
</div><br />
<br />
While working with two different clarification plants we confirmed that our project has the opportunity to solve problems with micro contaminations. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant"><br />
Click here to read more</a> about the usage in a clarification plants and micro conterminations...</p> <br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Bielefeld2012_Trametes_Laccase.JPG"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Laccases - Our Teammate<br />
</div><br />
Laccases have the ability to oxidize phenolic and nonphenolic lignin related compounds as well as highly recalcitrant environmental pollutants. This makes them very useful for applications concerning several biotechnological processes. <br />
<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Background#3"><br />
Click here to read more</a> about laccases...<br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class=clear></div><br />
</div><br />
</li><br />
<br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
</div><br />
<br />
<div class=frontpage-content-left><br />
<div id=page-title><br />
<span id=page-title-text><br />
Welcome<br />
</span><br />
</div><br />
<br />
<p align=justify><br />
The birth control pill is a widespread contraception method. However, large amounts of these modified estrogens leave the body again in urine. The conventional methods in sewage treatment plants are unable to treat waste water sufficiently because the most frequently used estrogen ethinyl estradiol is very difficult to break down. As a result, the hormone finds its way into rivers and lakes and accumulates in drinking water with serious consequences for fish and other aquatic life. These range from reproductive and severe developmental disorders to the formation of female sexual characteristics in males. The long-term consequences of increasing estrogen pollution for human beings are still largely unknown. Nonetheless, declining sperm counts and thereby increasing infertility in men living in industrial nations may well relate to this hormonal pollution. In addition, testicular and prostate cancers as well as osteoporosis could be a consequence of overly high concentrations of estrogen in the human body.<br><br><br />
The goal of Bielefeld’s iGEM team is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds. Laccases are copper-containing oxidase enzymes found in many organisms, and one of their properties is the ability to break down a wide range of aromatic and phenolic compounds. For this purpose, genes of various bacterial and eukaryotic laccases should be isolated and expressed in <i>Escherichia coli</i> and <i>Pichia pastoris</i>. The team is aiming to manufacture this enzyme economically and safely with the help of methods from synthetic biology. It should also be possible to extend the concept to other, in part poisonous and carcinogenic pollutants in drinking and waste water, as well as into industrial application, such as in paper and textile industries or even for bioremediation of contaminated soil. </p><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
A Case for Laccase!<br />
</span><br />
</div><br />
<iframe width="550" height="350" align="center" src="http://www.youtube.com/embed/qKOCKYnBsB8" frameborder="0" allowfullscreen></iframe><br />
<br />
<br />
</div><br />
<div class=frontpage-content-right><br />
<div id=page-title><br />
<span id=page-title-text><br />
iGEM Team Bielefeld 2012<br />
</span><br />
</div><br />
<br />
<div align="center" style="z-index:0;"><object width="375" height="220"><param name="movie" value="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><param name="wmode" value="opaque" /><embed src="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="375" height="220" wmode="opaque"></embed></object></div><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Achievements<br />
</span><br />
</div><br />
</html><br />
<p><br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|50px|left]]<br />
::Gold medal in Amsterdam.<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|50px|left]]<br />
::Qualified for the World Championships<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of four active bacterial laccases.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Designed and assembled a shuttle vector for site-directed integration in ''P. pastoris''<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of a active fungal laccase (TVEL5).<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful characterization of the activity of four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of the ''Trametes versicolor''-laccase (named TVEL0) and measurement of its activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of four bacterial laccases and measurement of their activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful creation of a model which simulates the required laccase amount to degraded harmful substances under real sewage plant conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Feasibility study of our project.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Creation of a database to organize our samples.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]]<br />
:Improved a BioBrick by clarifying its true function.<br />
</p><br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div class=frontpage-content-full><br />
<div id=page-title><br />
<span id=page-title-text><br />
Our Partners<br />
</span><br />
</div><br />
</div><br />
</body><br />
</html><br />
{| cellspacing="30"<br />
| [[File:Promega logo 180x109.gif|120px|link=http://www.promega.com/]] || <br />
| [[Image:Logo merck.jpg|100px|link=http://www.merckgroup.com/en/index.html]] ||<br />
| [[File:BioCircle.JPG|100px|link=http://www.bio-circle.de/home.html]] || <br />
| [[File:Bielefeld2012 Evonik.jpg|140px|link=http://www.evonik.de]] ||<br />
| [[File:Bielefeld2012_Baxter.png|100px|link=http://www.baxter.de]] <br />
|-<br />
| [[File:Logo knauer.jpg|100px|link=http://www.knauer.net/]] || <br />
| [[File:Logo iit.jpg|100px|link=http://www.iit-biotech.de]] ||<br />
| [[File:logo biometra.jpg|150px|link=http://www.biometra.de ]] ||<br />
| [[File:Bielefeld2012_BIEKUBA.jpg|100px|link=http://www.iit-unibi.de/]] ||<br />
| [[File:Bielefeld2012_Logo_ERASynbio.jpg|100px|link=http://www.erasynbio.net/]]<br />
|- <br />
| [[File:Logo bio-nrw.png|100px|link=http://www.bio.nrw.de/en]] || <br />
| [[File:Bielefeld-Germany-CeBiTec.jpg|100px|link=http://www.cebitec.uni-bielefeld.de/]] || <br />
| [[File: IgemBielefeld_2011_Logo_uni.jpg|100px|link=http://www.uni-bielefeld.de]] || <br />
| [[File:IgemBielefeld_Logo_biofak.jpg|100px|link=http://www.uni-bielefeld.de/biologie]] || <br />
| [[File:Bielefeld-Uniersity-techfak.gif|100px|link=http://www.techfak.uni-bielefeld.de/web/ ]]<br />
|}<br />
<br />
<br />
<br />
<html><br />
<div id="content-footer-box"><br />
<div class="content-footer-box-left"><br />
<div class="about"><br />
<p>About our Wiki</p><br />
<p>Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach. </p><br />
</div><br />
<div class="contact"><br />
<p>Contact Us</p><br />
<p>Universität Bielefeld<br><br />
Universitätsstraße 25<br><br />
D-33615 Bielefeld<br><br><a href="mailto:info@igem-bielefeld.de">info(at)igem-bielefeld.de</a></p><br />
</div><br />
</div><br />
<div class="content-footer-box-right"><br />
<div class="navigate"><br />
<p>Navigate our Wiki</p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany'>Start</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Members'>Team</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Description">Project</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary">Results</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Results">Since Regionals</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview">Human Practice</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Safety'>Safety</a><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Judging'>Judging</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Partner'>Partner</a></p><br />
</div><br />
<div class="facebook"><br />
<div id="fb_bg"><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fpages%2FiGEM_Bielefeld%2F244094752286371&amp;width=292&amp;height=300&amp;colorscheme=light&amp;show_faces=false&amp;border_color&amp;stream=true&amp;header=false" scrolling="no" frameborder="0" style="border:0px; overflow:hidden; width:292px; height:300px;" allowTransparency="false"></iframe><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</html></div>Mohttp://2012.igem.org/Team:Bielefeld-GermanyTeam:Bielefeld-Germany2012-10-27T00:15:43Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<html><br />
<br />
<!-- Flexslider CSS and JS --><br />
<link rel="stylesheet" href="http://2012.igem-bielefeld.de/includes/wiki/flex/css/flexslider.css" type="text/css"><br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js"></script><br />
<script src="http://2012.igem-bielefeld.de/includes/wiki/flex/js/jquery.flexslider.js"></script><br />
<br />
<!-- Load the flexslider --><br />
<script type="text/javascript" charset="utf-8"><br />
$(window).load(function() {<br />
$('.flexslider').flexslider({<br />
animation: "fade", // slide or fade<br />
controlsContainer: ".flex-container" // the container that holds the flexslider<br />
});<br />
});<br />
</script><br />
<br />
<!-- Slider Container and Images --><br />
<div style="padding:5px; z-index:1;"><br />
<br />
<div class="flexslider"><br />
<ul class="slides"><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Our Plan<br />
</div><br />
<br />
TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE <br><br />
The goal is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds.<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Appoach"><br />
Click here to read more</a> about our project<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/Bielefeld2012_Realization.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Realization<br />
</div><br />
<br />
To realize our plans we first produce the laccases in the different clades and purify them. After this we immobilized and tested their acitivity. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary"><br />
Click here to read more </a> about our methodes...<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d8/Bielefeld2012_Potential.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Potential<br />
</div><br />
<br />
While working with two different clarification plants we confirmed that our project has the opportunity to solve problems with micro contaminations. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant"><br />
Click here to read more</a> about the usage in a clarification plants and micro conterminations...</p> <br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Bielefeld2012_Trametes_Laccase.JPG"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Laccases - Our Teammate<br />
</div><br />
Laccases have the ability to oxidize phenolic and nonphenolic lignin related compounds as well as highly recalcitrant environmental pollutants. This makes them very useful for applications concerning several biotechnological processes. <br />
<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Background#3"><br />
Click here to read more</a> about laccases...<br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class=clear></div><br />
</div><br />
</li><br />
<br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
</div><br />
<br />
<div class=frontpage-content-left><br />
<div id=page-title><br />
<span id=page-title-text><br />
Welcome<br />
</span><br />
</div><br />
<br />
<p align=justify><br />
The birth control pill is a widespread contraception method. However, large amounts of these modified estrogens leave the body again in urine. The conventional methods in sewage treatment plants are unable to treat waste water sufficiently because the most frequently used estrogen ethinyl estradiol is very difficult to break down. As a result, the hormone finds its way into rivers and lakes and accumulates in drinking water with serious consequences for fish and other aquatic life. These range from reproductive and severe developmental disorders to the formation of female sexual characteristics in males. The long-term consequences of increasing estrogen pollution for human beings are still largely unknown. Nonetheless, declining sperm counts and thereby increasing infertility in men living in industrial nations may well relate to this hormonal pollution. In addition, testicular and prostate cancers as well as osteoporosis could be a consequence of overly high concentrations of estrogen in the human body.<br><br><br />
The goal of Bielefeld’s iGEM team is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds. Laccases are copper-containing oxidase enzymes found in many organisms, and one of their properties is the ability to break down a wide range of aromatic and phenolic compounds. For this purpose, genes of various bacterial and eukaryotic laccases should be isolated and expressed in <i>Escherichia coli</i> and <i>Pichia pastoris</i>. The team is aiming to manufacture this enzyme economically and safely with the help of methods from synthetic biology. It should also be possible to extend the concept to other, in part poisonous and carcinogenic pollutants in drinking and waste water, as well as into industrial application, such as in paper and textile industries or even for bioremediation of contaminated soil. </p><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
A Case for Laccase!<br />
</span><br />
</div><br />
<iframe width="550" height="350" align="center" src="http://www.youtube.com/embed/qKOCKYnBsB8" frameborder="0" allowfullscreen></iframe><br />
<br />
<br />
</div><br />
<div class=frontpage-content-right><br />
<div id=page-title><br />
<span id=page-title-text><br />
iGEM Team Bielefeld 2012<br />
</span><br />
</div><br />
<br />
<div align="center" style="z-index:0;"><object width="375" height="220"><param name="movie" value="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><param name="wmode" value="opaque" /><embed src="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="375" height="220" wmode="opaque"></embed></object></div><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Achievements<br />
</span><br />
</div><br />
</html><br />
<p><br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|50px|left]]<br />
::Gold medal in Amsterdam.<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|50px|left]]<br />
::Qualified for the World Championships<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Creation of a database to organize our samples.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of four active bacterial laccases.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Designed and assembled a shuttle vector for site-directed integration in ''P. pastoris''<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of a active fungal laccase (TVEL5).<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful characterization of the activity of four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of the ''Trametes versicolor''-laccase (named TVEL0) and measurement of its activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of four bacterial laccases and measurement of their activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful creation of a model which simulates the required laccase amount to degraded harmful substances under real sewage plant conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Feasibility study of our project.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]]<br />
:Improved a BioBrick by clarifying its true function.<br />
</p><br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div class=frontpage-content-full><br />
<div id=page-title><br />
<span id=page-title-text><br />
Our Partners<br />
</span><br />
</div><br />
</div><br />
</body><br />
</html><br />
{| cellspacing="30"<br />
| [[File:Promega logo 180x109.gif|120px|link=http://www.promega.com/]] || <br />
| [[Image:Logo merck.jpg|100px|link=http://www.merckgroup.com/en/index.html]] ||<br />
| [[File:BioCircle.JPG|100px|link=http://www.bio-circle.de/home.html]] || <br />
| [[File:Bielefeld2012 Evonik.jpg|140px|link=http://www.evonik.de]] ||<br />
| [[File:Bielefeld2012_Baxter.png|100px|link=http://www.baxter.de]] <br />
|-<br />
| [[File:Logo knauer.jpg|100px|link=http://www.knauer.net/]] || <br />
| [[File:Logo iit.jpg|100px|link=http://www.iit-biotech.de]] ||<br />
| [[File:logo biometra.jpg|150px|link=http://www.biometra.de ]] ||<br />
| [[File:Bielefeld2012_BIEKUBA.jpg|100px|link=http://www.iit-unibi.de/]] ||<br />
| [[File:Bielefeld2012_Logo_ERASynbio.jpg|100px|link=http://www.erasynbio.net/]]<br />
|- <br />
| [[File:Logo bio-nrw.png|100px|link=http://www.bio.nrw.de/en]] || <br />
| [[File:Bielefeld-Germany-CeBiTec.jpg|100px|link=http://www.cebitec.uni-bielefeld.de/]] || <br />
| [[File: IgemBielefeld_2011_Logo_uni.jpg|100px|link=http://www.uni-bielefeld.de]] || <br />
| [[File:IgemBielefeld_Logo_biofak.jpg|100px|link=http://www.uni-bielefeld.de/biologie]] || <br />
| [[File:Bielefeld-Uniersity-techfak.gif|100px|link=http://www.techfak.uni-bielefeld.de/web/ ]]<br />
|}<br />
<br />
<br />
<br />
<html><br />
<div id="content-footer-box"><br />
<div class="content-footer-box-left"><br />
<div class="about"><br />
<p>About our Wiki</p><br />
<p>Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach. </p><br />
</div><br />
<div class="contact"><br />
<p>Contact Us</p><br />
<p>Universität Bielefeld<br><br />
Universitätsstraße 25<br><br />
D-33615 Bielefeld<br><br><a href="mailto:info@igem-bielefeld.de">info(at)igem-bielefeld.de</a></p><br />
</div><br />
</div><br />
<div class="content-footer-box-right"><br />
<div class="navigate"><br />
<p>Navigate our Wiki</p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany'>Start</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Members'>Team</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Description">Project</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary">Results</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Results">Since Regionals</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview">Human Practice</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Safety'>Safety</a><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Judging'>Judging</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Partner'>Partner</a></p><br />
</div><br />
<div class="facebook"><br />
<div id="fb_bg"><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fpages%2FiGEM_Bielefeld%2F244094752286371&amp;width=292&amp;height=300&amp;colorscheme=light&amp;show_faces=false&amp;border_color&amp;stream=true&amp;header=false" scrolling="no" frameborder="0" style="border:0px; overflow:hidden; width:292px; height:300px;" allowTransparency="false"></iframe><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</html></div>Mohttp://2012.igem.org/Team:Bielefeld-GermanyTeam:Bielefeld-Germany2012-10-27T00:12:49Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<html><br />
<br />
<!-- Flexslider CSS and JS --><br />
<link rel="stylesheet" href="http://2012.igem-bielefeld.de/includes/wiki/flex/css/flexslider.css" type="text/css"><br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js"></script><br />
<script src="http://2012.igem-bielefeld.de/includes/wiki/flex/js/jquery.flexslider.js"></script><br />
<br />
<!-- Load the flexslider --><br />
<script type="text/javascript" charset="utf-8"><br />
$(window).load(function() {<br />
$('.flexslider').flexslider({<br />
animation: "fade", // slide or fade<br />
controlsContainer: ".flex-container" // the container that holds the flexslider<br />
});<br />
});<br />
</script><br />
<br />
<!-- Slider Container and Images --><br />
<div style="padding:5px; z-index:1;"><br />
<br />
<div class="flexslider"><br />
<ul class="slides"><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Our Plan<br />
</div><br />
<br />
TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE <br><br />
The goal is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds.<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Appoach"><br />
Click here to read more</a> about our project<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/Bielefeld2012_Realization.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Realization<br />
</div><br />
<br />
To realize our plans we first produce the laccases in the different clades and purify them. After this we immobilized and tested their acitivity. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary"><br />
Click here to read more </a> about our methodes...<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d8/Bielefeld2012_Potential.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Potential<br />
</div><br />
<br />
While working with two different clarification plants we confirmed that our project has the opportunity to solve problems with micro contaminations. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant"><br />
Click here to read more</a> about the usage in a clarification plants and micro conterminations...</p> <br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Bielefeld2012_Trametes_Laccase.JPG"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Laccases - Our Teammate<br />
</div><br />
Laccases have the ability to oxidize phenolic and nonphenolic lignin related compounds as well as highly recalcitrant environmental pollutants. This makes them very useful for applications concerning several biotechnological processes. <br />
<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Background#3"><br />
Click here to read more</a> about laccases...<br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class=clear></div><br />
</div><br />
</li><br />
<br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
</div><br />
<br />
<div class=frontpage-content-left><br />
<div id=page-title><br />
<span id=page-title-text><br />
Welcome<br />
</span><br />
</div><br />
<br />
<p align=justify><br />
The birth control pill is a widespread contraception method. However, large amounts of these modified estrogens leave the body again in urine. The conventional methods in sewage treatment plants are unable to treat waste water sufficiently because the most frequently used estrogen ethinyl estradiol is very difficult to break down. As a result, the hormone finds its way into rivers and lakes and accumulates in drinking water with serious consequences for fish and other aquatic life. These range from reproductive and severe developmental disorders to the formation of female sexual characteristics in males. The long-term consequences of increasing estrogen pollution for human beings are still largely unknown. Nonetheless, declining sperm counts and thereby increasing infertility in men living in industrial nations may well relate to this hormonal pollution. In addition, testicular and prostate cancers as well as osteoporosis could be a consequence of overly high concentrations of estrogen in the human body.<br><br><br />
The goal of Bielefeld’s iGEM team is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds. Laccases are copper-containing oxidase enzymes found in many organisms, and one of their properties is the ability to break down a wide range of aromatic and phenolic compounds. For this purpose, genes of various bacterial and eukaryotic laccases should be isolated and expressed in <i>Escherichia coli</i> and <i>Pichia pastoris</i>. The team is aiming to manufacture this enzyme economically and safely with the help of methods from synthetic biology. It should also be possible to extend the concept to other, in part poisonous and carcinogenic pollutants in drinking and waste water, as well as into industrial application, such as in paper and textile industries or even for bioremediation of contaminated soil. </p><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
A Case for Laccase!<br />
</span><br />
</div><br />
<iframe width="550" height="350" align="center" src="http://www.youtube.com/embed/qKOCKYnBsB8" frameborder="0" allowfullscreen></iframe><br />
<br />
<br />
</div><br />
<div class=frontpage-content-right><br />
<div id=page-title><br />
<span id=page-title-text><br />
iGEM Team Bielefeld 2012<br />
</span><br />
</div><br />
<br />
<div align="center" style="z-index:0;"><object width="375" height="220"><param name="movie" value="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><param name="wmode" value="opaque" /><embed src="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="375" height="220" wmode="opaque"></embed></object></div><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Achievements<br />
</span><br />
</div><br />
</html><br />
<p><br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|50px|left]]<br />
::Gold medal in Amsterdam.<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|50px|left]]<br />
::Qualified for the World Championships<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Creation of a database to organize our samples.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of four active bacterial laccases.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Designed and assembled a shuttle vector for site-directed integration in ''P. pastoris''<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of a active fungal laccase (TVEL5).<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful characterization of the activity of four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of the ''Trametes versicolor''-laccase (named TVEL0) and measurement of its activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of four bacterial laccases and measurement of their activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Feasibility study of our project.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful creation of a model which simulates the required laccase amount to degraded harmful substances under real sewage plant conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]]<br />
:Improved a BioBrick by clarifying its true function.<br />
</p><br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div class=frontpage-content-full><br />
<div id=page-title><br />
<span id=page-title-text><br />
Our Partners<br />
</span><br />
</div><br />
</div><br />
</body><br />
</html><br />
{| cellspacing="30"<br />
| [[File:Promega logo 180x109.gif|120px|link=http://www.promega.com/]] || <br />
| [[Image:Logo merck.jpg|100px|link=http://www.merckgroup.com/en/index.html]] ||<br />
| [[File:BioCircle.JPG|100px|link=http://www.bio-circle.de/home.html]] || <br />
| [[File:Bielefeld2012 Evonik.jpg|140px|link=http://www.evonik.de]] ||<br />
| [[File:Bielefeld2012_Baxter.png|100px|link=http://www.baxter.de]] <br />
|-<br />
| [[File:Logo knauer.jpg|100px|link=http://www.knauer.net/]] || <br />
| [[File:Logo iit.jpg|100px|link=http://www.iit-biotech.de]] ||<br />
| [[File:logo biometra.jpg|150px|link=http://www.biometra.de ]] ||<br />
| [[File:Bielefeld2012_BIEKUBA.jpg|100px|link=http://www.iit-unibi.de/]] ||<br />
| [[File:Bielefeld2012_Logo_ERASynbio.jpg|100px|link=http://www.erasynbio.net/]]<br />
|- <br />
| [[File:Logo bio-nrw.png|100px|link=http://www.bio.nrw.de/en]] || <br />
| [[File:Bielefeld-Germany-CeBiTec.jpg|100px|link=http://www.cebitec.uni-bielefeld.de/]] || <br />
| [[File: IgemBielefeld_2011_Logo_uni.jpg|100px|link=http://www.uni-bielefeld.de]] || <br />
| [[File:IgemBielefeld_Logo_biofak.jpg|100px|link=http://www.uni-bielefeld.de/biologie]] || <br />
| [[File:Bielefeld-Uniersity-techfak.gif|100px|link=http://www.techfak.uni-bielefeld.de/web/ ]]<br />
|}<br />
<br />
<br />
<br />
<html><br />
<div id="content-footer-box"><br />
<div class="content-footer-box-left"><br />
<div class="about"><br />
<p>About our Wiki</p><br />
<p>Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach. </p><br />
</div><br />
<div class="contact"><br />
<p>Contact Us</p><br />
<p>Universität Bielefeld<br><br />
Universitätsstraße 25<br><br />
D-33615 Bielefeld<br><br><a href="mailto:info@igem-bielefeld.de">info(at)igem-bielefeld.de</a></p><br />
</div><br />
</div><br />
<div class="content-footer-box-right"><br />
<div class="navigate"><br />
<p>Navigate our Wiki</p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany'>Start</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Members'>Team</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Description">Project</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary">Results</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Results">Since Regionals</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview">Human Practice</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Safety'>Safety</a><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Judging'>Judging</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Partner'>Partner</a></p><br />
</div><br />
<div class="facebook"><br />
<div id="fb_bg"><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fpages%2FiGEM_Bielefeld%2F244094752286371&amp;width=292&amp;height=300&amp;colorscheme=light&amp;show_faces=false&amp;border_color&amp;stream=true&amp;header=false" scrolling="no" frameborder="0" style="border:0px; overflow:hidden; width:292px; height:300px;" allowTransparency="false"></iframe><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</html></div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Project/AchievmentsTeam:Bielefeld-Germany/Project/Achievments2012-10-27T00:12:27Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Project Achievements<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
<br />
<b><br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]]<br />
::We successfully produced purified and identified active laccases of ''E. coli'' BL21(CueO named ECOL), ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL), ''Bacillus halodurans'' C-125 laccase (Lbh1 named BHAL) and ''Thermus thermophilus'' HB27 (tthL named TTHL).<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli Results ECOL] <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo Results BHAL]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully designed a shuttle vector for site-directed integration in ''P. pastoris'' which allows the production and secretion of a protein of interest. We were able to show that the vector is functioning as expected. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully produced the laccase TVEL5 from ''Trametes versicolor'' in ''P. pastoris'' and showed the activity of the produced enzymes.<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::Successful characterization of the activity of all four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Activity_Analysis_of_ECOL Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Activity_analysis_of_BPUL Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Activity_analysis_of_TTHL Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Activity_Analysis_of_BHAL Results BHAL]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We established a method for the degradation of several compounds with the help of our self-produced laccases. The HPLC analysis showed that our produced bacterial laccases are able to degrade estradiol with and without addition of ABTS. BPUL is able to degrade ethinyl estradiol with addition of ABTS. LC-MS measurements showed degradation products which could not be identified but were further analyzed using MS/MS. The resulting products have been discussed with an organic chemist.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#6 Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully immobilized ''Trametes versicolor'' laccase (named TVEL0), ''E. coli'' BL21 laccase (CueO named ECOL) and ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL) and measured their activity. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results TVEL0]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results BPUL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully improved a BioBrick by clarifying its true function. <br />
<br />
::[http://partsregistry.org/Part:BBa_K392014:Experience#User_Reviews Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created our own database to organize our samples.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Project/Database Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created a model which simulates the required laccase amount to degraded harmful substances under real sewage plant conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Modell Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We conducted a feasibility study of our project with sewage plant experts.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We did an outstanding outreach work.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview Results]<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|60px|frameless|left]] <br />
:::We won a gold medal.<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|60px|frameless|left]] <br />
:::We qualified for the world campionships<br />
<br style="clear: both" /><br />
</b><br />
<br />
<br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-GermanyTeam:Bielefeld-Germany2012-10-27T00:09:32Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<html><br />
<br />
<!-- Flexslider CSS and JS --><br />
<link rel="stylesheet" href="http://2012.igem-bielefeld.de/includes/wiki/flex/css/flexslider.css" type="text/css"><br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js"></script><br />
<script src="http://2012.igem-bielefeld.de/includes/wiki/flex/js/jquery.flexslider.js"></script><br />
<br />
<!-- Load the flexslider --><br />
<script type="text/javascript" charset="utf-8"><br />
$(window).load(function() {<br />
$('.flexslider').flexslider({<br />
animation: "fade", // slide or fade<br />
controlsContainer: ".flex-container" // the container that holds the flexslider<br />
});<br />
});<br />
</script><br />
<br />
<!-- Slider Container and Images --><br />
<div style="padding:5px; z-index:1;"><br />
<br />
<div class="flexslider"><br />
<ul class="slides"><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Our Plan<br />
</div><br />
<br />
TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE <br><br />
The goal is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds.<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Appoach"><br />
Click here to read more</a> about our project<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/Bielefeld2012_Realization.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Realization<br />
</div><br />
<br />
To realize our plans we first produce the laccases in the different clades and purify them. After this we immobilized and tested their acitivity. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary"><br />
Click here to read more </a> about our methodes...<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d8/Bielefeld2012_Potential.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Potential<br />
</div><br />
<br />
While working with two different clarification plants we confirmed that our project has the opportunity to solve problems with micro contaminations. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant"><br />
Click here to read more</a> about the usage in a clarification plants and micro conterminations...</p> <br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Bielefeld2012_Trametes_Laccase.JPG"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Laccases - Our Teammate<br />
</div><br />
Laccases have the ability to oxidize phenolic and nonphenolic lignin related compounds as well as highly recalcitrant environmental pollutants. This makes them very useful for applications concerning several biotechnological processes. <br />
<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Background#3"><br />
Click here to read more</a> about laccases...<br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class=clear></div><br />
</div><br />
</li><br />
<br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
</div><br />
<br />
<div class=frontpage-content-left><br />
<div id=page-title><br />
<span id=page-title-text><br />
Welcome<br />
</span><br />
</div><br />
<br />
<p align=justify><br />
The birth control pill is a widespread contraception method. However, large amounts of these modified estrogens leave the body again in urine. The conventional methods in sewage treatment plants are unable to treat waste water sufficiently because the most frequently used estrogen ethinyl estradiol is very difficult to break down. As a result, the hormone finds its way into rivers and lakes and accumulates in drinking water with serious consequences for fish and other aquatic life. These range from reproductive and severe developmental disorders to the formation of female sexual characteristics in males. The long-term consequences of increasing estrogen pollution for human beings are still largely unknown. Nonetheless, declining sperm counts and thereby increasing infertility in men living in industrial nations may well relate to this hormonal pollution. In addition, testicular and prostate cancers as well as osteoporosis could be a consequence of overly high concentrations of estrogen in the human body.<br><br><br />
The goal of Bielefeld’s iGEM team is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds. Laccases are copper-containing oxidase enzymes found in many organisms, and one of their properties is the ability to break down a wide range of aromatic and phenolic compounds. For this purpose, genes of various bacterial and eukaryotic laccases should be isolated and expressed in <i>Escherichia coli</i> and <i>Pichia pastoris</i>. The team is aiming to manufacture this enzyme economically and safely with the help of methods from synthetic biology. It should also be possible to extend the concept to other, in part poisonous and carcinogenic pollutants in drinking and waste water, as well as into industrial application, such as in paper and textile industries or even for bioremediation of contaminated soil. </p><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
A Case for Laccase!<br />
</span><br />
</div><br />
<iframe width="550" height="350" align="center" src="http://www.youtube.com/embed/qKOCKYnBsB8" frameborder="0" allowfullscreen></iframe><br />
<br />
<br />
</div><br />
<div class=frontpage-content-right><br />
<div id=page-title><br />
<span id=page-title-text><br />
iGEM Team Bielefeld 2012<br />
</span><br />
</div><br />
<br />
<div align="center" style="z-index:0;"><object width="375" height="220"><param name="movie" value="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><param name="wmode" value="opaque" /><embed src="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="375" height="220" wmode="opaque"></embed></object></div><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Achievements<br />
</span><br />
</div><br />
</html><br />
<p><br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|50px|left]]<br />
::Gold medal in Amsterdam.<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|50px|left]]<br />
::Qualified for the World Championships<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Creation of a database to organize our samples.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of four active bacterial laccases.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Designed and assembled a shuttle vector for site-directed integration in ''P. pastoris''<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of a active fungal laccase (TVEL5).<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful characterization of the activity of four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of the ''Trametes versicolor''-laccase (named TVEL0) and measurement of its activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of four bacterial laccases and measurement of their activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Feasibility study of our project.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful creation of a model which simulates the required laccase amount to degraded harmful substances in real sewageplant conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]]<br />
:Improved a BioBrick by clarifying its true function.<br />
</p><br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div class=frontpage-content-full><br />
<div id=page-title><br />
<span id=page-title-text><br />
Our Partners<br />
</span><br />
</div><br />
</div><br />
</body><br />
</html><br />
{| cellspacing="30"<br />
| [[File:Promega logo 180x109.gif|120px|link=http://www.promega.com/]] || <br />
| [[Image:Logo merck.jpg|100px|link=http://www.merckgroup.com/en/index.html]] ||<br />
| [[File:BioCircle.JPG|100px|link=http://www.bio-circle.de/home.html]] || <br />
| [[File:Bielefeld2012 Evonik.jpg|140px|link=http://www.evonik.de]] ||<br />
| [[File:Bielefeld2012_Baxter.png|100px|link=http://www.baxter.de]] <br />
|-<br />
| [[File:Logo knauer.jpg|100px|link=http://www.knauer.net/]] || <br />
| [[File:Logo iit.jpg|100px|link=http://www.iit-biotech.de]] ||<br />
| [[File:logo biometra.jpg|150px|link=http://www.biometra.de ]] ||<br />
| [[File:Bielefeld2012_BIEKUBA.jpg|100px|link=http://www.iit-unibi.de/]] ||<br />
| [[File:Bielefeld2012_Logo_ERASynbio.jpg|100px|link=http://www.erasynbio.net/]]<br />
|- <br />
| [[File:Logo bio-nrw.png|100px|link=http://www.bio.nrw.de/en]] || <br />
| [[File:Bielefeld-Germany-CeBiTec.jpg|100px|link=http://www.cebitec.uni-bielefeld.de/]] || <br />
| [[File: IgemBielefeld_2011_Logo_uni.jpg|100px|link=http://www.uni-bielefeld.de]] || <br />
| [[File:IgemBielefeld_Logo_biofak.jpg|100px|link=http://www.uni-bielefeld.de/biologie]] || <br />
| [[File:Bielefeld-Uniersity-techfak.gif|100px|link=http://www.techfak.uni-bielefeld.de/web/ ]]<br />
|}<br />
<br />
<br />
<br />
<html><br />
<div id="content-footer-box"><br />
<div class="content-footer-box-left"><br />
<div class="about"><br />
<p>About our Wiki</p><br />
<p>Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach. </p><br />
</div><br />
<div class="contact"><br />
<p>Contact Us</p><br />
<p>Universität Bielefeld<br><br />
Universitätsstraße 25<br><br />
D-33615 Bielefeld<br><br><a href="mailto:info@igem-bielefeld.de">info(at)igem-bielefeld.de</a></p><br />
</div><br />
</div><br />
<div class="content-footer-box-right"><br />
<div class="navigate"><br />
<p>Navigate our Wiki</p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany'>Start</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Members'>Team</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Description">Project</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary">Results</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Results">Since Regionals</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview">Human Practice</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Safety'>Safety</a><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Judging'>Judging</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Partner'>Partner</a></p><br />
</div><br />
<div class="facebook"><br />
<div id="fb_bg"><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fpages%2FiGEM_Bielefeld%2F244094752286371&amp;width=292&amp;height=300&amp;colorscheme=light&amp;show_faces=false&amp;border_color&amp;stream=true&amp;header=false" scrolling="no" frameborder="0" style="border:0px; overflow:hidden; width:292px; height:300px;" allowTransparency="false"></iframe><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</html></div>Mohttp://2012.igem.org/Team:Bielefeld-GermanyTeam:Bielefeld-Germany2012-10-27T00:06:56Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<html><br />
<br />
<!-- Flexslider CSS and JS --><br />
<link rel="stylesheet" href="http://2012.igem-bielefeld.de/includes/wiki/flex/css/flexslider.css" type="text/css"><br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js"></script><br />
<script src="http://2012.igem-bielefeld.de/includes/wiki/flex/js/jquery.flexslider.js"></script><br />
<br />
<!-- Load the flexslider --><br />
<script type="text/javascript" charset="utf-8"><br />
$(window).load(function() {<br />
$('.flexslider').flexslider({<br />
animation: "fade", // slide or fade<br />
controlsContainer: ".flex-container" // the container that holds the flexslider<br />
});<br />
});<br />
</script><br />
<br />
<!-- Slider Container and Images --><br />
<div style="padding:5px; z-index:1;"><br />
<br />
<div class="flexslider"><br />
<ul class="slides"><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Our Plan<br />
</div><br />
<br />
TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE <br><br />
The goal is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds.<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Appoach"><br />
Click here to read more</a> about our project<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/Bielefeld2012_Realization.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Realization<br />
</div><br />
<br />
To realize our plans we first produce the laccases in the different clades and purify them. After this we immobilized and tested their acitivity. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary"><br />
Click here to read more </a> about our methodes...<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d8/Bielefeld2012_Potential.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Potential<br />
</div><br />
<br />
While working with two different clarification plants we confirmed that our project has the opportunity to solve problems with micro contaminations. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant"><br />
Click here to read more</a> about the usage in a clarification plants and micro conterminations...</p> <br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Bielefeld2012_Trametes_Laccase.JPG"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Laccases - Our Teammate<br />
</div><br />
Laccases have the ability to oxidize phenolic and nonphenolic lignin related compounds as well as highly recalcitrant environmental pollutants. This makes them very useful for applications concerning several biotechnological processes. <br />
<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Background#3"><br />
Click here to read more</a> about laccases...<br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class=clear></div><br />
</div><br />
</li><br />
<br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
</div><br />
<br />
<div class=frontpage-content-left><br />
<div id=page-title><br />
<span id=page-title-text><br />
Welcome<br />
</span><br />
</div><br />
<br />
<p align=justify><br />
The birth control pill is a widespread contraception method. However, large amounts of these modified estrogens leave the body again in urine. The conventional methods in sewage treatment plants are unable to treat waste water sufficiently because the most frequently used estrogen ethinyl estradiol is very difficult to break down. As a result, the hormone finds its way into rivers and lakes and accumulates in drinking water with serious consequences for fish and other aquatic life. These range from reproductive and severe developmental disorders to the formation of female sexual characteristics in males. The long-term consequences of increasing estrogen pollution for human beings are still largely unknown. Nonetheless, declining sperm counts and thereby increasing infertility in men living in industrial nations may well relate to this hormonal pollution. In addition, testicular and prostate cancers as well as osteoporosis could be a consequence of overly high concentrations of estrogen in the human body.<br><br><br />
The goal of Bielefeld’s iGEM team is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds. Laccases are copper-containing oxidase enzymes found in many organisms, and one of their properties is the ability to break down a wide range of aromatic and phenolic compounds. For this purpose, genes of various bacterial and eukaryotic laccases should be isolated and expressed in <i>Escherichia coli</i> and <i>Pichia pastoris</i>. The team is aiming to manufacture this enzyme economically and safely with the help of methods from synthetic biology. It should also be possible to extend the concept to other, in part poisonous and carcinogenic pollutants in drinking and waste water, as well as into industrial application, such as in paper and textile industries or even for bioremediation of contaminated soil. </p><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
A Case for Laccase!<br />
</span><br />
</div><br />
<iframe width="550" height="350" align="center" src="http://www.youtube.com/embed/qKOCKYnBsB8" frameborder="0" allowfullscreen></iframe><br />
<br />
<br />
</div><br />
<div class=frontpage-content-right><br />
<div id=page-title><br />
<span id=page-title-text><br />
iGEM Team Bielefeld 2012<br />
</span><br />
</div><br />
<br />
<div align="center" style="z-index:0;"><object width="375" height="220"><param name="movie" value="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><param name="wmode" value="opaque" /><embed src="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="375" height="220" wmode="opaque"></embed></object></div><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Achievements<br />
</span><br />
</div><br />
</html><br />
<p><br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|50px|left]]<br />
::Gold medal in Amsterdam.<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|50px|left]]<br />
::Qualified for the World Championships<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Creation of a database to organize our samples.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:designed a shuttle vector for site-directed integration in ''P. pastoris''<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of four active bacterial laccases.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of a active fungal laccases (TVEL5).<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful characterization of the activity of four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of the ''Trametes versicolor''-laccase (named TVEL0) and measurement of its activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of four bacterial laccases and measurement of their activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Feasibility study of our project.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]]<br />
:Improved a BioBrick by clarifying its true function.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful creation of a model which simulates the required laccase amount to degraded harmful substances in real sewageplant conditions.<br />
</p><br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div class=frontpage-content-full><br />
<div id=page-title><br />
<span id=page-title-text><br />
Our Partners<br />
</span><br />
</div><br />
</div><br />
</body><br />
</html><br />
{| cellspacing="30"<br />
| [[File:Promega logo 180x109.gif|120px|link=http://www.promega.com/]] || <br />
| [[Image:Logo merck.jpg|100px|link=http://www.merckgroup.com/en/index.html]] ||<br />
| [[File:BioCircle.JPG|100px|link=http://www.bio-circle.de/home.html]] || <br />
| [[File:Bielefeld2012 Evonik.jpg|140px|link=http://www.evonik.de]] ||<br />
| [[File:Bielefeld2012_Baxter.png|100px|link=http://www.baxter.de]] <br />
|-<br />
| [[File:Logo knauer.jpg|100px|link=http://www.knauer.net/]] || <br />
| [[File:Logo iit.jpg|100px|link=http://www.iit-biotech.de]] ||<br />
| [[File:logo biometra.jpg|150px|link=http://www.biometra.de ]] ||<br />
| [[File:Bielefeld2012_BIEKUBA.jpg|100px|link=http://www.iit-unibi.de/]] ||<br />
| [[File:Bielefeld2012_Logo_ERASynbio.jpg|100px|link=http://www.erasynbio.net/]]<br />
|- <br />
| [[File:Logo bio-nrw.png|100px|link=http://www.bio.nrw.de/en]] || <br />
| [[File:Bielefeld-Germany-CeBiTec.jpg|100px|link=http://www.cebitec.uni-bielefeld.de/]] || <br />
| [[File: IgemBielefeld_2011_Logo_uni.jpg|100px|link=http://www.uni-bielefeld.de]] || <br />
| [[File:IgemBielefeld_Logo_biofak.jpg|100px|link=http://www.uni-bielefeld.de/biologie]] || <br />
| [[File:Bielefeld-Uniersity-techfak.gif|100px|link=http://www.techfak.uni-bielefeld.de/web/ ]]<br />
|}<br />
<br />
<br />
<br />
<html><br />
<div id="content-footer-box"><br />
<div class="content-footer-box-left"><br />
<div class="about"><br />
<p>About our Wiki</p><br />
<p>Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach. </p><br />
</div><br />
<div class="contact"><br />
<p>Contact Us</p><br />
<p>Universität Bielefeld<br><br />
Universitätsstraße 25<br><br />
D-33615 Bielefeld<br><br><a href="mailto:info@igem-bielefeld.de">info(at)igem-bielefeld.de</a></p><br />
</div><br />
</div><br />
<div class="content-footer-box-right"><br />
<div class="navigate"><br />
<p>Navigate our Wiki</p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany'>Start</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Members'>Team</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Description">Project</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary">Results</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Results">Since Regionals</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview">Human Practice</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Safety'>Safety</a><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Judging'>Judging</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Partner'>Partner</a></p><br />
</div><br />
<div class="facebook"><br />
<div id="fb_bg"><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fpages%2FiGEM_Bielefeld%2F244094752286371&amp;width=292&amp;height=300&amp;colorscheme=light&amp;show_faces=false&amp;border_color&amp;stream=true&amp;header=false" scrolling="no" frameborder="0" style="border:0px; overflow:hidden; width:292px; height:300px;" allowTransparency="false"></iframe><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</html></div>Mohttp://2012.igem.org/Team:Bielefeld-GermanyTeam:Bielefeld-Germany2012-10-27T00:05:07Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<html><br />
<br />
<!-- Flexslider CSS and JS --><br />
<link rel="stylesheet" href="http://2012.igem-bielefeld.de/includes/wiki/flex/css/flexslider.css" type="text/css"><br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js"></script><br />
<script src="http://2012.igem-bielefeld.de/includes/wiki/flex/js/jquery.flexslider.js"></script><br />
<br />
<!-- Load the flexslider --><br />
<script type="text/javascript" charset="utf-8"><br />
$(window).load(function() {<br />
$('.flexslider').flexslider({<br />
animation: "fade", // slide or fade<br />
controlsContainer: ".flex-container" // the container that holds the flexslider<br />
});<br />
});<br />
</script><br />
<br />
<!-- Slider Container and Images --><br />
<div style="padding:5px; z-index:1;"><br />
<br />
<div class="flexslider"><br />
<ul class="slides"><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Our Plan<br />
</div><br />
<br />
TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE <br><br />
The goal is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds.<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Appoach"><br />
Click here to read more</a> about our project<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/Bielefeld2012_Realization.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Realization<br />
</div><br />
<br />
To realize our plans we first produce the laccases in the different clades and purify them. After this we immobilized and tested their acitivity. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary"><br />
Click here to read more </a> about our methodes...<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d8/Bielefeld2012_Potential.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Potential<br />
</div><br />
<br />
While working with two different clarification plants we confirmed that our project has the opportunity to solve problems with micro contaminations. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant"><br />
Click here to read more</a> about the usage in a clarification plants and micro conterminations...</p> <br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Bielefeld2012_Trametes_Laccase.JPG"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Laccases - Our Teammate<br />
</div><br />
Laccases have the ability to oxidize phenolic and nonphenolic lignin related compounds as well as highly recalcitrant environmental pollutants. This makes them very useful for applications concerning several biotechnological processes. <br />
<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Background#3"><br />
Click here to read more</a> about laccases...<br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class=clear></div><br />
</div><br />
</li><br />
<br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
</div><br />
<br />
<div class=frontpage-content-left><br />
<div id=page-title><br />
<span id=page-title-text><br />
Welcome<br />
</span><br />
</div><br />
<br />
<p align=justify><br />
The birth control pill is a widespread contraception method. However, large amounts of these modified estrogens leave the body again in urine. The conventional methods in sewage treatment plants are unable to treat waste water sufficiently because the most frequently used estrogen ethinyl estradiol is very difficult to break down. As a result, the hormone finds its way into rivers and lakes and accumulates in drinking water with serious consequences for fish and other aquatic life. These range from reproductive and severe developmental disorders to the formation of female sexual characteristics in males. The long-term consequences of increasing estrogen pollution for human beings are still largely unknown. Nonetheless, declining sperm counts and thereby increasing infertility in men living in industrial nations may well relate to this hormonal pollution. In addition, testicular and prostate cancers as well as osteoporosis could be a consequence of overly high concentrations of estrogen in the human body.<br><br><br />
The goal of Bielefeld’s iGEM team is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds. Laccases are copper-containing oxidase enzymes found in many organisms, and one of their properties is the ability to break down a wide range of aromatic and phenolic compounds. For this purpose, genes of various bacterial and eukaryotic laccases should be isolated and expressed in <i>Escherichia coli</i> and <i>Pichia pastoris</i>. The team is aiming to manufacture this enzyme economically and safely with the help of methods from synthetic biology. It should also be possible to extend the concept to other, in part poisonous and carcinogenic pollutants in drinking and waste water, as well as into industrial application, such as in paper and textile industries or even for bioremediation of contaminated soil. </p><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
A Case for Laccase!<br />
</span><br />
</div><br />
<iframe width="550" height="350" align="center" src="http://www.youtube.com/embed/qKOCKYnBsB8" frameborder="0" allowfullscreen></iframe><br />
<br />
<br />
</div><br />
<div class=frontpage-content-right><br />
<div id=page-title><br />
<span id=page-title-text><br />
iGEM Team Bielefeld 2012<br />
</span><br />
</div><br />
<br />
<div align="center" style="z-index:0;"><object width="375" height="220"><param name="movie" value="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><param name="wmode" value="opaque" /><embed src="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="375" height="220" wmode="opaque"></embed></object></div><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Achievements<br />
</span><br />
</div><br />
</html><br />
<p><br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|50px|left]]<br />
::Gold medal in Amsterdam.<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|50px|left]]<br />
::Qualified for the World Championships<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Creation of a database to organize our samples.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of four active bacterial laccases.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of a active fungal laccases (TVEL5).<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful characterization of the activity of four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of the ''Trametes versicolor''-laccase (named TVEL0) and measurement of its activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of four bacterial laccases and measurement of their activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Feasibility study of our project.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]]<br />
:Improved a BioBrick by clarifying its true function.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful creation of a model which simulates the required laccase amount to degraded harmful substances in real sewageplant conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:designed a shuttle vector for site-directed integration in ''P. pastoris''<br />
</p><br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div class=frontpage-content-full><br />
<div id=page-title><br />
<span id=page-title-text><br />
Our Partners<br />
</span><br />
</div><br />
</div><br />
</body><br />
</html><br />
{| cellspacing="30"<br />
| [[File:Promega logo 180x109.gif|120px|link=http://www.promega.com/]] || <br />
| [[Image:Logo merck.jpg|100px|link=http://www.merckgroup.com/en/index.html]] ||<br />
| [[File:BioCircle.JPG|100px|link=http://www.bio-circle.de/home.html]] || <br />
| [[File:Bielefeld2012 Evonik.jpg|140px|link=http://www.evonik.de]] ||<br />
| [[File:Bielefeld2012_Baxter.png|100px|link=http://www.baxter.de]] <br />
|-<br />
| [[File:Logo knauer.jpg|100px|link=http://www.knauer.net/]] || <br />
| [[File:Logo iit.jpg|100px|link=http://www.iit-biotech.de]] ||<br />
| [[File:logo biometra.jpg|150px|link=http://www.biometra.de ]] ||<br />
| [[File:Bielefeld2012_BIEKUBA.jpg|100px|link=http://www.iit-unibi.de/]] ||<br />
| [[File:Bielefeld2012_Logo_ERASynbio.jpg|100px|link=http://www.erasynbio.net/]]<br />
|- <br />
| [[File:Logo bio-nrw.png|100px|link=http://www.bio.nrw.de/en]] || <br />
| [[File:Bielefeld-Germany-CeBiTec.jpg|100px|link=http://www.cebitec.uni-bielefeld.de/]] || <br />
| [[File: IgemBielefeld_2011_Logo_uni.jpg|100px|link=http://www.uni-bielefeld.de]] || <br />
| [[File:IgemBielefeld_Logo_biofak.jpg|100px|link=http://www.uni-bielefeld.de/biologie]] || <br />
| [[File:Bielefeld-Uniersity-techfak.gif|100px|link=http://www.techfak.uni-bielefeld.de/web/ ]]<br />
|}<br />
<br />
<br />
<br />
<html><br />
<div id="content-footer-box"><br />
<div class="content-footer-box-left"><br />
<div class="about"><br />
<p>About our Wiki</p><br />
<p>Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach. </p><br />
</div><br />
<div class="contact"><br />
<p>Contact Us</p><br />
<p>Universität Bielefeld<br><br />
Universitätsstraße 25<br><br />
D-33615 Bielefeld<br><br><a href="mailto:info@igem-bielefeld.de">info(at)igem-bielefeld.de</a></p><br />
</div><br />
</div><br />
<div class="content-footer-box-right"><br />
<div class="navigate"><br />
<p>Navigate our Wiki</p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany'>Start</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Members'>Team</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Description">Project</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary">Results</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Results">Since Regionals</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview">Human Practice</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Safety'>Safety</a><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Judging'>Judging</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Partner'>Partner</a></p><br />
</div><br />
<div class="facebook"><br />
<div id="fb_bg"><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fpages%2FiGEM_Bielefeld%2F244094752286371&amp;width=292&amp;height=300&amp;colorscheme=light&amp;show_faces=false&amp;border_color&amp;stream=true&amp;header=false" scrolling="no" frameborder="0" style="border:0px; overflow:hidden; width:292px; height:300px;" allowTransparency="false"></iframe><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</html></div>Mohttp://2012.igem.org/Team:Bielefeld-GermanyTeam:Bielefeld-Germany2012-10-27T00:03:12Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<html><br />
<br />
<!-- Flexslider CSS and JS --><br />
<link rel="stylesheet" href="http://2012.igem-bielefeld.de/includes/wiki/flex/css/flexslider.css" type="text/css"><br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js"></script><br />
<script src="http://2012.igem-bielefeld.de/includes/wiki/flex/js/jquery.flexslider.js"></script><br />
<br />
<!-- Load the flexslider --><br />
<script type="text/javascript" charset="utf-8"><br />
$(window).load(function() {<br />
$('.flexslider').flexslider({<br />
animation: "fade", // slide or fade<br />
controlsContainer: ".flex-container" // the container that holds the flexslider<br />
});<br />
});<br />
</script><br />
<br />
<!-- Slider Container and Images --><br />
<div style="padding:5px; z-index:1;"><br />
<br />
<div class="flexslider"><br />
<ul class="slides"><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Our Plan<br />
</div><br />
<br />
TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE <br><br />
The goal is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds.<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Appoach"><br />
Click here to read more</a> about our project<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/Bielefeld2012_Realization.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Realization<br />
</div><br />
<br />
To realize our plans we first produce the laccases in the different clades and purify them. After this we immobilized and tested their acitivity. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary"><br />
Click here to read more </a> about our methodes...<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d8/Bielefeld2012_Potential.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Potential<br />
</div><br />
<br />
While working with two different clarification plants we confirmed that our project has the opportunity to solve problems with micro contaminations. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant"><br />
Click here to read more</a> about the usage in a clarification plants and micro conterminations...</p> <br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Bielefeld2012_Trametes_Laccase.JPG"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Laccases - Our Teammate<br />
</div><br />
Laccases have the ability to oxidize phenolic and nonphenolic lignin related compounds as well as highly recalcitrant environmental pollutants. This makes them very useful for applications concerning several biotechnological processes. <br />
<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Background#3"><br />
Click here to read more</a> about laccases...<br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class=clear></div><br />
</div><br />
</li><br />
<br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
</div><br />
<br />
<div class=frontpage-content-left><br />
<div id=page-title><br />
<span id=page-title-text><br />
Welcome<br />
</span><br />
</div><br />
<br />
<p align=justify><br />
The birth control pill is a widespread contraception method. However, large amounts of these modified estrogens leave the body again in urine. The conventional methods in sewage treatment plants are unable to treat waste water sufficiently because the most frequently used estrogen ethinyl estradiol is very difficult to break down. As a result, the hormone finds its way into rivers and lakes and accumulates in drinking water with serious consequences for fish and other aquatic life. These range from reproductive and severe developmental disorders to the formation of female sexual characteristics in males. The long-term consequences of increasing estrogen pollution for human beings are still largely unknown. Nonetheless, declining sperm counts and thereby increasing infertility in men living in industrial nations may well relate to this hormonal pollution. In addition, testicular and prostate cancers as well as osteoporosis could be a consequence of overly high concentrations of estrogen in the human body.<br><br><br />
The goal of Bielefeld’s iGEM team is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds. Laccases are copper-containing oxidase enzymes found in many organisms, and one of their properties is the ability to break down a wide range of aromatic and phenolic compounds. For this purpose, genes of various bacterial and eukaryotic laccases should be isolated and expressed in <i>Escherichia coli</i> and <i>Pichia pastoris</i>. The team is aiming to manufacture this enzyme economically and safely with the help of methods from synthetic biology. It should also be possible to extend the concept to other, in part poisonous and carcinogenic pollutants in drinking and waste water, as well as into industrial application, such as in paper and textile industries or even for bioremediation of contaminated soil. </p><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
A Case for Laccase!<br />
</span><br />
</div><br />
<iframe width="550" height="350" align="center" src="http://www.youtube.com/embed/qKOCKYnBsB8" frameborder="0" allowfullscreen></iframe><br />
<br />
<br />
</div><br />
<div class=frontpage-content-right><br />
<div id=page-title><br />
<span id=page-title-text><br />
iGEM Team Bielefeld 2012<br />
</span><br />
</div><br />
<br />
<div align="center" style="z-index:0;"><object width="375" height="220"><param name="movie" value="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><param name="wmode" value="opaque" /><embed src="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="375" height="220" wmode="opaque"></embed></object></div><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Achievements<br />
</span><br />
</div><br />
</html><br />
<p><br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|50px|left]]<br />
::Gold medal in Amsterdam.<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|50px|left]]<br />
::Qualified for the World Championships<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Creation of a database to organize our samples.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of four active bacterial laccases.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful characterization of the activity of four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of the ''Trametes versicolor''-laccase (named TVEL0) and measurement of its activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of four bacterial laccases and measurement of their activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Feasibility study of our project.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]]<br />
:Improved a BioBrick by clarifying its true function.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful creation of a model which simulates the required laccase amount to degraded harmful substances in real sewageplant conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:designed a shuttle vector for site-directed integration in ''P. pastoris''<br />
</p><br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div class=frontpage-content-full><br />
<div id=page-title><br />
<span id=page-title-text><br />
Our Partners<br />
</span><br />
</div><br />
</div><br />
</body><br />
</html><br />
{| cellspacing="30"<br />
| [[File:Promega logo 180x109.gif|120px|link=http://www.promega.com/]] || <br />
| [[Image:Logo merck.jpg|100px|link=http://www.merckgroup.com/en/index.html]] ||<br />
| [[File:BioCircle.JPG|100px|link=http://www.bio-circle.de/home.html]] || <br />
| [[File:Bielefeld2012 Evonik.jpg|140px|link=http://www.evonik.de]] ||<br />
| [[File:Bielefeld2012_Baxter.png|100px|link=http://www.baxter.de]] <br />
|-<br />
| [[File:Logo knauer.jpg|100px|link=http://www.knauer.net/]] || <br />
| [[File:Logo iit.jpg|100px|link=http://www.iit-biotech.de]] ||<br />
| [[File:logo biometra.jpg|150px|link=http://www.biometra.de ]] ||<br />
| [[File:Bielefeld2012_BIEKUBA.jpg|100px|link=http://www.iit-unibi.de/]] ||<br />
| [[File:Bielefeld2012_Logo_ERASynbio.jpg|100px|link=http://www.erasynbio.net/]]<br />
|- <br />
| [[File:Logo bio-nrw.png|100px|link=http://www.bio.nrw.de/en]] || <br />
| [[File:Bielefeld-Germany-CeBiTec.jpg|100px|link=http://www.cebitec.uni-bielefeld.de/]] || <br />
| [[File: IgemBielefeld_2011_Logo_uni.jpg|100px|link=http://www.uni-bielefeld.de]] || <br />
| [[File:IgemBielefeld_Logo_biofak.jpg|100px|link=http://www.uni-bielefeld.de/biologie]] || <br />
| [[File:Bielefeld-Uniersity-techfak.gif|100px|link=http://www.techfak.uni-bielefeld.de/web/ ]]<br />
|}<br />
<br />
<br />
<br />
<html><br />
<div id="content-footer-box"><br />
<div class="content-footer-box-left"><br />
<div class="about"><br />
<p>About our Wiki</p><br />
<p>Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach. </p><br />
</div><br />
<div class="contact"><br />
<p>Contact Us</p><br />
<p>Universität Bielefeld<br><br />
Universitätsstraße 25<br><br />
D-33615 Bielefeld<br><br><a href="mailto:info@igem-bielefeld.de">info(at)igem-bielefeld.de</a></p><br />
</div><br />
</div><br />
<div class="content-footer-box-right"><br />
<div class="navigate"><br />
<p>Navigate our Wiki</p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany'>Start</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Members'>Team</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Description">Project</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary">Results</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Results">Since Regionals</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview">Human Practice</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Safety'>Safety</a><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Judging'>Judging</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Partner'>Partner</a></p><br />
</div><br />
<div class="facebook"><br />
<div id="fb_bg"><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fpages%2FiGEM_Bielefeld%2F244094752286371&amp;width=292&amp;height=300&amp;colorscheme=light&amp;show_faces=false&amp;border_color&amp;stream=true&amp;header=false" scrolling="no" frameborder="0" style="border:0px; overflow:hidden; width:292px; height:300px;" allowTransparency="false"></iframe><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</html></div>Mohttp://2012.igem.org/Team:Bielefeld-GermanyTeam:Bielefeld-Germany2012-10-27T00:02:26Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<html><br />
<br />
<!-- Flexslider CSS and JS --><br />
<link rel="stylesheet" href="http://2012.igem-bielefeld.de/includes/wiki/flex/css/flexslider.css" type="text/css"><br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js"></script><br />
<script src="http://2012.igem-bielefeld.de/includes/wiki/flex/js/jquery.flexslider.js"></script><br />
<br />
<!-- Load the flexslider --><br />
<script type="text/javascript" charset="utf-8"><br />
$(window).load(function() {<br />
$('.flexslider').flexslider({<br />
animation: "fade", // slide or fade<br />
controlsContainer: ".flex-container" // the container that holds the flexslider<br />
});<br />
});<br />
</script><br />
<br />
<!-- Slider Container and Images --><br />
<div style="padding:5px; z-index:1;"><br />
<br />
<div class="flexslider"><br />
<ul class="slides"><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Our Plan<br />
</div><br />
<br />
TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE <br><br />
The goal is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds.<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Appoach"><br />
Click here to read more</a> about our project<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/Bielefeld2012_Realization.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Realization<br />
</div><br />
<br />
To realize our plans we first produce the laccases in the different clades and purify them. After this we immobilized and tested their acitivity. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary"><br />
Click here to read more </a> about our methodes...<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d8/Bielefeld2012_Potential.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Potential<br />
</div><br />
<br />
While working with two different clarification plants we confirmed that our project has the opportunity to solve problems with micro contaminations. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant"><br />
Click here to read more</a> about the usage in a clarification plants and micro conterminations...</p> <br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Bielefeld2012_Trametes_Laccase.JPG"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Laccases - Our Teammate<br />
</div><br />
Laccases have the ability to oxidize phenolic and nonphenolic lignin related compounds as well as highly recalcitrant environmental pollutants. This makes them very useful for applications concerning several biotechnological processes. <br />
<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Background#3"><br />
Click here to read more</a> about laccases...<br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class=clear></div><br />
</div><br />
</li><br />
<br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
</div><br />
<br />
<div class=frontpage-content-left><br />
<div id=page-title><br />
<span id=page-title-text><br />
Welcome<br />
</span><br />
</div><br />
<br />
<p align=justify><br />
The birth control pill is a widespread contraception method. However, large amounts of these modified estrogens leave the body again in urine. The conventional methods in sewage treatment plants are unable to treat waste water sufficiently because the most frequently used estrogen ethinyl estradiol is very difficult to break down. As a result, the hormone finds its way into rivers and lakes and accumulates in drinking water with serious consequences for fish and other aquatic life. These range from reproductive and severe developmental disorders to the formation of female sexual characteristics in males. The long-term consequences of increasing estrogen pollution for human beings are still largely unknown. Nonetheless, declining sperm counts and thereby increasing infertility in men living in industrial nations may well relate to this hormonal pollution. In addition, testicular and prostate cancers as well as osteoporosis could be a consequence of overly high concentrations of estrogen in the human body.<br><br><br />
The goal of Bielefeld’s iGEM team is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds. Laccases are copper-containing oxidase enzymes found in many organisms, and one of their properties is the ability to break down a wide range of aromatic and phenolic compounds. For this purpose, genes of various bacterial and eukaryotic laccases should be isolated and expressed in <i>Escherichia coli</i> and <i>Pichia pastoris</i>. The team is aiming to manufacture this enzyme economically and safely with the help of methods from synthetic biology. It should also be possible to extend the concept to other, in part poisonous and carcinogenic pollutants in drinking and waste water, as well as into industrial application, such as in paper and textile industries or even for bioremediation of contaminated soil. </p><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
A Case for Laccase!<br />
</span><br />
</div><br />
<iframe width="550" height="350" align="center" src="http://www.youtube.com/embed/qKOCKYnBsB8" frameborder="0" allowfullscreen></iframe><br />
<br />
<br />
</div><br />
<div class=frontpage-content-right><br />
<div id=page-title><br />
<span id=page-title-text><br />
iGEM Team Bielefeld 2012<br />
</span><br />
</div><br />
<br />
<div align="center" style="z-index:0;"><object width="375" height="220"><param name="movie" value="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><param name="wmode" value="opaque" /><embed src="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="375" height="220" wmode="opaque"></embed></object></div><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Achievements<br />
</span><br />
</div><br />
</html><br />
<p><br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|50px|left]]<br />
::Gold medal in Amsterdam.<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|50px|left]]<br />
::Qualified for the World Championships<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Creation of a database to organize our samples.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of four active bacterial laccases.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful characterization of the activity of four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of the ''Trametes versicolor''-laccase (named TVEL0) and measurement of its activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of four bacterial laccases and measurement of their activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Feasibility study of our project.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]]<br />
:Improved a BioBrick by clarifying its true function.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful creation of a model which simulates the required laccase amount to degraded harmful substances in real sewageplant conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:designed a shuttle vector for site-directed integration in P. pastoris<br />
</p><br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div class=frontpage-content-full><br />
<div id=page-title><br />
<span id=page-title-text><br />
Our Partners<br />
</span><br />
</div><br />
</div><br />
</body><br />
</html><br />
{| cellspacing="30"<br />
| [[File:Promega logo 180x109.gif|120px|link=http://www.promega.com/]] || <br />
| [[Image:Logo merck.jpg|100px|link=http://www.merckgroup.com/en/index.html]] ||<br />
| [[File:BioCircle.JPG|100px|link=http://www.bio-circle.de/home.html]] || <br />
| [[File:Bielefeld2012 Evonik.jpg|140px|link=http://www.evonik.de]] ||<br />
| [[File:Bielefeld2012_Baxter.png|100px|link=http://www.baxter.de]] <br />
|-<br />
| [[File:Logo knauer.jpg|100px|link=http://www.knauer.net/]] || <br />
| [[File:Logo iit.jpg|100px|link=http://www.iit-biotech.de]] ||<br />
| [[File:logo biometra.jpg|150px|link=http://www.biometra.de ]] ||<br />
| [[File:Bielefeld2012_BIEKUBA.jpg|100px|link=http://www.iit-unibi.de/]] ||<br />
| [[File:Bielefeld2012_Logo_ERASynbio.jpg|100px|link=http://www.erasynbio.net/]]<br />
|- <br />
| [[File:Logo bio-nrw.png|100px|link=http://www.bio.nrw.de/en]] || <br />
| [[File:Bielefeld-Germany-CeBiTec.jpg|100px|link=http://www.cebitec.uni-bielefeld.de/]] || <br />
| [[File: IgemBielefeld_2011_Logo_uni.jpg|100px|link=http://www.uni-bielefeld.de]] || <br />
| [[File:IgemBielefeld_Logo_biofak.jpg|100px|link=http://www.uni-bielefeld.de/biologie]] || <br />
| [[File:Bielefeld-Uniersity-techfak.gif|100px|link=http://www.techfak.uni-bielefeld.de/web/ ]]<br />
|}<br />
<br />
<br />
<br />
<html><br />
<div id="content-footer-box"><br />
<div class="content-footer-box-left"><br />
<div class="about"><br />
<p>About our Wiki</p><br />
<p>Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach. </p><br />
</div><br />
<div class="contact"><br />
<p>Contact Us</p><br />
<p>Universität Bielefeld<br><br />
Universitätsstraße 25<br><br />
D-33615 Bielefeld<br><br><a href="mailto:info@igem-bielefeld.de">info(at)igem-bielefeld.de</a></p><br />
</div><br />
</div><br />
<div class="content-footer-box-right"><br />
<div class="navigate"><br />
<p>Navigate our Wiki</p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany'>Start</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Members'>Team</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Description">Project</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary">Results</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Results">Since Regionals</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview">Human Practice</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Safety'>Safety</a><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Judging'>Judging</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Partner'>Partner</a></p><br />
</div><br />
<div class="facebook"><br />
<div id="fb_bg"><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fpages%2FiGEM_Bielefeld%2F244094752286371&amp;width=292&amp;height=300&amp;colorscheme=light&amp;show_faces=false&amp;border_color&amp;stream=true&amp;header=false" scrolling="no" frameborder="0" style="border:0px; overflow:hidden; width:292px; height:300px;" allowTransparency="false"></iframe><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</html></div>Mohttp://2012.igem.org/Team:Bielefeld-GermanyTeam:Bielefeld-Germany2012-10-26T23:47:05Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<html><br />
<br />
<!-- Flexslider CSS and JS --><br />
<link rel="stylesheet" href="http://2012.igem-bielefeld.de/includes/wiki/flex/css/flexslider.css" type="text/css"><br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js"></script><br />
<script src="http://2012.igem-bielefeld.de/includes/wiki/flex/js/jquery.flexslider.js"></script><br />
<br />
<!-- Load the flexslider --><br />
<script type="text/javascript" charset="utf-8"><br />
$(window).load(function() {<br />
$('.flexslider').flexslider({<br />
animation: "fade", // slide or fade<br />
controlsContainer: ".flex-container" // the container that holds the flexslider<br />
});<br />
});<br />
</script><br />
<br />
<!-- Slider Container and Images --><br />
<div style="padding:5px; z-index:1;"><br />
<br />
<div class="flexslider"><br />
<ul class="slides"><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Our Plan<br />
</div><br />
<br />
TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE <br><br />
The goal is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds.<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Appoach"><br />
Click here to read more</a> about our project<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/Bielefeld2012_Realization.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Realization<br />
</div><br />
<br />
To realize our plans we first produce the laccases in the different clades and purify them. After this we immobilized and tested their acitivity. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary"><br />
Click here to read more </a> about our methodes...<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d8/Bielefeld2012_Potential.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Potential<br />
</div><br />
<br />
While working with two different clarification plants we confirmed that our project has the opportunity to solve problems with micro contaminations. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant"><br />
Click here to read more</a> about the usage in a clarification plants and micro conterminations...</p> <br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Bielefeld2012_Trametes_Laccase.JPG"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Laccases - Our Teammate<br />
</div><br />
Laccases have the ability to oxidize phenolic and nonphenolic lignin related compounds as well as highly recalcitrant environmental pollutants. This makes them very useful for applications concerning several biotechnological processes. <br />
<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Background#3"><br />
Click here to read more</a> about laccases...<br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class=clear></div><br />
</div><br />
</li><br />
<br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
</div><br />
<br />
<div class=frontpage-content-left><br />
<div id=page-title><br />
<span id=page-title-text><br />
Welcome<br />
</span><br />
</div><br />
<br />
<p align=justify><br />
The birth control pill is a widespread contraception method. However, large amounts of these modified estrogens leave the body again in urine. The conventional methods in sewage treatment plants are unable to treat waste water sufficiently because the most frequently used estrogen ethinyl estradiol is very difficult to break down. As a result, the hormone finds its way into rivers and lakes and accumulates in drinking water with serious consequences for fish and other aquatic life. These range from reproductive and severe developmental disorders to the formation of female sexual characteristics in males. The long-term consequences of increasing estrogen pollution for human beings are still largely unknown. Nonetheless, declining sperm counts and thereby increasing infertility in men living in industrial nations may well relate to this hormonal pollution. In addition, testicular and prostate cancers as well as osteoporosis could be a consequence of overly high concentrations of estrogen in the human body.<br><br><br />
The goal of Bielefeld’s iGEM team is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds. Laccases are copper-containing oxidase enzymes found in many organisms, and one of their properties is the ability to break down a wide range of aromatic and phenolic compounds. For this purpose, genes of various bacterial and eukaryotic laccases should be isolated and expressed in <i>Escherichia coli</i> and <i>Pichia pastoris</i>. The team is aiming to manufacture this enzyme economically and safely with the help of methods from synthetic biology. It should also be possible to extend the concept to other, in part poisonous and carcinogenic pollutants in drinking and waste water, as well as into industrial application, such as in paper and textile industries or even for bioremediation of contaminated soil. </p><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
A Case for Laccase!<br />
</span><br />
</div><br />
<iframe width="550" height="350" align="center" src="http://www.youtube.com/embed/qKOCKYnBsB8" frameborder="0" allowfullscreen></iframe><br />
<br />
<br />
</div><br />
<div class=frontpage-content-right><br />
<div id=page-title><br />
<span id=page-title-text><br />
iGEM Team Bielefeld 2012<br />
</span><br />
</div><br />
<br />
<div align="center" style="z-index:0;"><object width="375" height="220"><param name="movie" value="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><param name="wmode" value="opaque" /><embed src="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="375" height="220" wmode="opaque"></embed></object></div><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Achievements<br />
</span><br />
</div><br />
</html><br />
<p><br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|50px|left]]<br />
::Gold medal in Amsterdam.<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|50px|left]]<br />
::Qualified for the World Championships<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Creation of a database to organize our samples.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of four active bacterial laccases.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful characterization of the activity of four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of the ''Trametes versicolor''-laccase (named TVEL0) and measurement of its activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of four bacterial laccases and measurement of their activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Feasibility study of our project.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]]<br />
:Improved a BioBrick by clarifying its true function.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful creation of a model which simulates the required laccase amount to degraded harmful substances in real sewageplant conditions.<br />
</p><br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div class=frontpage-content-full><br />
<div id=page-title><br />
<span id=page-title-text><br />
Our Partners<br />
</span><br />
</div><br />
</div><br />
</body><br />
</html><br />
{| cellspacing="30"<br />
| [[File:Promega logo 180x109.gif|120px|link=http://www.promega.com/]] || <br />
| [[Image:Logo merck.jpg|100px|link=http://www.merckgroup.com/en/index.html]] ||<br />
| [[File:BioCircle.JPG|100px|link=http://www.bio-circle.de/home.html]] || <br />
| [[File:Bielefeld2012 Evonik.jpg|140px|link=http://www.evonik.de]] ||<br />
| [[File:Bielefeld2012_Baxter.png|100px|link=http://www.baxter.de]] <br />
|-<br />
| [[File:Logo knauer.jpg|100px|link=http://www.knauer.net/]] || <br />
| [[File:Logo iit.jpg|100px|link=http://www.iit-biotech.de]] ||<br />
| [[File:logo biometra.jpg|150px|link=http://www.biometra.de ]] ||<br />
| [[File:Bielefeld2012_BIEKUBA.jpg|100px|link=http://www.iit-unibi.de/]] ||<br />
| [[File:Bielefeld2012_Logo_ERASynbio.jpg|100px|link=http://www.erasynbio.net/]]<br />
|- <br />
| [[File:Logo bio-nrw.png|100px|link=http://www.bio.nrw.de/en]] || <br />
| [[File:Bielefeld-Germany-CeBiTec.jpg|100px|link=http://www.cebitec.uni-bielefeld.de/]] || <br />
| [[File: IgemBielefeld_2011_Logo_uni.jpg|100px|link=http://www.uni-bielefeld.de]] || <br />
| [[File:IgemBielefeld_Logo_biofak.jpg|100px|link=http://www.uni-bielefeld.de/biologie]] || <br />
| [[File:Bielefeld-Uniersity-techfak.gif|100px|link=http://www.techfak.uni-bielefeld.de/web/ ]]<br />
|}<br />
<br />
<br />
<br />
<html><br />
<div id="content-footer-box"><br />
<div class="content-footer-box-left"><br />
<div class="about"><br />
<p>About our Wiki</p><br />
<p>Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach. </p><br />
</div><br />
<div class="contact"><br />
<p>Contact Us</p><br />
<p>Universität Bielefeld<br><br />
Universitätsstraße 25<br><br />
D-33615 Bielefeld<br><br><a href="mailto:info@igem-bielefeld.de">info(at)igem-bielefeld.de</a></p><br />
</div><br />
</div><br />
<div class="content-footer-box-right"><br />
<div class="navigate"><br />
<p>Navigate our Wiki</p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany'>Start</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Members'>Team</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Description">Project</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary">Results</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Results">Since Regionals</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview">Human Practice</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Safety'>Safety</a><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Judging'>Judging</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Partner'>Partner</a></p><br />
</div><br />
<div class="facebook"><br />
<div id="fb_bg"><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fpages%2FiGEM_Bielefeld%2F244094752286371&amp;width=292&amp;height=300&amp;colorscheme=light&amp;show_faces=false&amp;border_color&amp;stream=true&amp;header=false" scrolling="no" frameborder="0" style="border:0px; overflow:hidden; width:292px; height:300px;" allowTransparency="false"></iframe><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</html></div>Mohttp://2012.igem.org/File:Bielefeld-Germany2012_Goldmedaillie.pngFile:Bielefeld-Germany2012 Goldmedaillie.png2012-10-26T23:41:10Z<p>Mo: uploaded a new version of &quot;File:Bielefeld-Germany2012 Goldmedaillie.png&quot;</p>
<hr />
<div></div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Project/AchievmentsTeam:Bielefeld-Germany/Project/Achievments2012-10-26T23:38:29Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Project Achievements<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
<br />
<b><br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]]<br />
::We successfully produced purified and identified active laccases of ''E. coli'' BL21(CueO named ECOL), ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL), ''Bacillus halodurans'' C-125 laccase (Lbh1 named BHAL) and ''Thermus thermophilus'' HB27 (tthL named TTHL).<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli Results ECOL] <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo Results BHAL]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully designed a shuttle vector for site-directed integration in ''P. pastoris'' which allows the production and secretion of a protein of interest. We were able to show that the vector is functioning as expected. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully produced the laccase TVEL5 from ''Trametes versicolor'' in ''P. pastoris'' and showed the activity of the produced enzymes.<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::Successful characterization of the activity of all four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Activity_Analysis_of_ECOL Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Activity_analysis_of_BPUL Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Activity_analysis_of_TTHL Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Activity_Analysis_of_BHAL Results BHAL]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We established a method for the degradation of several compounds with the help of our self-produced laccases. The HPLC analysis showed that our produced bacterial laccases are able to degrade estradiol with and without addition of ABTS. BPUL is able to degrade ethinyl estradiol with addition of ABTS. LC-MS measurements showed degradation products which could not be identified but were further analyzed using MS/MS. The resulting products have been discussed with an organic chemist.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#6 Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully immobilized ''Trametes versicolor'' laccase (named TVEL0), ''E. coli'' BL21 laccase (CueO named ECOL) and ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL) and measured their activity. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results TVEL0]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results BPUL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully improved a BioBrick by clarifying its true function. <br />
<br />
::[http://partsregistry.org/Part:BBa_K392014:Experience#User_Reviews Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created our own database to organize our samples.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Project/Database Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created a model which simulates the oxidation of ABTS.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Modell Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We conducted a feasibility study of our project with sewage plant experts.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We did an outstanding outreach work.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview Results]<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|60px|frameless|left]] <br />
:::We won a gold medal.<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|60px|frameless|left]] <br />
:::We qualified for the world campionships<br />
<br style="clear: both" /><br />
</b><br />
<br />
<br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Project/AchievmentsTeam:Bielefeld-Germany/Project/Achievments2012-10-26T23:36:53Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Project Achievements<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
<br />
<b><br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]]<br />
::We successfully produced purified and identified active laccases of ''E. coli'' BL21(CueO named ECOL), ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL), ''Bacillus halodurans'' C-125 laccase (Lbh1 named BHAL) and ''Thermus thermophilus'' HB27 (tthL named TTHL).<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli Results ECOL] <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo Results BHAL]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully designed a shuttle vector for site-directed integration in ''P. pastoris'' which allows the production and secretion of a protein of interest. We were able to show that the vector is functioning as expected. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully produced the laccase TVEL5 from ''Trametes versicolor'' in ''P. pastoris'' and showed the activity of the produced enzymes.<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::Successful characterization of the activity of all four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Activity_Analysis_of_ECOL Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Activity_analysis_of_BPUL Results BPUL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Activity_analysis_of_TTHL Results TTHL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Activity_Analysis_of_BHAL Results BHAL]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We established a method for the degradation of several compounds with the help of our self-produced laccases. The HPLC analysis showed that our produced bacterial laccases are able to degrade estradiol with and without addition of ABTS. BPUL is able to degrade ethinyl estradiol with addition of ABTS. LC-MS measurements showed degradation products which could not be identified but were further analyzed using MS/MS. The resulting products have been discussed with an organic chemist.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#6 Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully immobilized ''Trametes versicolor'' laccase (named TVEL0), ''E. coli'' BL21 laccase (CueO named ECOL) and ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL) and measured their activity. <br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results TVEL0]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results ECOL]<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results BPUL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully improved a BioBrick by clarifying its true function. <br />
<br />
::[http://partsregistry.org/Part:BBa_K392014:Experience#User_Reviews Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created our own database to organize our samples.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Project/Database Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We successfully created a model which simulates the oxidation of ABTS.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Modell Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We conducted a feasibility study of our project with sewage plant experts.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
::We did an outstanding outreach work.<br />
<br />
::[https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview Results]<br />
<br />
<br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|60px|frameless|left]] <br />
::We won a gold medal.<br />
<br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|60px|frameless|left]] <br />
::We qualified for the Boston finals<br />
<br />
</b><br />
<br />
<br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Project/AchievmentsTeam:Bielefeld-Germany/Project/Achievments2012-10-26T23:34:40Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Project Achievements<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
<br />
<b><br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]]<br />
:We successfully produced purified and identified active laccases of ''E. coli'' BL21(CueO named ECOL), ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL), ''Bacillus halodurans'' C-125 laccase (Lbh1 named BHAL) and ''Thermus thermophilus'' HB27 (tthL named TTHL).<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli Results ECOL] <br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi Results BPUL]<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo Results TTHL]<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo Results BHAL]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We successfully designed a shuttle vector for site-directed integration in ''P. pastoris'' which allows the production and secretion of a protein of interest. We were able to show that the vector is functioning as expected. <br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We successfully produced the laccase TVEL5 from ''Trametes versicolor'' in ''P. pastoris'' and showed the activity of the produced enzymes.<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:Successful characterization of the activity of all four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Activity_Analysis_of_ECOL Results ECOL]<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Activity_analysis_of_BPUL Results BPUL]<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Activity_analysis_of_TTHL Results TTHL]<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Activity_Analysis_of_BHAL Results BHAL]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We established a method for the degradation of several compounds with the help of our self-produced laccases. The HPLC analysis showed that our produced bacterial laccases are able to degrade estradiol with and without addition of ABTS. BPUL is able to degrade ethinyl estradiol with addition of ABTS. LC-MS measurements showed degradation products which could not be identified but were further analyzed using MS/MS. The resulting products have been discussed with an organic chemist.<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#6 Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We successfully immobilized ''Trametes versicolor'' laccase (named TVEL0), ''E. coli'' BL21 laccase (CueO named ECOL) and ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL) and measured their activity. <br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results TVEL0]<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results ECOL]<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results BPUL]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We successfully improved a BioBrick by clarifying its true function. <br />
<br />
:[http://partsregistry.org/Part:BBa_K392014:Experience#User_Reviews Results]<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We successfully created our own database to organize our samples.<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Project/Database Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We successfully created a model which simulates the oxidation of ABTS.<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Modell Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We conducted a feasibility study of our project with sewage plant experts.<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We did an outstanding outreach work.<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview Results]<br />
<br />
<br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|30px|frameless|left]] <br />
:We won a gold medal.<br />
<br />
[[File:Bielefeld-Germany2012_Qualified.png|30px|frameless|left]] <br />
:We qualified for the Boston finals<br />
<br />
</b><br />
<br />
<br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Project/AchievmentsTeam:Bielefeld-Germany/Project/Achievments2012-10-26T23:33:03Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<br />
<html><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Project Achievements<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
<br />
<b><br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]]<br />
:We successfully produced purified and identified active laccases of ''E. coli'' BL21(CueO named ECOL), ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL), ''Bacillus halodurans'' C-125 laccase (Lbh1 named BHAL) and ''Thermus thermophilus'' HB27 (tthL named TTHL).<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli Results ECOL] <br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi Results BPUL]<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo Results TTHL]<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo Results BHAL]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We successfully designed a shuttle vector for site-directed integration in ''P. pastoris'' which allows the production and secretion of a protein of interest. We were able to show that the vector is functioning as expected. <br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/vector Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We successfully produced the laccase TVEL5 from ''Trametes versicolor'' in ''P. pastoris'' and showed the activity of the produced enzymes.<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/tvel5 Results] <br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:Successful characterization of the activity of all four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Activity_Analysis_of_ECOL Results ECOL]<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/pumi#Activity_analysis_of_BPUL Results BPUL]<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/thermo#Activity_analysis_of_TTHL Results TTHL]<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/halo#Activity_Analysis_of_BHAL Results BHAL]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We established a method for the degradation of several compounds with the help of our self-produced laccases. The HPLC analysis showed that our produced bacterial laccases are able to degrade estradiol with and without addition of ABTS. BPUL is able to degrade ethinyl estradiol with addition of ABTS. LC-MS measurements showed degradation products which could not be identified but were further analyzed using MS/MS. The resulting products have been discussed with an organic chemist.<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#6 Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We successfully immobilized ''Trametes versicolor'' laccase (named TVEL0), ''E. coli'' BL21 laccase (CueO named ECOL) and ''Bacillus pumilus'' DSM 27 laccase (CotA named BPUL) and measured their activity. <br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results TVEL0]<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results ECOL]<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Results/immo Results BPUL]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We successfully improved a BioBrick by clarifying its true function. <br />
<br />
:[http://partsregistry.org/Part:BBa_K392014:Experience#User_Reviews Results]<br />
<br />
<br />
:[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] We successfully created our own database to organize our samples.<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Project/Database Results]<br />
<br />
<br />
:[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] We successfully created a model which simulates the oxidation of ABTS.<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Modell Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We conducted a feasibility study of our project with sewage plant experts.<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant Results]<br />
<br />
<br />
[[File:Bielefeld2012_haken_grau.jpg|30px|frameless|left]] <br />
:We did an outstanding outreach work.<br />
<br />
:[https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview Results]<br />
<br />
<br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|30px|frameless|left]] <br />
:We won a gold medal.<br />
<br />
[[File:Bielefeld-Germany2012_Qualified.png|30px|frameless|left]] <br />
:We qualified for the Boston finals<br />
<br />
</b><br />
<br />
<br />
<br />
<html><br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mohttp://2012.igem.org/Team:Bielefeld-GermanyTeam:Bielefeld-Germany2012-10-26T23:19:12Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<html><br />
<br />
<!-- Flexslider CSS and JS --><br />
<link rel="stylesheet" href="http://2012.igem-bielefeld.de/includes/wiki/flex/css/flexslider.css" type="text/css"><br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js"></script><br />
<script src="http://2012.igem-bielefeld.de/includes/wiki/flex/js/jquery.flexslider.js"></script><br />
<br />
<!-- Load the flexslider --><br />
<script type="text/javascript" charset="utf-8"><br />
$(window).load(function() {<br />
$('.flexslider').flexslider({<br />
animation: "fade", // slide or fade<br />
controlsContainer: ".flex-container" // the container that holds the flexslider<br />
});<br />
});<br />
</script><br />
<br />
<!-- Slider Container and Images --><br />
<div style="padding:5px; z-index:1;"><br />
<br />
<div class="flexslider"><br />
<ul class="slides"><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Our Plan<br />
</div><br />
<br />
TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE <br><br />
The goal is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds.<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Appoach"><br />
Click here to read more</a> about our project<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/Bielefeld2012_Realization.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Realization<br />
</div><br />
<br />
To realize our plans we first produce the laccases in the different clades and purify them. After this we immobilized and tested their acitivity. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary"><br />
Click here to read more </a> about our methodes...<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d8/Bielefeld2012_Potential.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Potential<br />
</div><br />
<br />
While working with two different clarification plants we confirmed that our project has the opportunity to solve problems with micro contaminations. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant"><br />
Click here to read more</a> about the usage in a clarification plants and micro conterminations...</p> <br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Bielefeld2012_Trametes_Laccase.JPG"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Laccases - Our Teammate<br />
</div><br />
Laccases have the ability to oxidize phenolic and nonphenolic lignin related compounds as well as highly recalcitrant environmental pollutants. This makes them very useful for applications concerning several biotechnological processes. <br />
<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Background#3"><br />
Click here to read more</a> about laccases...<br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class=clear></div><br />
</div><br />
</li><br />
<br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
</div><br />
<br />
<div class=frontpage-content-left><br />
<div id=page-title><br />
<span id=page-title-text><br />
Welcome<br />
</span><br />
</div><br />
<br />
<p align=justify><br />
The birth control pill is a widespread contraception method. However, large amounts of these modified estrogens leave the body again in urine. The conventional methods in sewage treatment plants are unable to treat waste water sufficiently because the most frequently used estrogen ethinyl estradiol is very difficult to break down. As a result, the hormone finds its way into rivers and lakes and accumulates in drinking water with serious consequences for fish and other aquatic life. These range from reproductive and severe developmental disorders to the formation of female sexual characteristics in males. The long-term consequences of increasing estrogen pollution for human beings are still largely unknown. Nonetheless, declining sperm counts and thereby increasing infertility in men living in industrial nations may well relate to this hormonal pollution. In addition, testicular and prostate cancers as well as osteoporosis could be a consequence of overly high concentrations of estrogen in the human body.<br><br><br />
The goal of Bielefeld’s iGEM team is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds. Laccases are copper-containing oxidase enzymes found in many organisms, and one of their properties is the ability to break down a wide range of aromatic and phenolic compounds. For this purpose, genes of various bacterial and eukaryotic laccases should be isolated and expressed in <i>Escherichia coli</i> and <i>Pichia pastoris</i>. The team is aiming to manufacture this enzyme economically and safely with the help of methods from synthetic biology. It should also be possible to extend the concept to other, in part poisonous and carcinogenic pollutants in drinking and waste water, as well as into industrial application, such as in paper and textile industries or even for bioremediation of contaminated soil. </p><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
A Case for Laccase!<br />
</span><br />
</div><br />
<iframe width="550" height="350" align="center" src="http://www.youtube.com/embed/qKOCKYnBsB8" frameborder="0" allowfullscreen></iframe><br />
<br />
<br />
</div><br />
<div class=frontpage-content-right><br />
<div id=page-title><br />
<span id=page-title-text><br />
iGEM Team Bielefeld 2012<br />
</span><br />
</div><br />
<br />
<div align="center" style="z-index:0;"><object width="375" height="220"><param name="movie" value="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><param name="wmode" value="opaque" /><embed src="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="375" height="220" wmode="opaque"></embed></object></div><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Achievements<br />
</span><br />
</div><br />
</html><br />
<p><br />
[[File:Bielefeld-Germany2012_Goldmedaillie.png|50px|left]]<br />
::Won a gold medal in Amsterdam.<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Qualified_stemp.png|50px|left]]<br />
::Qualified for the finals in Boston.<br />
</p><br />
<br style="clear: both" /><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Creation of a database to organize our samples.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Production of four active bacterial laccases.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful characterization of the activity of four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of the ''Trametes versicolor''-laccase (named TVEL0) and measurement of its activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful immobilization of four bacterial laccases and measurement of their activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Feasibility study of our project.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]]<br />
:Improved a BioBrick by clarifying its true function.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|20px|left]] <br />
:Successful creation of a model which simulates the required laccase amount to degraded harmful substances in real sewageplant conditions.<br />
</p><br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div class=frontpage-content-full><br />
<div id=page-title><br />
<span id=page-title-text><br />
Our Partners<br />
</span><br />
</div><br />
</div><br />
</body><br />
</html><br />
{| cellspacing="30"<br />
| [[File:Promega logo 180x109.gif|120px|link=http://www.promega.com/]] || <br />
| [[Image:Logo merck.jpg|100px|link=http://www.merckgroup.com/en/index.html]] ||<br />
| [[File:BioCircle.JPG|100px|link=http://www.bio-circle.de/home.html]] || <br />
| [[File:Bielefeld2012 Evonik.jpg|140px|link=http://www.evonik.de]] ||<br />
| [[File:Bielefeld2012_Baxter.png|100px|link=http://www.baxter.de]] <br />
|-<br />
| [[File:Logo knauer.jpg|100px|link=http://www.knauer.net/]] || <br />
| [[File:Logo iit.jpg|100px|link=http://www.iit-biotech.de]] ||<br />
| [[File:logo biometra.jpg|150px|link=http://www.biometra.de ]] ||<br />
| [[File:Bielefeld2012_BIEKUBA.jpg|100px|link=http://www.iit-unibi.de/]] ||<br />
| [[File:Bielefeld2012_Logo_ERASynbio.jpg|100px|link=http://www.erasynbio.net/]]<br />
|- <br />
| [[File:Logo bio-nrw.png|100px|link=http://www.bio.nrw.de/en]] || <br />
| [[File:Bielefeld-Germany-CeBiTec.jpg|100px|link=http://www.cebitec.uni-bielefeld.de/]] || <br />
| [[File: IgemBielefeld_2011_Logo_uni.jpg|100px|link=http://www.uni-bielefeld.de]] || <br />
| [[File:IgemBielefeld_Logo_biofak.jpg|100px|link=http://www.uni-bielefeld.de/biologie]] || <br />
| [[File:Bielefeld-Uniersity-techfak.gif|100px|link=http://www.techfak.uni-bielefeld.de/web/ ]]<br />
|}<br />
<br />
<br />
<br />
<html><br />
<div id="content-footer-box"><br />
<div class="content-footer-box-left"><br />
<div class="about"><br />
<p>About our Wiki</p><br />
<p>Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach. </p><br />
</div><br />
<div class="contact"><br />
<p>Contact Us</p><br />
<p>Universität Bielefeld<br><br />
Universitätsstraße 25<br><br />
D-33615 Bielefeld<br><br><a href="mailto:info@igem-bielefeld.de">info(at)igem-bielefeld.de</a></p><br />
</div><br />
</div><br />
<div class="content-footer-box-right"><br />
<div class="navigate"><br />
<p>Navigate our Wiki</p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany'>Start</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Members'>Team</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Description">Project</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary">Results</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Results">Since Regionals</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview">Human Practice</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Safety'>Safety</a><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Judging'>Judging</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Partner'>Partner</a></p><br />
</div><br />
<div class="facebook"><br />
<div id="fb_bg"><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fpages%2FiGEM_Bielefeld%2F244094752286371&amp;width=292&amp;height=300&amp;colorscheme=light&amp;show_faces=false&amp;border_color&amp;stream=true&amp;header=false" scrolling="no" frameborder="0" style="border:0px; overflow:hidden; width:292px; height:300px;" allowTransparency="false"></iframe><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</html></div>Mohttp://2012.igem.org/Team:Bielefeld-GermanyTeam:Bielefeld-Germany2012-10-26T23:05:15Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<html><br />
<br />
<!-- Flexslider CSS and JS --><br />
<link rel="stylesheet" href="http://2012.igem-bielefeld.de/includes/wiki/flex/css/flexslider.css" type="text/css"><br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js"></script><br />
<script src="http://2012.igem-bielefeld.de/includes/wiki/flex/js/jquery.flexslider.js"></script><br />
<br />
<!-- Load the flexslider --><br />
<script type="text/javascript" charset="utf-8"><br />
$(window).load(function() {<br />
$('.flexslider').flexslider({<br />
animation: "fade", // slide or fade<br />
controlsContainer: ".flex-container" // the container that holds the flexslider<br />
});<br />
});<br />
</script><br />
<br />
<!-- Slider Container and Images --><br />
<div style="padding:5px; z-index:1;"><br />
<br />
<div class="flexslider"><br />
<ul class="slides"><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Our Plan<br />
</div><br />
<br />
TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE <br><br />
The goal is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds.<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Appoach"><br />
Click here to read more</a> about our project<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/Bielefeld2012_Realization.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Realization<br />
</div><br />
<br />
To realize our plans we first produce the laccases in the different clades and purify them. After this we immobilized and tested their acitivity. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary"><br />
Click here to read more </a> about our methodes...<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d8/Bielefeld2012_Potential.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Potential<br />
</div><br />
<br />
While working with two different clarification plants we confirmed that our project has the opportunity to solve problems with micro contaminations. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant"><br />
Click here to read more</a> about the usage in a clarification plants and micro conterminations...</p> <br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Bielefeld2012_Trametes_Laccase.JPG"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Laccases - Our Teammate<br />
</div><br />
Laccases have the ability to oxidize phenolic and nonphenolic lignin related compounds as well as highly recalcitrant environmental pollutants. This makes them very useful for applications concerning several biotechnological processes. <br />
<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Background#3"><br />
Click here to read more</a> about laccases...<br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class=clear></div><br />
</div><br />
</li><br />
<br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
</div><br />
<br />
<div class=frontpage-content-left><br />
<div id=page-title><br />
<span id=page-title-text><br />
Welcome<br />
</span><br />
</div><br />
<br />
<p align=justify><br />
The birth control pill is a widespread contraception method. However, large amounts of these modified estrogens leave the body again in urine. The conventional methods in sewage treatment plants are unable to treat waste water sufficiently because the most frequently used estrogen ethinyl estradiol is very difficult to break down. As a result, the hormone finds its way into rivers and lakes and accumulates in drinking water with serious consequences for fish and other aquatic life. These range from reproductive and severe developmental disorders to the formation of female sexual characteristics in males. The long-term consequences of increasing estrogen pollution for human beings are still largely unknown. Nonetheless, declining sperm counts and thereby increasing infertility in men living in industrial nations may well relate to this hormonal pollution. In addition, testicular and prostate cancers as well as osteoporosis could be a consequence of overly high concentrations of estrogen in the human body.<br><br><br />
The goal of Bielefeld’s iGEM team is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds. Laccases are copper-containing oxidase enzymes found in many organisms, and one of their properties is the ability to break down a wide range of aromatic and phenolic compounds. For this purpose, genes of various bacterial and eukaryotic laccases should be isolated and expressed in <i>Escherichia coli</i> and <i>Pichia pastoris</i>. The team is aiming to manufacture this enzyme economically and safely with the help of methods from synthetic biology. It should also be possible to extend the concept to other, in part poisonous and carcinogenic pollutants in drinking and waste water, as well as into industrial application, such as in paper and textile industries or even for bioremediation of contaminated soil. </p><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
A Case for Laccase!<br />
</span><br />
</div><br />
<iframe width="550" height="350" align="center" src="http://www.youtube.com/embed/qKOCKYnBsB8" frameborder="0" allowfullscreen></iframe><br />
<br />
<br />
</div><br />
<div class=frontpage-content-right><br />
<div id=page-title><br />
<span id=page-title-text><br />
iGEM Team Bielefeld 2012<br />
</span><br />
</div><br />
<br />
<div align="center" style="z-index:0;"><object width="375" height="220"><param name="movie" value="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><param name="wmode" value="opaque" /><embed src="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="375" height="220" wmode="opaque"></embed></object></div><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Achievements<br />
</span><br />
</div><br />
</html><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Won a gold medal in Amsterdam.[[File:Bielefeld-Germany2012_Goldmedaillie.png|300px|center]]<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Qualified for the finals in Boston.[[File:Bielefeld-Germany2012_Qualified_stemp.png|300px|center]]<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Creation of a database to organize our samples.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Production of four active bacterial laccases.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Successful characterization of the activity of four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Successful immobilization of the ''Trametes versicolor''-laccase (named TVEL0) and measurement of its activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Successful immobilization of four bacterial laccases and measurement of their activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Feasibility study of our project.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Improved a BioBrick by clarifying its true function.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Successful creation of a model which simulates the required laccase amount to degraded harmful substances in real sewageplant conditions.<br />
</p><br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div class=frontpage-content-full><br />
<div id=page-title><br />
<span id=page-title-text><br />
Our Partners<br />
</span><br />
</div><br />
</div><br />
</body><br />
</html><br />
{| cellspacing="30"<br />
| [[File:Promega logo 180x109.gif|120px|link=http://www.promega.com/]] || <br />
| [[Image:Logo merck.jpg|100px|link=http://www.merckgroup.com/en/index.html]] ||<br />
| [[File:BioCircle.JPG|100px|link=http://www.bio-circle.de/home.html]] || <br />
| [[File:Bielefeld2012 Evonik.jpg|140px|link=http://www.evonik.de]] ||<br />
| [[File:Bielefeld2012_Baxter.png|100px|link=http://www.baxter.de]] <br />
|-<br />
| [[File:Logo knauer.jpg|100px|link=http://www.knauer.net/]] || <br />
| [[File:Logo iit.jpg|100px|link=http://www.iit-biotech.de]] ||<br />
| [[File:logo biometra.jpg|150px|link=http://www.biometra.de ]] ||<br />
| [[File:Bielefeld2012_BIEKUBA.jpg|100px|link=http://www.iit-unibi.de/]] ||<br />
| [[File:Bielefeld2012_Logo_ERASynbio.jpg|100px|link=http://www.erasynbio.net/]]<br />
|- <br />
| [[File:Logo bio-nrw.png|100px|link=http://www.bio.nrw.de/en]] || <br />
| [[File:Bielefeld-Germany-CeBiTec.jpg|100px|link=http://www.cebitec.uni-bielefeld.de/]] || <br />
| [[File: IgemBielefeld_2011_Logo_uni.jpg|100px|link=http://www.uni-bielefeld.de]] || <br />
| [[File:IgemBielefeld_Logo_biofak.jpg|100px|link=http://www.uni-bielefeld.de/biologie]] || <br />
| [[File:Bielefeld-Uniersity-techfak.gif|100px|link=http://www.techfak.uni-bielefeld.de/web/ ]]<br />
|}<br />
<br />
<br />
<br />
<html><br />
<div id="content-footer-box"><br />
<div class="content-footer-box-left"><br />
<div class="about"><br />
<p>About our Wiki</p><br />
<p>Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach. </p><br />
</div><br />
<div class="contact"><br />
<p>Contact Us</p><br />
<p>Universität Bielefeld<br><br />
Universitätsstraße 25<br><br />
D-33615 Bielefeld<br><br><a href="mailto:info@igem-bielefeld.de">info(at)igem-bielefeld.de</a></p><br />
</div><br />
</div><br />
<div class="content-footer-box-right"><br />
<div class="navigate"><br />
<p>Navigate our Wiki</p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany'>Start</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Members'>Team</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Description">Project</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary">Results</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Results">Since Regionals</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview">Human Practice</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Safety'>Safety</a><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Judging'>Judging</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Partner'>Partner</a></p><br />
</div><br />
<div class="facebook"><br />
<div id="fb_bg"><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fpages%2FiGEM_Bielefeld%2F244094752286371&amp;width=292&amp;height=300&amp;colorscheme=light&amp;show_faces=false&amp;border_color&amp;stream=true&amp;header=false" scrolling="no" frameborder="0" style="border:0px; overflow:hidden; width:292px; height:300px;" allowTransparency="false"></iframe><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</html></div>Mohttp://2012.igem.org/File:Bielefeld-Germany2012_Qualified_stemp.pngFile:Bielefeld-Germany2012 Qualified stemp.png2012-10-26T23:03:38Z<p>Mo: </p>
<hr />
<div></div>Mohttp://2012.igem.org/Team:Bielefeld-GermanyTeam:Bielefeld-Germany2012-10-26T22:52:20Z<p>Mo: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<br />
<html><br />
<br />
<!-- Flexslider CSS and JS --><br />
<link rel="stylesheet" href="http://2012.igem-bielefeld.de/includes/wiki/flex/css/flexslider.css" type="text/css"><br />
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js"></script><br />
<script src="http://2012.igem-bielefeld.de/includes/wiki/flex/js/jquery.flexslider.js"></script><br />
<br />
<!-- Load the flexslider --><br />
<script type="text/javascript" charset="utf-8"><br />
$(window).load(function() {<br />
$('.flexslider').flexslider({<br />
animation: "fade", // slide or fade<br />
controlsContainer: ".flex-container" // the container that holds the flexslider<br />
});<br />
});<br />
</script><br />
<br />
<!-- Slider Container and Images --><br />
<div style="padding:5px; z-index:1;"><br />
<br />
<div class="flexslider"><br />
<ul class="slides"><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6c/Bielefeld2012_Plan.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Our Plan<br />
</div><br />
<br />
TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE <br><br />
The goal is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds.<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Appoach"><br />
Click here to read more</a> about our project<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/9/9b/Bielefeld2012_Realization.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Realization<br />
</div><br />
<br />
To realize our plans we first produce the laccases in the different clades and purify them. After this we immobilized and tested their acitivity. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary"><br />
Click here to read more </a> about our methodes...<br />
</p><br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d8/Bielefeld2012_Potential.jpg"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
The Potential<br />
</div><br />
<br />
While working with two different clarification plants we confirmed that our project has the opportunity to solve problems with micro contaminations. <br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Sewage_treatment_plant"><br />
Click here to read more</a> about the usage in a clarification plants and micro conterminations...</p> <br />
<br />
</div><br />
<div class=clear></div><br />
</div><br />
</li><br />
<li><br />
<div class="frontpage-slide"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Bielefeld2012_Trametes_Laccase.JPG"><br />
<div class="slide-right-col"><br />
<div class="slide-heading"><br />
Laccases - Our Teammate<br />
</div><br />
Laccases have the ability to oxidize phenolic and nonphenolic lignin related compounds as well as highly recalcitrant environmental pollutants. This makes them very useful for applications concerning several biotechnological processes. <br />
<br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Background#3"><br />
Click here to read more</a> about laccases...<br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class=clear></div><br />
</div><br />
</li><br />
<br />
<br />
<br />
<br />
</ul><br />
</div><br />
<br />
</div><br />
<br />
<div class=frontpage-content-left><br />
<div id=page-title><br />
<span id=page-title-text><br />
Welcome<br />
</span><br />
</div><br />
<br />
<p align=justify><br />
The birth control pill is a widespread contraception method. However, large amounts of these modified estrogens leave the body again in urine. The conventional methods in sewage treatment plants are unable to treat waste water sufficiently because the most frequently used estrogen ethinyl estradiol is very difficult to break down. As a result, the hormone finds its way into rivers and lakes and accumulates in drinking water with serious consequences for fish and other aquatic life. These range from reproductive and severe developmental disorders to the formation of female sexual characteristics in males. The long-term consequences of increasing estrogen pollution for human beings are still largely unknown. Nonetheless, declining sperm counts and thereby increasing infertility in men living in industrial nations may well relate to this hormonal pollution. In addition, testicular and prostate cancers as well as osteoporosis could be a consequence of overly high concentrations of estrogen in the human body.<br><br><br />
The goal of Bielefeld’s iGEM team is to develop a biological filter using immobilized laccases to purify municipal and industrial wastewater from synthetic estrogens and other aromatic compounds. Laccases are copper-containing oxidase enzymes found in many organisms, and one of their properties is the ability to break down a wide range of aromatic and phenolic compounds. For this purpose, genes of various bacterial and eukaryotic laccases should be isolated and expressed in <i>Escherichia coli</i> and <i>Pichia pastoris</i>. The team is aiming to manufacture this enzyme economically and safely with the help of methods from synthetic biology. It should also be possible to extend the concept to other, in part poisonous and carcinogenic pollutants in drinking and waste water, as well as into industrial application, such as in paper and textile industries or even for bioremediation of contaminated soil. </p><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
A Case for Laccase!<br />
</span><br />
</div><br />
<iframe width="550" height="350" align="center" src="http://www.youtube.com/embed/qKOCKYnBsB8" frameborder="0" allowfullscreen></iframe><br />
<br />
<br />
</div><br />
<div class=frontpage-content-right><br />
<div id=page-title><br />
<span id=page-title-text><br />
iGEM Team Bielefeld 2012<br />
</span><br />
</div><br />
<br />
<div align="center" style="z-index:0;"><object width="375" height="220"><param name="movie" value="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><param name="wmode" value="opaque" /><embed src="http://www.youtube.com/v/HwvumBLdwP8?fs=1&amp;hl=en_GB" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="375" height="220" wmode="opaque"></embed></object></div><br />
<br />
<div id=page-title><br />
<span id=page-title-text><br />
Achievements<br />
</span><br />
</div><br />
</html><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Won a gold medal in Amsterdam.[[File:Bielefeld-Germany2012_Goldmedaillie.png|300px|center]]<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Creation of a database to organize our samples.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Production of four active bacterial laccases.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Successful characterization of the activity of four bacterial laccases regarding the oxidization of ABTS under different conditions.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Successful immobilization of the ''Trametes versicolor''-laccase (named TVEL0) and measurement of its activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Successful immobilization of four bacterial laccases and measurement of their activity.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Feasibility study of our project.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Improved a BioBrick by clarifying its true function.<br />
</p><br />
<p><br />
[[File:Bielefeld-Germany2012_Check.jpg|15px|left]] Successful creation of a model which simulates the oxidation of ABTS.<br />
</p><br />
<html><br />
<br />
<br />
<br />
</div><br />
<br />
<div class=frontpage-content-full><br />
<div id=page-title><br />
<span id=page-title-text><br />
Our Partners<br />
</span><br />
</div><br />
</div><br />
</body><br />
</html><br />
{| cellspacing="30"<br />
| [[File:Promega logo 180x109.gif|120px|link=http://www.promega.com/]] || <br />
| [[Image:Logo merck.jpg|100px|link=http://www.merckgroup.com/en/index.html]] ||<br />
| [[File:BioCircle.JPG|100px|link=http://www.bio-circle.de/home.html]] || <br />
| [[File:Bielefeld2012 Evonik.jpg|140px|link=http://www.evonik.de]] ||<br />
| [[File:Bielefeld2012_Baxter.png|100px|link=http://www.baxter.de]] <br />
|-<br />
| [[File:Logo knauer.jpg|100px|link=http://www.knauer.net/]] || <br />
| [[File:Logo iit.jpg|100px|link=http://www.iit-biotech.de]] ||<br />
| [[File:logo biometra.jpg|150px|link=http://www.biometra.de ]] ||<br />
| [[File:Bielefeld2012_BIEKUBA.jpg|100px|link=http://www.iit-unibi.de/]] ||<br />
| [[File:Bielefeld2012_Logo_ERASynbio.jpg|100px|link=http://www.erasynbio.net/]]<br />
|- <br />
| [[File:Logo bio-nrw.png|100px|link=http://www.bio.nrw.de/en]] || <br />
| [[File:Bielefeld-Germany-CeBiTec.jpg|100px|link=http://www.cebitec.uni-bielefeld.de/]] || <br />
| [[File: IgemBielefeld_2011_Logo_uni.jpg|100px|link=http://www.uni-bielefeld.de]] || <br />
| [[File:IgemBielefeld_Logo_biofak.jpg|100px|link=http://www.uni-bielefeld.de/biologie]] || <br />
| [[File:Bielefeld-Uniersity-techfak.gif|100px|link=http://www.techfak.uni-bielefeld.de/web/ ]]<br />
|}<br />
<br />
<br />
<br />
<html><br />
<div id="content-footer-box"><br />
<div class="content-footer-box-left"><br />
<div class="about"><br />
<p>About our Wiki</p><br />
<p>Fifteen students from different fields of study from the Bielefeld University aspired to complete a project called TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE. In his Wiki we document our achievements and our approach. </p><br />
</div><br />
<div class="contact"><br />
<p>Contact Us</p><br />
<p>Universität Bielefeld<br><br />
Universitätsstraße 25<br><br />
D-33615 Bielefeld<br><br><a href="mailto:info@igem-bielefeld.de">info(at)igem-bielefeld.de</a></p><br />
</div><br />
</div><br />
<div class="content-footer-box-right"><br />
<div class="navigate"><br />
<p>Navigate our Wiki</p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany'>Start</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Members'>Team</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Project/Description">Project</a></p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary">Results</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Results">Since Regionals</p><br />
<p><a href="https://2012.igem.org/Team:Bielefeld-Germany/Public_relations_Overview">Human Practice</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Safety'>Safety</a><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Judging'>Judging</a></p><br />
<p><a href='https://2012.igem.org/Team:Bielefeld-Germany/Partner'>Partner</a></p><br />
</div><br />
<div class="facebook"><br />
<div id="fb_bg"><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fpages%2FiGEM_Bielefeld%2F244094752286371&amp;width=292&amp;height=300&amp;colorscheme=light&amp;show_faces=false&amp;border_color&amp;stream=true&amp;header=false" scrolling="no" frameborder="0" style="border:0px; overflow:hidden; width:292px; height:300px;" allowTransparency="false"></iframe><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</html></div>Mohttp://2012.igem.org/File:Bielefeld-Germany2012_Goldmedaillie.pngFile:Bielefeld-Germany2012 Goldmedaillie.png2012-10-26T22:47:42Z<p>Mo: </p>
<hr />
<div></div>Mohttp://2012.igem.org/Team:Bielefeld-Germany/Results/cbcTeam:Bielefeld-Germany/Results/cbc2012-10-26T22:21:24Z<p>Mo: /* Since Amsterdam */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Cellulose Binding Domain <br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
</html><br />
__TOC__<br />
<br />
<br />
==Introduction==<br />
<div style="text-align:justify;"><br />
In the field of cheap protein-extraction, cellulose binding domains (CBD) have made themselves a name. A lot of publications are available providing capture of a protein from the cell-lysate with a CBD-tag as a cheap purification strategy. Also enhanced segregation with CBD-tagged proteins have been observed. In this project the idea is different, the binding of our self-produced proteins to cellulose via a protein-domain-tag is taking advantage of the binding capacity of binding domains not only for purification reasons (it is still a great benefit), but also as an immobilization procedure for our laccases for later application.<br />
<br />
[[Image:Bielefeld2012 Osaka3.jpg|500px|thumb|right|Figure 1:Graphical sequence-alignment of <partinfo>K392014</partinfo> and the [http://www.ncbi.nlm.nih.gov/nuccore/AB041993 ''xyn10A'' gene of ''C.josui'']]]<br />
To make a purification and immobilization-tag out of a protein domain, there are a lot of decisions and characterizations to do.<br />
<br />
Starting with the choice of the binding domain, the first limitation is accessibility. The first place to look at is of course the [http://partsregistry.org Partsregistry]. A promising Cellulose binding motif of the ''C. josui'' ''xyn10A'' gene (<partinfo>BBa_K392014</partinfo>) was found and ordered for the project right from the spot. After some research concerning the sequence of that BioBrick, it turned out that the part is not the CBD of the Xylanase as it should be, but the glycosyl hydrolase domain of the protein (Figure 1). This result made the part useless for the project ([http://partsregistry.org/Part:BBa_K392014:Experience complete review]) and it was the only binding domain in the [http://partsregistry.org Partsregistry] that fitted to the project.<br />
<br />
Accessible organisms were searched via NCBI for binding-domains, -proteins and -motifs and work groups were asked if they could help out. The results of the database research were only two chitin/carbohydrate binding modules within the ''Bacillus halodurans'' genome (that strain was ordered for its laccase <partinfo>BBa_K863020</partinfo>). One is in the [http://www.ncbi.nlm.nih.gov/nucleotide/289656506?report=genbank&log$=nuclalign&blast_rank=1&RID=0JPT9WMS01N Cochin chitinase gene] and the other in a [http://www.ncbi.nlm.nih.gov/protein/BAB05022.1 chitin binding protein].<br />
<br />
[[Image:Bielefeld2012_p714.jpg|200px|thumb|left|Figure 2: Plasmid-map of p714 with CBDcex; Origin: Fermentation group of Bielefeld University]][[Image:Bielefeld2012_p570.jpg|220px|thumb|left|Figure 3: Plasmid-map of p570 with CBDclos; Origin: Fermentation group of Bielefeld University]]<br />
<br />
Meanwhile the Fermentation group of our university offered the use of two plasmids (p570 & p671), containing cellulose binding domains. The cellulose binding domain of the [http://www.ncbi.nlm.nih.gov/nucleotide/327179207?report=genbank&log$=nucltop&blast_rank=3&RID=152ZCN0E01N ''Cellulomonas fimi'' ATCC 484 exoglucanase gene] (CBDcex) and the cellulose binding domain of [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein gene (''cbpA'')] (CBDclos). The decision was made to use these two domains. Staying within the cellulose binding domain-family and leave other protein domains like carbohydrate binding domains aside would keep the results comparable. For example, changing to a different binding material would change the binding capacities of both domains in the same way. Also both are bacterial CBDs and no post-translational modification and glycosylation had to be dealt with.<br />
<br />
To get to know more about these two domains, their properties and their proteins, the NCBI databases were consulted. [http://blast.ncbi.nlm.nih.gov/ BLAST] was used to identify the cellulose binding domains and ExPASy-tools were used for further analyses.<br />
<br><br><br />
<br />
[[Image:Bielefeld2012_pfam00553.jpg|150px|thumb|left|Figure 5: Predicted structure of the CBM_2-family made with Cn3D]]<br />
[[Image:Bielefeld2012_cfimiexo.jpg|450px|thumb|right|Figure 6: Protein-BLAST of [http://www.ncbi.nlm.nih.gov/nucleotide/327179207?report=genbank&log$=nucltop&blast_rank=3&RID=152ZCN0E01N ''Cellulomonas fimi'' ATCC 484 exoglucanase]]]<br />
<br />
The CBD of the ''Cellulomonas fimi'' ATCC 484 exoglucanase gene (Figure 6) is a 100 amino acid long domain, close to the C-terminal ending of the protein with a theoretical pI of 8.07 and a molecular weight of 10.3 kDa. It is classified to be stable and belongs to the Cellulose Binding Modul family 2 (pfam00553/cl02709; Figure 5). Two tryptophane residues are involved in cellulose binding in this family which is only found in bacteria. Also, a CBM49 carbohydrate binding domain is found within the protein domain, where [http://www.ncbi.nlm.nih.gov/pubmed/17322304?dopt=Abstract binding studies] have shown, that it binds to crystalline cellulose, which could be a possible target for immobilization.<br />
<br />
[[Image:Bielefeld2012_ccellubp.jpg|450px|thumb|left|Figure 7: Protein-BLAST of [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein (Cbp A)]]]<br />
[[Image:Bielefeld2012_pfam00942.jpg|150px|thumb|right|Figure 8: Predicted structure of the CBM_3-family made with Cn3D]]<br />
<br />
The CBD of the [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein gene (''cbpA'')] on the other hand is a N-terminal domain with 92 amino acids, theoretical pI of 4.56 and is also classified as stable. It belongs to the Cellulose Binding Module family 3 (pfam00942/cl03026; Figure 8) and is part of a very large cellulose binding protein with four other carbohydrate binding modules and a lot of docking interfaces for the proteins in its amino acid sequence (Figure 7).<br />
<br />
==The Binding Assay==<br />
<br />
[[image:Bielefeld2012_GFP.jpg|300px|thumb|right|''Aequorea victoria'' green fluorescent protein in action]]<br />
To measure the capacity and strength of the bonding between the cellulose binding domains and different types of cellulose many different assays have been made. One of the simplest and most often used is the fusion of the CBD to a reporter-protein, especially [http://www.ncbi.nlm.nih.gov/pubmed/22305911a green or red fluorescent protein (GFP/RFP)] is very common. The place of the CBD is measured through the fluorescence of the fused GFP and quantification can easily been done.<br />
<br />
[http://www.ncbi.nlm.nih.gov/pubmed/18573384 Protocol]:<br />
* Harvest the ''E coli''-cells producing the fusion-protein of CBD and GFP and centifuge 10 minutes at top speed.<br />
* Re-suspend the cell-pellet in 50 mM Tris-HCl-Buffer (pH 8.0).<br />
* Break down cells via sonication.<br />
* Centrifuge at top speed for 20 minutes to get rid of the cell-debris. <br />
* Take the supernatant and measure the emission at 511 nm (excitation at 501 nm) (<partinfo>E0040</partinfo>)<br />
* Mix a definite volume of lysate with a definite volume or mass of e.g. crystalline cellulose (CC) or reactivated amorphous cellulose (RAC)<br />
* Wait 15 (RAC) to 30 (CC) minutes <br />
* Take supernatant and measure the emission at 511 nm again. <br />
* The difference between the first an the second measurement is the relative quantity of what has bound to the cellulose.<br />
<br />
==Cloning of the Cellulose Binding Domains==<br />
<br />
The cloning of the CBDs should fit to the cloning of our laccases, so the BioBricks were designed with a T7-promoter and the B0034 RBS to have a similar method of cultivation. After investigating the restriction-sites it was found, that at least for the characterization of the CBDs a quick in-frame assembly of the CBDs and a GFP would be possible, because neither the CBDs nor the GFP (<partinfo>I13522</partinfo>) of the Partsregistry inherits a ''Age''I- or ''Ngo''MIV-site, which makes Freiburg-assembly possible. To do so, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Primers primers] for the constructs <partinfo>BBa_K863101</partinfo> (CBDcex(T7)), carrying the CBDcex domain from the ''C. fimi'' exoglucanase and <partinfo>BBa_K863111</partinfo> (CBDclos(T7)), carrying the CBDclos domain from the ''C.cellulovorans'' binding protein were designed. The protein-BLAST of the two CBDs gave an exact picture of which bases belong to the binding domains and which do not. To be sure not to disturb the folding anyway 6 to 12 bases up and downstream of the domains as conserved sequences were kept. Even if the [http://partsregistry.org/Part:BBa_K863101 CBDcex]is an C-terminal domain both domains were made N-terminal, so the BioBricks can carry all regulatory parts and the linked protein can easily be exchanged. This also would be nice for other people using this part.<br />
<br />
<center><br />
{|class="wikitable"<br />
| CBDcex_T7RBS|| 80 || TGAATTCGCGGCCGCTTCTAGAGTAATACGACTCACTATAGGGAAAGAGGAGAAATAATGGGT<br />CCGGCCGGGTGCCAGGT<br />
|-<br />
| CBDcex_2AS-Link_compl || 56 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGCTGCCGCCGACCGTGCAGGGCGTGC<br />
|-<br />
| CBDclos_T7RBS || 73 || CCGCTTCTAGAGTAATACGACTCACTATAGGGAAAGAGGAGAAATAATGTCAGTTGAATTTTACAACTCTAAC<br />
|-<br />
| CBDclos_2ASlink_compl|| 63 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGCTGCCTGCAAATCCAAATTCAACATATGTATC<br />
|}<br />
</center><br />
<br />
The listed complementary primers added, besides the Freiburg-suffix, a two amino acid glycine-serine-linker to the end of the CBDs. This is a very short linker, but as GFP-experts and [http://www.ncbi.nlm.nih.gov/pubmed/17394253 publications] described GFP and CBDs are very stable proteins and should cope with a very short linker. The benefit of a short linker is that protease activity is kept minimal.<br />
<br />
The GFP <partinfo>K863121</partinfo> used in the assay was an alternated version of the <partinfo>BBa_I13522</partinfo>. The [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Primers primers] that were made added a Freiburg-pre- and suffix to the GFP coding sequence and a His-tag to the C-terminus to get it purified for the measurements. This part <partinfo>BBa_K863121</partinfo> (GFP_His) should be easily added to the CBDs and assembled to the fusion-proteins <partinfo>BBa_K863103</partinfo> CBDcex(T7)+GFP_His] and <partinfo>BBa_K863113</partinfo> CBDclos(T7)+GFP_His]).<br />
<br />
<center><br />
{|class="wikitable"<br />
| GFP_Frei || 54 || TACGGAATTCGCGGCCGCTTCTAGATGGCCGGCATGCGTAAAGGAGAAGAACTT<br />
|-<br />
| GFP_His6_compl || 74 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGTGATGGTGATGGTGATGTTTGTATAGTTCATCCATGCCATGTG<br />
|}<br />
</center><br />
<br />
Since a His-tag was added to the end of the GFP, an alternate version of the <partinfo>BBa_I13522</partinfo> had to be made to compare binding of GFP with and without CBD. Therefore, a forward primer was made, to amplify the whole <partinfo>BBa_I13522</partinfo> with the GFP_His_compl-primer to add the His-tag to the C-terminus.<br />
<br />
<center><br />
{|class="wikitable"<br />
| GFP_FW_SV || 39 || acgtcacctgcgtgtagctCGTAAAGGAGAAGAACTTTT<br />
|}<br />
</center><br />
Due to bad cleavage efficiency at the ''Pst''I restriction-site in nearly all PCR-products the cloning of the CBDs ([http://partsregistry.org/Part:BBa_K863102 CBDcex(T7)] and [http://partsregistry.org/Part:BBa_K863112 CBDclos(T7)]) and especially the insertion of [http://partsregistry.org/Part:BBa_K863121 GFP_His] to the CBDs took a lot more time as expected. This was due to the fact that no additional bases were added to the 5<nowiki>'</nowiki> termini of the designed primers, thereby greatly reducing cleavage efficiency. When the problem was discovered and protocols adjusted or primers extended, cloning got a lot quicker and more successful.<br />
<br />
As the project went on the T7-constructs did not seem to work. One suspected reason was that a stop codon (TAA) that was accidentally introduced between the RBS and ATG could be the reason. To solve the problem a change to a constitutive promoter (<partinfo>BBa_J61101</partinfo>) was made using the Freiburg-assembly. Therefore Freiburg forward primers for the CBDs were made.<br />
<center><br />
{|class="wikitable"<br />
| CBDcex_Freiburg-Prefix|| 54 || GCTAGAATTCGCGGCCGCTTCTAGATGGCCGGCGGTCCGGCCGGGTGCCAGGTG<br />
|-<br />
| CBDclos_Freiburg-Prefix || 57 || GCTAGAATTCGCGGCCGCTTCTAGATGGCCGGCTCATCAATGTCAGTTGAATTTTAC<br />
|}<br />
</center><br />
<br />
The primers arrived just a few days before wiki freeze (Europe). Switching to the constitutive promoter had no obvious effect (no green colonies or culture), neither had changing the expression strain from ''E. coli'' KRX to ''E. coli'' BL21 for the T7-construct.<br />
<br />
==Since Amsterdam==<br />
<br />
After Amsterdam two approaches were made. One changing the order of the fused proteins and one altering the linker between CBD and the GFP. Both started simultaneously. [[File:Bielefeld2012_S3N10linker.jpg|500px|thumb|right|PCR-product of BBa_K863104 with S3N10-primers]]<br />
One reason for the problems could be the too short space in between the two proteins, resulting in CBD and GFP hampering each other from folding correctly. To test and solve this, a very long linker with three serines followed by ten asparagines should be assembled in the already existing parts via a blunt end cloning.<br />
<center><br />
{|class="wikitable"<br />
| S3N10_Cex_compl || 40 || TTGTTGTTGTTCGAGCTCGAGCCGACCGTGCAGGGCGTGC<br />
|-<br />
| S3N10_Clos_compl || 40 || TTGTTGTTGTTCGAGCTCGAGCTGCCGCCGACCGTGCAGG<br />
|-<br />
| S3N10_GFP || 40 || CAATAACAATAACAACAACCGTAAAGGAGAAGAACTTTTC<br />
|}<br />
</center><br />
While the PCR worked properly, ligation of the linearized new plasmid was not successful and no transformed colonies could be found in two attempts. A reason for this could be insufficient phosphorylation of the PCR product.<br />
Because already Freiburg pre- and suffix primers for the CBDs were at hand the order of the fusion proteins could easily been changed, when a Freiburg suffix primer for the GFP would be available, so it was ordered.<br />
<center><br />
{|class="wikitable"<br />
| GFP_Freiburg_compl || 61 || ACGTCTGCAGCGGCCGCTACTAGTATTAACCGGTTTTGTATAGTTCATCCATGCCATGTGT<br />
|}<br />
</center><br />
When changing the fusing proteins to GFP N-terminal and CBD C-terminal an additional single GFP was cloned in a plasmid behind a J61101 RBS to see the expression of the J23100/J61101 promoter/RBS and to have a corresponding protein for the assay as a negative control. The result was the same as before, no green colonies. The colony PCRs and digestions showed the right bands, but no construct and even the single GFP was expressed correctly. Sequencing later showed that a deletion of one of the first few bases of the ORF caused a frame shift. At this point in time it seemed as if the promoter/RBS did not work properly.<br />
So in spite of continuing working as planed on the linker between GFP and the CBDs, the efforts now focused on the usage of promoter and RBS. In the last week of lab work it was tried to assemble GFP with a CBD behind the strong B0034 RBS, followed by cutting this piece out with ''Xba''I and ''Pst''I and ligate this insert via a standard suffix insertion with the J23100 promoter. After some unsuccessful attempts ''Age''I ran empty and could not be ordered in time. A last quick-shot with a PCR product of an old (but correct) assembly (CBDcex-GFP) and a single GFP_Freiburg went well in adding it to the RBS but did not show green glowing colonies when fused to the promoter.<br />
<br />
== Literature ==<br />
Kavoosi ''et al.'' (2007) Strategy for selecting and characterizing linker peptides for CBM9-tagged fusion proteins expressed in Escherichia coli. ''Biotechnol Bioeng.'' Oct 15;98(3):599-610.<br />
<br />
Urbanowicz ''et al.'' (2007) A tomato endo-beta-1,4-glucanase, SlCel9C1, represents a distinct subclass with a new family of carbohydrate binding modules (CBM49). ''J Biol Chem.'' Apr 20;282(16):12066-74. Epub 2007 Feb 23.<br />
<br />
Sugimoto ''et al.'' (2012) Cellulose affinity purification of fusion proteins tagged with fungal family 1 cellulose-binding domain. ''Protein Expr Purif.'' Apr;82(2):290-6. Epub 2012 Jan 28.<br />
<br />
Hong ''et al.'' (2008) Bioseparation of recombinant cellulose-binding module-proteins by affinity adsorption on an ultra-high-capacity cellulosic adsorbent. ''Anal Chim Acta.'' Jul 28;621(2):193-9. Epub 2008 May 27.<br />
</div><br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Mo