http://2012.igem.org/wiki/index.php?title=Special:Contributions/Dynastywarrior&feed=atom&limit=50&target=Dynastywarrior&year=&month=
2012.igem.org - User contributions [en]
2024-03-28T16:21:04Z
From 2012.igem.org
MediaWiki 1.16.0
http://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control
Team:HKUST-Hong Kong/Module/Regulation and control
2012-10-21T14:14:25Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<div><p align="center"><font size="20">Regulation and Control Module</font></p></div><br />
<div><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module"><<< Back to Modules</a></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>Overview</p></h1><br />
</div><br />
<br />
<p>We first introduced a xylose inducible promoter that, when used to express the anti-tumor drug BMP2, can help us control the timing of its expression and secretion. We chose xylose as an inducer because of its induction efficiency, relative scarcity and low absorption rate in the colon.<a href="#_ftn1" name="_ftnref1" title="" id="_ftnref1"> </a>(Yuasa <i>et al.</i>, 1997) Besides the timing regulation, we further introduce a cell growth inhibition device to prevent the overexpression of BMP2. This device is achieved by a balance between a toxin and antitoxin pair, YdcE and YdcD. Under these two regulation systems, our B. hercules can have more reliable and controllable performance.</p><br />
<br />
<p><strong>Objectives:</strong></p><br />
<br />
<p>1. To provide external control over the induction of BMP2 expression, by using a xylose inducible promoter. (Timing regulation.)</p><br />
<br />
<p>To prevent overexpression of BMP2. (Dosage regulation.)</p><br />
<br />
</div><br />
<br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>Design</p></h1><br />
</div><br />
<br />
<p><strong>Our Module in B. hercules:</strong></p><br />
<br />
<p>1. <em>The inducible promoter. <a href="http://partsregistry.org/Part:BBa_K733002">BBa_K733002</a></em></p><br />
<br />
<p>In the consideration of our B. hercules, one of our concerns is that our bacteria may secrete BMP2 before its binding to colon cancer cells. Although BMP2 triggers the apoptosis of colon cancer cell, its better known function is the stimulate of growth and proliferation of normal epithelial cells in digestive tract. <a href="#_ftn2" name="_ftnref2" title="" id="_ftnref2"> </a>(Zhang <i>et al.</i>, 2012) Thus, we intend to introduce a regulatory timing system into our B. hercules by incorporating an inducible promoter into our device.</p><br />
<br />
<p>Admittedly, there are many different induction systems in <em>Bacillus subtilis</em>. However, to achieve the induction when our B. hercules is inside human colon, two conditions need to be taken into consideration: a) the inducer should not normally exist <em>in vivo</em>, but the option should be there to make it available in the human colon; b) the inducer should not vitiate the healthy state of the individual. Furthermore, although high efficiency of the induction is not strictly required, it will still be considerably helpful if could be achieved.</p><br />
<br />
<p>With those concerns in mind we decided on xylose to induce our B. hercules. Xylose, which is the main building block for hemicellulose, can only be found in plants. Largely absorbed in the jejunum before reaching colon, xylose is not typically present in the colon.(Yuasa <i>et al.</i>, 1997) Besides, the absorption rate of xylose in colon is low indicated by Yuasa. Thus, well scheduled diet and medication can prevent the interaction of xylose and B. hercules in an earlier stage of the digestive tract, and induction can therefore be achieved by xylose delivered in enteric capsules or from the anus.</p><br />
<br />
<p>Besides its rare existence in the human colon, xylose is an efficient inducer as for <i>PxylA</i> promoter. When ligated with gene <em>bgaB</em>, 200-fold induction was achieved 30 minutes after the induction of xylose.<a href="#_ftn3" name="_ftnref3" title="" id="_ftnref3"> </a> (Kim <i>et al</i>. 1996)<br />
</p><br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/ce/Xylose_promoter_1.JPG" width="50%" /></p><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/e/eb/Xylose_promoter_2.JPG" width="60%" /></p><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/7/7b/Xylose_promoter_3.JPG" width="60%" /></p><br />
<br />
<p>2. <em>The Cell Growth Inhibition Device. <a href="http://partsregistry.org/Part:BBa_K733012">BBa_K733012</a></em></li></em></li><br />
<br />
<p>Considering the problems caused by the unexpected proliferation of normal colon cells induced by over-dose BMP2, a regulatory system is necessary for the dosage control of BMP2 expression.(Zhang <i>et al.</i>, 2012)</p><br />
<br />
<p>In order to build this controlling system, we came up with a cell growth inhibition device to manage this task. Understanding that toxin-antitoxin operons exist abundantly in bacteria, we intend to link the expression of BMP2 with a toxin gene. However, the lone presence of the toxin gene is not enough. Stabilization, to a certain extent, is necessary, so that our B. hercules will not die after a low level of BMP2 expression. And this short-term stabilization could be achieved by introducing the corresponding anti-toxin gene of the previous toxin gene. </p><br />
<br />
<p>In order to practically implement the ideas above, a toxin-antitoxin pair – YdcE and YdcD – is used. <i>ydcE</i> encodes an endoribonuclease – EndoA, which causes cell growth inhibition, and is regarded as the "toxin" in this case. On the other hand, <i>ydcD</i> encodes YdcD (EndoAI), which counteracts the effect of EndoA and is regarded as the "anti-toxin" <a href="#_ftn4" name="_ftnref4" title="" id="_ftnref4"> </a>(Pellegrini, O. et al. 2005). By linking <i>ydcE</i> immediately after <i>Bmp2</i> gene, and put <i>ydcD</i> after <i>Ptms</i> promoter, a relatively low efficiency constitutive promoter, EndoA can be expressed simultaneously with the expression of BMP2 under the control of xylose inducible promoter, and cell growth inhibition will not occur until the produced EndoA outweighs the effect of accumulated YdcD (EndoAI).</p><br />
<br />
<p align="center"><br />
<img src="https://static.igem.org/mediawiki/2012/d/dd/CGIDfunction2..jpg" width="99%" /><br />
<img src="https://static.igem.org/mediawiki/2012/7/74/CGIDFunction.jpg" width="80%" /><br />
<br />
</p><br />
<br />
</div><br />
<br />
<div id="paragraph3" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>References</p></h1><br />
</div><br />
<br />
<div id="ftn1"><br />
<a href="#_ftnref1" name="_ftn1" title="" id="_ftn1"> </a> Yuasa, H., Kuno, C., &amp; Watanabe, J. (1997). Comparative assessment of D-xylose absorption between small intestine and large intestine..&nbsp;<em>The journal of pharmacy and pharmocology</em>,<em>49</em>, 26-29. </div><br />
<div id="ftn2"><br />
<p><a href="#_ftnref2" name="_ftn2" title="" id="_ftn2"> </a> Zhang J, Ge Y, Sun L, Cao J, Wu Q, Guo L, Wang Z. Effect of Bone Morphogenetic Protein-2 on Proliferation and Apoptosis of Gastric Cancer Cells.&nbsp;<em>Int J Med Sci</em>&nbsp;2012; 9(2):184-192. </p><br />
</div><br />
<div id="ftn3"><br />
<p><a href="#_ftnref3" name="_ftn3" title="" id="_ftn3"> </a> Kim, L., Mogk, A., &amp; Schumann, W. (1996). A xylose-inducible <i>Bacillus subtilis</i> integration vector and its application.&nbsp;<em>Gene</em>,&nbsp;<em>181</em>(1-2), 71-76. </p><br />
</div><br />
<div id="ftn4"><br />
<p><a href="#_ftnref4" name="_ftn4" title="" id="_ftn4"> </a> Pellegrini, O., Mathy, N., Gogos, A., Shapiro, L., &amp; Condon, C. (2005). The <i>Bacillus subtilis</i> ydcDE operon encodes an endoribonuclease of the MazFPemK family and its inhibitor.<em>Molecular Microbiology</em>,&nbsp;<em>56</em>(5), 1139-1148. </p><br />
</div><br />
</div><br />
</div><br />
<br />
<div style="clear:both"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
</div><br />
<br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor
Team:HKUST-Hong Kong/Module/Anti tumor
2012-10-21T14:13:14Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align = "center"><font size="20">Anti-tumor Molecule Secretion</font></p></div><br />
<br />
<div><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module"><<< Back to Modules</a></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>Overview</p></h1><br />
</div><br />
<br />
<p>As our team objective is to provide specific and efficient drug delivery against colon cancer, investigating and designing the way of drug synthesis and release is a significant part of our whole project. Hence this module is focusing on the production and delivery of anti-tumor drug. Synthesis of the drug is achieved by engineering bacteria to produce and secrete it. Release of the drug to the extracellular environment is performed by secretion of the recombinant gene product facilitated by attachment of a signaling peptide.<br><br />
</p><br />
</div><br />
<br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>Design</p></h1><br />
</div><br />
<br />
<p>Among the hundreds of studied anti-tumor chemokines, BMP2 (bone morphogenetic protein 2) has caught our attention as the &ldquo;drug&rdquo; for our project. BMP2 is a signaling molecule in the BMP pathway, which belongs to the transforming growth factor beta superfamily. One function of the BMP pathway is to induce cell differentiation, especially in the development of bone and cartilage. BMP stimulates the formation of bone by inducing differentiation of bone cells. On the other hand, BMP2 has also been suggested to have high apoptotic activity towards colon cancer cells (Beck <em>et al.,</em> 2005). According to Beck <em>et al.</em>, colon cancer cells that are treated with 100 ng/mL BMP2 for 48 hours show significant decreases in cell growth. Knowing this fact, we see the potency of BMP2 as the drug to cure colon cancer. Therefore, we incorporate mature BMP2 gene in our construct and transform it into our chosen bacterial vector. <br><br />
<br />
<br>Furthermore, our choice of chassis is also important so we can ensure the secretion of BMP2. <em>B. subtilis</em>, which is a probiotic, was chosen as the chassis because of its harmless activity towards humans and its high secretory activity which is important for the delivery of BMP2 to the environment. To activate the secretory activity of our synthesized BMP2 in <em>B. subtilis</em>, we add signaling peptide type I gene - which works mostly through the <em>B. subtilis'</em> secretory pathway - upstream of the <i>Bmp2</i> gene in our construct (Tjalsma <em>et al., </em>2000). In this way, the signaling peptide would be translated together with BMP2 as a whole peptide, and be delivered to the cell membrane. Once it reaches the cell membrane, BMP2 is separated from the signaling peptide by signal peptidase (Spase). BMP2 is then transferred outside the cell and fold into its native conformation, while the signal peptide is degraded by signal peptide peptidase (SPPases) (Tjalsma <em>et al., </em>2000)<br><br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/c4/Bmp2_2.JPG" width="50%" /></p><br />
<br />
<br>However, among hundreds of signaling peptides, we need to choose the signaling peptide that allows the secretion of the accurate mature BMP2 polypeptide in appropriate amounts. Both YbdN, a signaling peptide of relatively high efficiency in <em>B. subtilis</em>, and YdjM, a peptide supporting reliably accurate cleavage from Spase, looked promising. It would be hard for us to make the decision just based on the literature, so we chose to build the two constructs consisting of <i>ydjM</i> or <i>ybdN</i> gene at the upstream of <i>Bmp2</i> gene and compare them before making the final choice. <br><br />
<br />
<br>Although researchers have shown mature BMP2 can be produced in <em>E. coli</em> (Yuvaraj <i>et al.</i>, 2012), recombinant BMP2 has not been successfully expressed in <em>B. subtilis</em>. Also, for the characterization of our work, other than checking whether we successfully produced the recombinant protein, we need to further confirm the function of BMP2 produced by our engineered bacteria.<br><br />
</p></div><br />
<br />
<div id="paragraph3" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>References</p></h1><br />
</div><br />
<br />
<p>Beck, S. E., Jung, B. H., Fiorino, A., Gomez, J., Del Rosario, E., Cabrera, B. L., Huang, S. C., Chow, J. Y. C., &amp; Carethers J.M. (2006). Bone morphogenetic protein signaling and growth suppression in colon cancer.&nbsp;<em>The American Journal of Physiology-Gastrointestinal and Liver Physiology</em>,&nbsp;<em>291</em>(1), G135-G145.</p><br />
<br />
<p>Ernesto, C. (2000). &ldquo;Skeletal Growth Factors&rdquo;. LIPPINCOTT WILLIAMS&amp;WILKINS.</p><br />
<br />
<p>Hardwick,J.C., Van Den Brink,G.R., Bleuming,S.A., Ballester,I., Van Den Brande,J.M., Keller,J.J., Offerhaus,G.J., Van Deventer,S.J., Peppelenbosch,M.P., 2004.Bone morphogenetic protein 2 is expressed by, and acts upon, mature epithelial cells in the colon. <i>Gastroenterology</i> 2004. Jan. ;126. (1):111. -21. 126, 111-121. </p><br />
<p>Saravanan Yuvaraj, Sa&rsquo;ad H. Al-Lahham, Rajesh Somasundaram, Patrick A. Figaroa, Maikel P. Peppelenbosch, and Nicolaas A. Bos, <em>E. coli</em>-Produced BMP-2 as a Chemopreventive Strategy for Colon Cancer: A Proof-of-Concept Study.&nbsp;<em>Gastroenterology Research and Practice</em>, vol. 2012, Article ID 895462, 6 pages, 2012. doi:10.1155/2012/895462</p><br />
<br />
<p>Tjalsma, H., Bolhuis, A., Jongbloed, J. D. H., Bron, S., &amp; Dijl, J. M. V. (2000). Signal peptide-dependent protein transport in <i>bacillus subtilis</i>: a genome-based survey of the secretome.&nbsp;<em>Microbiology and Molecular Biology Reviews</em>,&nbsp;<em>64</em>(3), 515-547.</p><br />
<br />
</div><br />
<br />
<div style="clear:both"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
</div><br />
<br />
<br />
<br />
<style type="text/css"><br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor
Team:HKUST-Hong Kong/Module/Anti tumor
2012-10-21T14:12:24Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align = "center"><font size="20">Anti-tumor Molecule Secretion</font></p></div><br />
<br />
<div><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module"><<< Back to Modules</a></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>Overview</p></h1><br />
</div><br />
<br />
<p>As our team objective is to provide specific and efficient drug delivery against colon cancer, investigating and designing the way of drug synthesis and release is a significant part of our whole project. Hence this module is focusing on the production and delivery of anti-tumor drug. Synthesis of the drug is achieved by engineering bacteria to produce and secrete it. Release of the drug to the extracellular environment is performed by secretion of the recombinant gene product facilitated by attachment of a signaling peptide.<br><br />
</p><br />
</div><br />
<br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>Design</p></h1><br />
</div><br />
<br />
<p>Among the hundreds of studied anti-tumor chemokines, BMP2 (bone morphogenetic protein 2) has caught our attention as the &ldquo;drug&rdquo; for our project. BMP2 is a signaling molecule in the BMP pathway, which belongs to the transforming growth factor beta superfamily. One function of the BMP pathway is to induce cell differentiation, especially in the development of bone and cartilage. BMP stimulates the formation of bone by inducing differentiation of bone cells. On the other hand, BMP2 has also been suggested to have high apoptotic activity towards colon cancer cells (Beck <em>et al.,</em> 2005). According to Beck <em>et al.</em>, colon cancer cells that are treated with 100 ng/mL BMP2 for 48 hours show significant decreases in cell growth. Knowing this fact, we see the potency of BMP2 as the drug to cure colon cancer. Therefore, we incorporate mature BMP2 gene in our construct and transform it into our chosen bacterial vector. <br><br />
<br />
<br>Furthermore, our choice of chassis is also important so we can ensure the secretion of BMP2. <em>B. subtilis</em>, which is a probiotic, was chosen as the chassis because of its harmless activity towards humans and its high secretory activity which is important for the delivery of BMP2 to the environment. To activate the secretory activity of our synthesized BMP2 in <em>B. subtilis</em>, we add signaling peptide type I gene - which works mostly through the <em>B. subtilis'</em> secretory pathway - upstream of the <i>Bmp2</i> gene in our construct (Tjalsma <em>et al., </em>2000). In this way, the signaling peptide would be translated together with BMP2 as a whole peptide, and be delivered to the cell membrane. Once it reaches the cell membrane, BMP2 is separated from the signaling peptide by signal peptidase (Spase). BMP2 is then transferred outside the cell and fold into its native conformation, while the signal peptide is degraded by signal peptide peptidase (SPPases) (Tjalsma <em>et al., </em>2000)<br><br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/c4/Bmp2_2.JPG" width="50%" /></p><br />
<br />
<br>However, among hundreds of signaling peptides, we need to choose the signaling peptide that allows the secretion of the accurate mature BMP2 polypeptide in appropriate amounts. Both YbdN, a signaling peptide of relatively high efficiency in <em>B. subtilis</em>, and YdjM, a peptide supporting reliably accurate cleavage from Spase, looked promising. It would be hard for us to make the decision just based on the literature, so we chose to build the two constructs consisting of <i>ydjM</i> or <i>ybdN</i> gene at the upstream of <i>Bmp2</i> gene and compare them before making the final choice. <br><br />
<br />
<br>Although researchers have shown mature BMP2 can be produced in <em>E. coli</em> (Yuvaraj <i>et al.</i>, 2012), recombinant BMP2 has not been successfully expressed in <em>B. subtilis</em>. Also, for the characterization of our work, other than checking whether we successfully produced the recombinant protein, we need to further confirm the function of BMP2 produced by our engineered bacteria.<br><br />
</p></div><br />
<br />
<div id="paragraph3" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>References</p></h1><br />
</div><br />
<br />
<p>Beck, S. E., Jung, B. H., Fiorino, A., Gomez, J., Del Rosario, E., Cabrera, B. L., Huang, S. C., Chow, J. Y. C., &amp; Carethers J.M. (2006). Bone morphogenetic protein signaling and growth suppression in colon cancer.&nbsp;<em>The American Journal of Physiology-Gastrointestinal and Liver Physiology</em>,&nbsp;<em>291</em>(1), G135-G145.</p><br />
<br />
<p>Ernesto, C. (2000). &ldquo;Skeletal Growth Factors&rdquo;. LIPPINCOTT WILLIAMS&amp;WILKINS.</p><br />
<br />
<p>Hardwick,J.C., Van Den Brink,G.R., Bleuming,S.A., Ballester,I., Van Den Brande,J.M., Keller,J.J., Offerhaus,G.J., Van Deventer,S.J., Peppelenbosch,M.P., 2004.Bone morphogenetic protein 2 is expressed by, and acts upon, mature epithelial cells in the colon. <i>Gastroenterology</i> 2004. Jan. ;126. (1):111. -21. 126, 111-121. </p><br />
<p>Saravanan Yuvaraj, Sa&rsquo;ad H. Al-Lahham, Rajesh Somasundaram, Patrick A. Figaroa, Maikel P. Peppelenbosch, and Nicolaas A. Bos, <em>E. coli</em>-Produced BMP-2 as a Chemopreventive Strategy for Colon Cancer: A Proof-of-Concept Study.&nbsp;<em>Gastroenterology Research and Practice</em>, vol. 2012, Article ID 895462, 6 pages, 2012. doi:10.1155/2012/895462</p><br />
<br />
<p>Tjalsma, H., Bolhuis, A., Jongbloed, J. D. H., Bron, S., &amp; Dijl, J. M. V. (2000). Signal peptide-dependent protein transport in <i>bacillus subtilis</i>: a genome-based survey of the secretome.&nbsp;<em>Microbiology and Molecular Biology Reviews</em>,&nbsp;<em>64</em>(3), 515-547.</p><br />
<br />
</div><br />
<br />
<div><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
</div><br />
<br />
<br />
<br />
<style type="text/css"><br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Characterization
Team:HKUST-Hong Kong/Characterization
2012-09-26T20:28:43Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align="center"><font size="20">Characterization</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Introduction</h1><br />
</div><br />
<p>In our project, we have characterized two promoters and the cell death device using different methods. The results indicate that our parts are functional and we can quantitatively control their activities by changing the experimental conditions.</p><br />
</div><br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>Low Efficiency Constitutive Promoter <em>Ptms</em></h1><br />
</div><br />
<p><strong>Background Information <u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control" target="_blank" >(link to Regulation and Control Module)</a></u></strong><br /><br />
<br />
<br />
<br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/c3/Promoter_characterization_1.JPG" width="50%" /></p><br />
<br />
<br />
<br />
<br />
The key reason for using this low efficiency constitutive promoter in our construct is to enable our bacteria to express a low level of antitoxin so that the bacterial cell can only tolerate a certain amount of toxin. As the expression of BMP2 is tightly linked to the toxin, its expression can be regulated accordingly.</p><br><br />
<p><strong>Objective</strong><br /><br />
Our objective in characterizing this promoter is to test whether <em>Ptms</em> works in <i>E. coli</i> DH10B strain and determine its relative promoter unit (RPU) compared to the standard constitutive promoter (a promoter whose activity is arbitrarily valued at 1.0 by partsregistry.org).</p><br />
<br><br />
<p><strong>Intended Result</strong><br /><br />
1. <em>Ptms</em> should work in <i>E. coli</i>. This is supported by previous research (Moran et al., 1982). <br><br />
2. The activity of <em>Ptms</em> should be relatively low.<br />
</p><br />
<br />
<br><br />
<p><strong>Method</strong><br /><br />
Instead of using the absolute promoter activity as the final result, our characterization was based on obtaining the in vivo activity of this constitutive promoter. Adopting this method enables us to eliminate errors caused by different experimental conditions and give a more convincing result.<br /><br />
By linking the promoter with GFP (BBa_E0240), the promoter activity was represented by the GFP synthesis rate which can be easily measured.<i> E. coli </i>carrying the right construct was then cultured to log phase. At a time point around the mid-log phase, the GFP intensity and OD595 values were measured to obtain the Relative Promoter Units (RPU).</p><br><br />
<p><strong>Characterization Procedure</strong></p><br />
<ol><br />
<li>Constructing BBa_K733009-pSB3K3 (<em>Ptms</em>-BBa_E0240-pSB3K3); Transforming BBa_I20260-pSB3K3 (Standard Constitutive Promoter/Reference Promoter) from the 2012 Distribution Kit;</li><br />
<li>Preparing supplemented M9 medium (see below); </li><br />
<li>Culturing <i>E. coli</i> DH10B strain carrying BBa_K733009-pSB3K3 and <i>E. coli</i> carrying BBa_I20260-pSB3K3 in supplemented M9 medium and measuring the respective growth curves;</li><br />
<li>Measuring the GFP intensity and OD595 values every 15 minutes after the above mentioned<i> E. coli</i> strains are cultured to mid-log phase;</li><br />
<li>Calculating the Relative Promoter Units (RPU) using the obtained data;</li><br />
<li>Compiling the results.</li><br />
</ol><br />
<br />
<br><br />
<p><strong>Data Processing</strong></p><br />
<ol><br />
<li>After <i>E. coli</i> carrying the right construct was grown to mid-log phase, GFP intensity and OD595 were measured every 15 minutes (up to 60 mins);</li><br />
<li>For GFP intensity, curve reflecting GFP expression change was plotted; for OD595, average values were taken;</li><br />
<li>GFP synthesis rate was then obtained by calculating the slope of linear regression line of the above mentioned curve;</li><br />
<li>Absolute promoter activity of <em>Ptms</em> and BBa_I20260 were calculated by dividing the corresponding GFP synthesis rate over the average OD595 value;</li><br />
<li>Averaged absolute promoter activity was then obtained by averaging the respective sets of absolute promoter activity values;</li><br />
<li>Finally, R.P.U was calculated by dividing the averaged <em>Ptms</em> absolute promoter activity over the averaged BBa_I20260 absolute promoter activity.</li><br />
</ol><br />
<br />
<br><br />
<p><strong>Result</strong><br /><br />
<div style="margin-left: 25px"><br />
1. Suggested by the GFP expression curve we plotted, <em>Ptms</em> functions in <i>E.coli </i>DH10B strain.<br />
<br><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/d/d9/PTms_GFP.jpg" width="75%" /></p><br />
<br><br />
<i> * Above: GFP expression curve for one set of data</i><br><br />
<br><br />
2. The RPU of <em>Ptms</em> obtained was 0.046497. This shows that <em>Ptms</em> has a very low promoter efficiency in <i>E.coli</i> DH10B strain.<br />
<br><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/a/ae/PTms_Promoter.jpg" width="75%" /></p><br />
<br><br />
</div><br />
</p><br />
<br><br />
<p><strong>Discussion</strong><br /><br />
Compared to BBa_I20260, it seems that <i>E. coli</i> carrying <em>Ptms</em>-GFP has a rather low GFP expression. This may cause some difficulties in deciding whether <em>Ptms</em> functions in <i>E. coli</i> or not. However, referring to the curve (for GFP Intensity), the GFP expression for <em>Ptms</em> increased gradually with respect to time. This suggests that <em>Ptms</em> functions in <i>E. coli</i> DH10B strain, although with a low efficiency. A possible reason for its low efficiency could be that <em>Ptms</em> was originally from <i>B. subtilis</i> but was functioning in a heterologous system when placed in <i>E. coli</i>. Due to time constraints, we were unable to characterize the promoter in <i>B. subtilis</i>, and we still hope that we can address this in the future.<br />
</p><br />
<br><br />
<p><strong>Reference</strong><br /><br />
Moran, C., Lang, N., LeGrice, S., Lee, G., Stephens, M., Sonenshein, A., et al. (1982). Nucleotide sequences that signal the initiation of transcription and translation in <i>Bacillus subtilis</i>..<i>Molecular and General Genetics MGG,186,</i> 339-346.<br />
</p><br />
<br><br />
<p><strong>Supplemented M9 Medium Composition</strong><br/><br />
1. 5X M9 Salt Composition (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 64g Na<font size="1"><small>2</small></font>HPO<font size="1"><small>4</small></font>﹒7H<font size="1"><small>2</small></font>O<br><br />
(2) 15g KH<font size="1"><small>2</small></font>PO<font size="1"><small>4</small></font><br><br />
(3) 2.5g NaCl<br><br />
(4) 5.0g NH<font size="1"><small>4</small></font>CL<br><br />
<br />
</div><br />
2. Minimal 1X M9 medium (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 200ml of 5X M9 Salt <br><br />
(2) 2ml of 1M MgSO<font size="1"><small>4</small></font><br><br />
(3) 100μl of 1M CaCl<font size="1"><small>2</small></font><br><br />
(4) 5ml of 40% glycerol<br><br />
<br />
</div><br />
3. Supplement (for the final medium) <br><br />
<div style="margin-left:25px"><br />
(1) 1mM thiamine hydrochloride<br><br />
(2) 0.2% casamino acids<br />
</div><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="paragraph3" class="bodyParagraphs"><br />
<div align="right"><br />
<h1>Xylose Inducible Promoter</h1><br />
</div><br />
<br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/ce/Xylose_promoter_1.JPG" width="50%" /></p><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/e/eb/Xylose_promoter_2.JPG" width="60%" /></p><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/7/7b/Xylose_promoter_3.JPG" width="60%" /></p><br />
<br />
<br />
<br />
<br />
<br />
<p><strong>Background Information <u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control" target="_blank" >(link to Regulation and Control Module)</a></u></strong><br /><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/cf/Promoter_characterization_2.JPG" width="50%" /></p><br />
<br />
The reason for using the xylose inducible promoter is to enable control on the expression of toxin and BMP2. Xylose is not toxic and normally not present in the human colon. This provides us an easy way to induce BMP2 expression without disrupting normal human body function.</p><br><br />
<p><strong>Objective</strong><br /><br />
On characterization, we want to test whether the promoter works in <i>E. coli</i> DH10B strain and if it works, what is the absolute promoter activity under varied experimental condition (i.e. xylose concentration).</p><br />
<br><br />
<p><strong>Intended Result</strong><br /><br />
<br />
1. Xylose inducible promoter is functional in <i>E. coli</i>.<br />
<br><br />
2. After the inducer concentration has reached a certain level, a relatively stationary GFP expression level (expression upper-limit) should be observed.<br />
<br />
</p><br />
<br />
<br><br />
<p><strong>Method</strong><br /><br />
The absolute promoter activity was measured with respect to xylose concentration. <br><br />
The same reporter gene (BBa_E0240) was used to indicate promoter activity. <i>E. coli</i> carrying the right construct was cultured to log phase. Following the addition of xylose at various predetermined concentrations, at a time point around the mid-log phase, the GFP intensity and OD595 were measured for every 30 mins (up to 120 mins). Independent curves indicating the GFP intensity units (of various xylose concentrations) with respect to time were then plotted, following which the respective absolute promoter activities were calculated.<br />
</p><br />
<br><br />
<p><strong>Characterization Procedure</strong></p><br />
<ol><br />
<li>Constructing <em>xylR-PxylA</em>-BBa_E0240-pSB1A2</li><br />
<li>Preparing supplemented M9 medium (see below);</u></li><br />
<li>Culturing <i>E. coli</i> carrying <em>xylR-PxylA</em>-BBa_E0240-pSB1A2 and <i>E. coli</i> without constructs in supplemented M9 medium and measuring the growth curve respectively;</li><br />
<li>Culturing the above mentioned bacteria in supplemented M9 medium to log phase;</li><br />
<li>Adding xylose at different concentrations to different sets of bacterial culture;</li><br />
<li>Measuring the GFP intensity and OD595 values across time for every set of bacterial culture containing different xylose concentrations;</li><br />
<li>Plotting independent curves showing the GFP intensity units of various xylose concentrations with respect to time;</li><br />
<li>Plotting a graph to demonstrate the absolute promoter activity under different inducer concentrations;</li><br />
<li>Compiling the results.</li><br />
<br />
</ol><br />
<br><br />
<p><strong>Data Processing</strong></p><br />
<ol><br />
<li>After <i>E. coli</i> carrying the right construct was grown to mid-log phase, GFP intensity and OD595 were measured every 30 minutes (up to 120 mins);</li><br />
<li>For GFP intensity, curve reflecting GFP expression change was plotted; for OD595, average value was taken;</u></li><br />
<li>GFP synthesis rate was then obtained by calculating the slope of linear regression line of the above mentioned curve;</li><br />
<li>Absolute promoter activity for the promoter under different inducer concentrations were calculated by dividing the corresponding GFP synthesis rate over the average OD595 value;</li><br />
<li>Averaged absolute promoter activity was then obtained by averaging the respective sets of absolute promoter activity values.</li><br />
<br />
<br />
</ol><br />
<br><br />
<p><strong>Result</strong></p><br />
<ol><br />
<li>Shown in the figure below, with the addition of xylose, GFP expression increased. This tells us that the xylose inducible promoter is functional in <i>E. coli</i> DH10B strain.</li><br />
<li>When no xylose was added, a limited amount of GFP was expressed. This suggests that the xylose inducible promoter is to some extent leaky.</li><br />
<li>A relatively stationary GFP expression level was observed at xylose concentrations of 1% to 5%. Despite some other variables (see discussion for more details), the data suggests that the minimum inducer concentration for triggering a full induction should lie somewhere between 0% and 1%</li><br />
<li>For 10% inducer concentration, the GFP expression was relatively lower. There could be several reasons for this occurence, such as xylose metabolism by the bacteria. (see discussion for more details)</li><br />
</ol><br />
<p align="center"><br />
<img src="https://static.igem.org/mediawiki/2012/4/4c/PXylGFP.jpg" width="75%" /><br />
</p><br />
<br><br />
<br />
<p><strong>Discussion</strong></p><br />
<ol><br />
<li>It is quite obvious that addition of xylose induces GFP expression in this construct. However, a slight issue remains: even when no xylose was added, a minute but detectable amount of GFP was still expressed. This shows that the xylose inducible promoter is leaky. It should be noteworthy that this version of the xylose inducible promoter has undergone mutagenesis on 3 different sites [XX*XX]<br />
Reason for this could be that three mutagenesis had been done to the repressive gene of this promoter. Although we had adopted the most frequently used codon in <i>B.subtilis </i>for the mutagenesis, this may not work as our expectation in<i> E.coli.</i></li><br />
<li>For the observation of full induction. Our biggest problem is that the E.coli strain we used contains the xylose metabolic operon, which means xylose might be metabolized by the bacteria. To eliminate error caused by this factor, we chose to use relatively higher concentration for experiment. This further caused another problem on determining the minimum xylose concentration for full GFP induction as when xylose concentration increased to 1%, the observed GFP expression level already entered a relatively stationary phase. Therefore, based on this result, we would say that due to bacterial metabolism of xylose, we are not sure whether the real GFP maximum level is higher than our current observation. However, since for a xylose concentration above 1%, a relative stationary level of GFP was observed, we would say that the minimum xylose concentration to trigger the full induction lies below 1%. We hope that in the future we can confirm the exact concentration.</li><br />
<li>For the decreased GFP expression at 10% xylose concentration, one possible reason is that the high osmotic pressure caused by the medium may inhibit the growth and metabolism of bacteria, thus reducing the GFP expression. Another possible reason could be that the over expression of induced GFP expression may disturb the normal bacteria function, leading to a low overall GFP expression.</li><br />
</ol><br><br />
<p><strong>Supplemented M9 Medium Composition</strong><br/><br />
1. 5X M9 Salt Composition (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 64g Na<font size="1"><small>2</small></font>HPO<font size="1"><small>4</small></font>﹒7H<font size="1"><small>2</small></font>O<br><br />
(2) 15g KH<font size="1"><small>2</small></font>PO<font size="1"><small>4</small></font><br><br />
(3) 2.5g NaCl<br><br />
(4) 5.0g NH<font size="1"><small>4</small></font>CL<br><br />
<br />
</div><br />
2. Minimal 1X M9 medium (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 200ml of 5X M9 Salt <br><br />
(2) 2ml of 1M MgSO<font size="1"><small>4</small></font><br><br />
(3) 100μl of 1M CaCl<font size="1"><small>2</small></font><br><br />
(4) 5ml of 40% glycerol<br><br />
<br />
</div><br />
3. Supplement (for the final medium) <br><br />
<div style="margin-left:25px"><br />
(1) 1mM thiamine hydrochloride<br><br />
(2) 0.2% casamino acids<br />
</div><br />
<br />
</p><br />
<br />
</div><br />
<div id="paragraph4" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>ydcD-E Growth Inhibition Device</h1><br />
</div><br />
<p><strong>Background Information <u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control" target="_blank" >(link to Regulation and Control Module)</a></u></strong><br /><br />
The rationale to include this growth inhibition device is that over-dose BMP-2 can cause unexpected proliferation of normal colon cells.(Zhang et al., 2012) Thus, a growth inhibition device is introduced and needs to be characterized.<br />
</p><br />
<p><strong>Objective</strong><br /><br />
The objective of this characterization is to find out what is the minimal concentration of xylose to inhibit the growth of our B. hercules.<br />
</p><br />
<p><strong>Method</strong><br /><br />
<i>I. Construct </i> <br><br />
<div style="margin-left: 30px"><br />
<p align="center"><img src="https://static.igem.org/mediawiki/2012/0/08/CGIDchar.JPG" width="50%" /></p><br />
<br><br />
xylR: The transcriptional regulator for the xylose inducible promoter. <br><br />
PxylA: The xylose inducible promoter. <br><br />
ydcE (ndoA): The toxin gene encoding EndoA. <br><br />
pTms: The low efficient constitutive promoter. <br><br />
ydcD (endB): The antitoxin gene encoding YdcD. <br><br />
</div><br />
<br><br />
<br />
<i>II. Culture Medium </i> <br><br />
Supplemented M9 minimal medium (M9 salt, 1 mM thiamine hydrochloride, 0.2% casamino acids, 0.1 M MgSO<font size="1"><small>4</small></font>, 0.5 M CaCl<font size="1"><small>2</small></font>, 0.4% glycerol) was used for our characterization. The reason for this medium and 0.4% glycerol as the carbon source is that glucose can repress the induction of xylose. (Kim, Mogk & Schumann,. 1996) 25 mg/mL chloramphenicol was diluted 100 times and added to the medium to select the bacteria with our intended vectors. The final concentration gradient of xylose in the supplemented M9 minimal medium is: 0.05%, 0.10%, 0.15%, 0.20% and 0.25%.<br><br />
<br><br />
<br />
<i>III. Control and Experiment Group </i> <br><br />
Control Group: <i>E. coli DH10β</i> without any vector was engaged in characterization as control. It was inoulated into the supplemented M9 minimal medium with xylose concentration: 0.00%, 0.05%, 0.10%, 0.15%, 0.20%, 0.25%. Note that in the control group, the medium was not added with chloramphenicol.<br><br />
Experiment Group: <i>E. coli DH10β</i> with our cell growth inhibition device were inoculated in the supplemented M9 minimal medium with xylose concentration: 0.00%, 0.05%, 0.10%, 0.15%, 0.20%, 0.25%. The total volume of the culture was 2mL for each test tube.<br><br><br />
<br />
<i>IV. Experiment </i> <br><br />
The bacteria cultures were incubated in 37 degree Celsius, shaked with 200 rpm for exactly 16 hours. After 16-hour incubation, the turbidity of the cultures were checked and photographed. Later, 50uL culture from one set of the experiments were taken and be spread on chloramphenicol 25 ug/mL LB plate for overnight incubation. <br><br><br />
<br />
</p><br />
<br />
<br />
<p><strong>Result</strong> </p><br />
<p><br />
<div style="margin-left":40px><br />
<img src="http://partsregistry.org/wiki/images/f/f9/CGIDC.png" width="50%" /><br><br />
Note that after spreading the culture on the plates, there were bacteria growing for all the tubes in the experiment groups. Admittedly, there were distinguishable difference between the concentration of 0.00%, 0.05% and 0.10% and the concentration of 0.15%, 0.20% and 0.25%: for the left three groups, the number of bacteria was much more than that in the right three ones. This result indicated that our<i> E. coli </i>did not die for the xylose induction, but its growth was inhibited.<br><br />
</div><br />
</p><br />
<br><br />
<p><strong>Reference</strong><br /><br />
Pellegrini O, Mathy N, Gogos A, Shapiro L, and Condon C. "The<i> Bacillus subtilis </i>ydcDE operon encodes an endoribonuclease of the MazF/PemK family and its inhibitor.." <i>Molecular microbiology.</i> 56.5 (2005): 1139-1148. Print.<br><br />
Kim, L., Mogk, A., & Schumann, W. (1996). A xylose-inducible <i>Bacillus subtilis</i> integration vector and its application.. <i>Gene, 181</i>(1-2), 71-76. <br><br />
Zhang J, Ge Y, Sun L, Cao J, Wu Q, Guo L, Wang Z. Effect of Bone Morphogenetic Protein-2 on Proliferation and Apoptosis of Gastric Cancer Cells.<i> Int J Med Sci </i>2012; 9(2):184-192.<br />
</p><br />
<br />
</div><br />
<div id="paragraph5" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Colon Tumor Binding System</h1><br />
</div><br />
<p><strong>Abstract<u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding" target="_blank" >(link to Target Binding Module)</a></u></strong><br><br />
A phage displaying peptide, RPMrel, was reported to have the ability to bind to poorly differentiate colon cancer cells while having significant lower binding ability to well-differentiate colon cancer cell and other normal tissue including lung, liver and stomach. (Kelly & Jones, 2003). Displaying RPMrel peptide on <em>B. subtilis</em> cell wall is expected to enable vegetative <em>B. subtilis</em> binding to colon cancer cell line specifically without adhering to other normal epithelial cell. In this characterization, <em>B. subtilis</em> was transfected with integration plasmid pDG1661- BBa_K733007 in order to displaying RPMrel on its cell wall. Empty vector pDG1661 is also transformed into <em>B. subtilis</em> as control. HT-29 (cancer adenocarcinoma) and HBE-16 (Human Bronchial epithelial cell) are engaged for adherence test to compare the binding affinity of experiment and control <em>B. subtilis</em> on cancer cell. The binding specificity of RPMrel displaying <em>Bacillus subtilis</em> was also investigated in this characterization.</p><br><br />
<strong>Materials and Method</strong><br><br />
<li><strong>Constructing part for <em>B. subtilis</em> characterization</strong><br><br />
In order to characterize biobrick BBa_K733007 and demonstrate that it functions as expected in <em>Bacillus subtilis</em>, the recombinant DNA constructed needs to be inserted into integration plasmid pDG1661. Therefore, K733007 was first inserted into pBluescript ii KS+ through EcoRI and PstI site. Construct in pBluescript ii KS+ was further digested with EcoRI and BamHI site in order to insert into integration vector pDG1661. pDG1661-K733007 was transformed into <i>E. coli</i> DH10B and selected on Ampicillin plate (150 μg/ml). After replicated in <i>E coli</i>, pDG1661-K733007 was extracted and transformed into <em>B. subtilis</em>. LB plate containing 5μg/ml Chloramphenicol is used to select transformed <em>B. subtilis</em>. All <i>E. coli</i> and <em>B. subtilis</em> transformation were performed strictly follow the protocol uploaded in protocol section. </li><br><br />
<li><strong>Mammalian cell culture</strong><br>Colon adenocarcinoma (HT-29) was cultured in McCoy’s 5A medium supplement with 10% FBS in 5% CO2, 37℃ incubator. Normal human bronchial epithelial cell (HBE-16) was cultured in MEM medium supplemented with 10% FBS in 5%CO2, 37℃ incubator. 12-well plate was engaged to culture both cell into confluent. </li><br><br />
<li><strong>Bacillus subtilic culture</strong><br><br />
<em>Bacillus subtilis</em> transformed with pDG1661-K733007 and the one transformed with pDG1661 empty vector were cultured separately in LB medium. Overnight cultures were diluted to OD650=0.1 and sub-culture for another 3 hours until OD650 reached 1. Bacteria were washed in 0.1M PBS 3 times and then re-suspended in McCoy' 5A (without FBS) and MEM medium (without FBS) respectively.</li> <br><br />
<li><strong>Co-culture Bacillus subtilis with mammalian cell: </strong><br><br />
Confluent mammalian cells were washed with 0.1M PBS once before adding bacteria. 1ml <em>B. subtilis</em> suspensions were added into each well of mammalian cell culture plate. After co-culturing the mammalian cell with bacteria, 5 times washing with 0.1M PBS was performed then to wash away the free bacteria without attachment and move into further characterization.</li><br><br />
<li><strong>Gram staining for detecting the binding between Bacillus subtilis and colon cancer cell:</strong><br><br />
Cells were fixed with 1% paraformaldehyde for 15 minutes in room temperature. After fixation, 0.0007 % crystal violet was used to stain cells overnight. Stains were washed away the next day with water and observed under inverted microscope with 400X magnificence.</li><br><br />
<li><strong>Adherence assay through CFU calculation</strong><br><br />
0.1% Triton X-100 in 0.1M PBS was added into well after PBS washing and incubated for 10 minutes. Cells were then pellet and re-suspended in LB medium, plating on LB plate to determine CFU. (Sheng et al, 2011)</li><br><br />
<strong>Result</strong><br><br />
<p><li><strong>Gram staining </strong><br><br />
Co-cultured <i>Bacillus subtilis</i> with RPMrel peptide on HT-29 and controlled <i>Bacillus subtilis</i> on HT-29 were stained and observed under inverted microscope with 400X magnificence. As shown in figure 1, <i>Bacillus subtilis</i> and nucleus of HT-29 cell were stained in purple and both types of <i>B. subtilis</i> can be detected on HT -29 cell.</li><br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/e/ea/HKUST_Characterization_of_RPMrel_construct_and_BMP2_construct.jpg" width="40%" style="float:left"/><img src="https://static.igem.org/mediawiki/2012/6/68/HKUST_Characterization_of_RPMrel_construct_and_BMP2_construct-2.jpg" width="40%" style="float:left"/></p><br />
<br />
<br />
<p style="clear:both"><br />
Figure 1: Gram stain of B. subtilis on confluent HT-29 cell.<br><br />
A: Gram stain of HT-29 co-cultured with B. subtilsi with RPMrel peptide.<br><br />
B: Gram stain of HT-29 co-cultured with control bacteria, B. subtilis without RPMrel peptide.<br></p><br />
<p><li><strong>CFU calculation </strong><br><br />
Serial dilutions were performed before plating and plates with colony between 25~300 were counted to calculate the CFU/ml. As shown in table 1 and figure 1, more <i>Bacillus subtilis</i> with empty vector pDG1661 was detected on HT-29 cell line than the one of <i>B. subtilis</i> with RPMrel peptide on HT-29. Comparing the number of <i>Bacillus subtilis</i> with RPMrel retained on HT-29 and HBE16, more <i>Bacillus subtilis</i> can be detected on HBE16 cell. Two round of T-tests were further performed and it showed that no significant differences in the binding affinity between <i>Bacillus subtilis</i> with or without RPMrel to HT-29 cell (P>0.05) but the number of <i>Bacillus subtilis</i> with RPMrel peptide binding to HBE16 cells is significantly higher than the same bacteria bind to HT-29.</li><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/a/aa/HKUST_table_for_colon_cancer_binding_steven.jpg" width="50%"/></p><br />
<br />
Table 1: Number of Bacillus subtilis retained on different mammalian cell line.<br><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/3/30/HKUST_Number_of_Bacillus_subtilis_retained_on_mammalian_cell.jpg" width="50%"/></p><br />
Figure 2: Number of Bacillus subtilis retained on different mammalian cell line</p><br><br />
<br />
<br />
<p><strong>Discussion</strong></p><br />
<p><li><strong>Experiment result to some extent reject our hypothesis but no solid conclusion can be made at this stage:</strong><br></p><br />
<p>Based on the result from table 1 and figure 2 and two t-test performed, it can be stated that <i>B. subtilis</i> with RPMrel displaying have no significant increase in binding ability to cancer cell line and the peptide displaying results in significant improvement in binding to normal epithelial tissue. <br></p><br />
<p>However, the statement above is just based on the evidence we have now. Because of time limitation, we haven’t demonstrated that LytC system can facilitate the displaying successfully be displaying on cell wall. Therefore, we can hardly tell the unexpected result is caused by the unexpected structure changes of RPMrel when displaying on cell wall or because of the failure of LytC system in transporting and localizing RPMrel on cell wall.<br></p><br />
<p>In addition, the gram staining method used in our characterization is not consistence during our one-month characterization work. Over staining happened from time to time and the cell layers were easily detached from the bottom of well after adding crystal violet.<br></p><br />
<p>Besides, more proper control group is needed for our experiment. Because of the limitation of source and time we have, no normal epithelial cell line from digestive system can be found and used in our work. Engaging HBE16 cells in experiment is a compromised but best choice we have so far. If possible, we will try to engage othrt cell lines in our experiment in order to draw solid conclusion in the future. <br></p><br />
<p><li><strong>Future work</strong></li></p><ol><br />
<li>Using BBa_K733008 (LytC system with flag tag on its C terminus) to verify the proper functioning of the cell wall binding system.</li><br />
<li>Developing some more reliable staining method to demonstrate the adherence between <i>B. subtilis</i> and mammalian cell.</i><br />
<li>Proper control bacteria and proper control cell line need to be added in our characterization in order to obtain reliable and solid conclusions. </i><br />
</ol><br />
<br><br />
<p><strong>Reference</strong></p><br />
<p>Haiqing Sheng, Wang Jing, Lim Ji Youn, Davitt Christine, Minnich Scott A. & Hovde Carolyn J. 2012. Internalization of <i>Escherichia coli</i> O157:H7 by bovine rectal epithelial cells. <i>Frontiers of Microbiology.</i> (2012.2.32)</p><br />
<p>Kimberly A. Kelly & Jones David A.2003. Isolation of a Colon Tumor Specific Binding Peptide Using Phage Display Selection. <i>Neoplasia.</i> 5: 437 – 444</p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br />
</div><br />
<div id="paragraph6" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Characterization of BMP2</h1><br />
</div><br />
<p><strong>Characterization of Biobrick BBa_K733017:</strong><br /><br />
<strong>Abstract:</strong><br /><br />
This characterization is intended to demonstrate that <em>B. subtilis </em>transformed with BMP2 expression and secretion construct can trigger the apoptosis of colon cancer. In this characterization, <em>B. subtilis</em> was co-cultured with HT-29 cell. MTT assay which is widely used to cell proliferation and viability assay was engaged in our experiment to investigate the growth suppression effect on colon cancer cell.</p><br />
<p><strong>Material and Method:</strong></p><br />
<ul><br />
<li><strong>Constructing part for <em>B. subtilis</em> characterization : </strong></li><br />
</ul><br />
<p align="left">In order to characterize this construct in B. subtilis, the K733017 was inserted into integration vector pDG1661. Detailed methods can be referred to the characterization of BBa_K733007. </p><br />
<ul><br />
<li><strong>Mammalian cell culture:</strong></li><br />
</ul><br />
<p>Colon adenocarcinoma (HT-29) was cultured in McCoy&rsquo;s 5A medium supplement with 10% FBS in 5% CO2, 37℃ incubator. They were seeded in 96 well plate for further characterization.</p><br />
<ul><br />
<li><strong><em>Bacillus subtilic</em></strong><strong> culture: </strong></li><br />
</ul><br />
<p><em>Bacillus subtilis</em> transformed with pDG1661-K733017 and the one transformed with pDG1661 empty vector were cultured separately in LB medium. Overnight cultures were diluted to OD650=0.1 and subculture to OD650 reaching 1.0.<em> B. subtilis</em> were washed three times with 0.1M PBS and diluted to OD=0.1, 0.01, 0.001 and 0.0001 in McCoy&rsquo;s 5A medium with 10%FBS supplemented. </p><br />
<ul><br />
<li><strong>Co-culture <em>Bacillus subtilis</em> with mammalian cell: </strong></li><br />
</ul><br />
<p>3000 HT-29 cells in 100μl were seeded in 96 well plate. After overnight incubation, 100μl <em>B.subtilis</em> suspension is added into each well and co-cultured with HT-29 cell for 48 hours. </p><br />
<ul><br />
<li><strong>MTT assay: </strong></li><br />
</ul><br />
<p>Cells were washed 5 times with 0.1M PBS. 0.5% MTT solution was added and incubated in 37℃ for 4 hours. After incubation, 100ul DMSO was added into each well, shacking for 5 minutes in order to obtain homogenized solution. A570 were measured then to reflect the viability of cells. Percentage of viability was calculated through equation <img width="342" height="26" src="https://static.igem.org/mediawiki/2012/b/bb/Clip_image002.png" /> <br /><br />
<strong>Result: </strong><br /><br />
A decline trend of cell proliferation can be clearly observed when more bacteria were co-cultured with HT-29 cell as shown in figure 1. Comparing the proliferation rate HT-29 cells which were co-cultured with BMP2 producing<em> B. subtilis</em> and non-BMP2 produced <em>B. subtilis</em>, a significant decline can be detected when initial OD650 of <em>B. subtilis </em>equal to 0.1 and 0.01. (P&lt;0.05 ). No significant difference can be detected when OD650 decreased to 0.001. When it OD650 comes to 0.0001, significant increase in cell proliferation rate can be detected in experiment group. </p><img width=80% src="https://static.igem.org/mediawiki/2012/7/7f/Mmm.jpg"><br />
<p style="clear:both"><strong>Discussion: </strong><br /><br />
In this characterization, <em>Bacillus subtilis</em> transformed with plasmid pDG161-K733017 execute significant growth inhibition effect when OD650 is above 0.01. However, no supporting experiment like western blot has been successfully carried out to confirm the expression of BMP2 in <em>B. subtilis</em>. Therefore, more experiment need to be done in order to fully characterize this biobrick.</p><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Section_Heading{<br />
width:auto;<br />
height:50px;<br />
padding:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#33FF33;<br />
opacity:0.8;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
clear:both;<br />
}<br />
.Section_Heading h3 p{<br />
color:#000;<br />
}<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:autopx;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph4{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph5{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:autopx;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph6{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/File:Clip_image002.png
File:Clip image002.png
2012-09-26T20:28:20Z
<p>Dynastywarrior: </p>
<hr />
<div></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Characterization
Team:HKUST-Hong Kong/Characterization
2012-09-26T20:26:54Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align="center"><font size="20">Characterization</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Introduction</h1><br />
</div><br />
<p>In our project, we have characterized two promoters and the cell death device using different methods. The results indicate that our parts are functional and we can quantitatively control their activities by changing the experimental conditions.</p><br />
</div><br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>Low Efficiency Constitutive Promoter <em>Ptms</em></h1><br />
</div><br />
<p><strong>Background Information <u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control" target="_blank" >(link to Regulation and Control Module)</a></u></strong><br /><br />
<br />
<br />
<br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/c3/Promoter_characterization_1.JPG" width="50%" /></p><br />
<br />
<br />
<br />
<br />
The key reason for using this low efficiency constitutive promoter in our construct is to enable our bacteria to express a low level of antitoxin so that the bacterial cell can only tolerate a certain amount of toxin. As the expression of BMP2 is tightly linked to the toxin, its expression can be regulated accordingly.</p><br><br />
<p><strong>Objective</strong><br /><br />
Our objective in characterizing this promoter is to test whether <em>Ptms</em> works in <i>E. coli</i> DH10B strain and determine its relative promoter unit (RPU) compared to the standard constitutive promoter (a promoter whose activity is arbitrarily valued at 1.0 by partsregistry.org).</p><br />
<br><br />
<p><strong>Intended Result</strong><br /><br />
1. <em>Ptms</em> should work in <i>E. coli</i>. This is supported by previous research (Moran et al., 1982). <br><br />
2. The activity of <em>Ptms</em> should be relatively low.<br />
</p><br />
<br />
<br><br />
<p><strong>Method</strong><br /><br />
Instead of using the absolute promoter activity as the final result, our characterization was based on obtaining the in vivo activity of this constitutive promoter. Adopting this method enables us to eliminate errors caused by different experimental conditions and give a more convincing result.<br /><br />
By linking the promoter with GFP (BBa_E0240), the promoter activity was represented by the GFP synthesis rate which can be easily measured.<i> E. coli </i>carrying the right construct was then cultured to log phase. At a time point around the mid-log phase, the GFP intensity and OD595 values were measured to obtain the Relative Promoter Units (RPU).</p><br><br />
<p><strong>Characterization Procedure</strong></p><br />
<ol><br />
<li>Constructing BBa_K733009-pSB3K3 (<em>Ptms</em>-BBa_E0240-pSB3K3); Transforming BBa_I20260-pSB3K3 (Standard Constitutive Promoter/Reference Promoter) from the 2012 Distribution Kit;</li><br />
<li>Preparing supplemented M9 medium (see below); </li><br />
<li>Culturing <i>E. coli</i> DH10B strain carrying BBa_K733009-pSB3K3 and <i>E. coli</i> carrying BBa_I20260-pSB3K3 in supplemented M9 medium and measuring the respective growth curves;</li><br />
<li>Measuring the GFP intensity and OD595 values every 15 minutes after the above mentioned<i> E. coli</i> strains are cultured to mid-log phase;</li><br />
<li>Calculating the Relative Promoter Units (RPU) using the obtained data;</li><br />
<li>Compiling the results.</li><br />
</ol><br />
<br />
<br><br />
<p><strong>Data Processing</strong></p><br />
<ol><br />
<li>After <i>E. coli</i> carrying the right construct was grown to mid-log phase, GFP intensity and OD595 were measured every 15 minutes (up to 60 mins);</li><br />
<li>For GFP intensity, curve reflecting GFP expression change was plotted; for OD595, average values were taken;</li><br />
<li>GFP synthesis rate was then obtained by calculating the slope of linear regression line of the above mentioned curve;</li><br />
<li>Absolute promoter activity of <em>Ptms</em> and BBa_I20260 were calculated by dividing the corresponding GFP synthesis rate over the average OD595 value;</li><br />
<li>Averaged absolute promoter activity was then obtained by averaging the respective sets of absolute promoter activity values;</li><br />
<li>Finally, R.P.U was calculated by dividing the averaged <em>Ptms</em> absolute promoter activity over the averaged BBa_I20260 absolute promoter activity.</li><br />
</ol><br />
<br />
<br><br />
<p><strong>Result</strong><br /><br />
<div style="margin-left: 25px"><br />
1. Suggested by the GFP expression curve we plotted, <em>Ptms</em> functions in <i>E.coli </i>DH10B strain.<br />
<br><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/d/d9/PTms_GFP.jpg" width="75%" /></p><br />
<br><br />
<i> * Above: GFP expression curve for one set of data</i><br><br />
<br><br />
2. The RPU of <em>Ptms</em> obtained was 0.046497. This shows that <em>Ptms</em> has a very low promoter efficiency in <i>E.coli</i> DH10B strain.<br />
<br><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/a/ae/PTms_Promoter.jpg" width="75%" /></p><br />
<br><br />
</div><br />
</p><br />
<br><br />
<p><strong>Discussion</strong><br /><br />
Compared to BBa_I20260, it seems that <i>E. coli</i> carrying <em>Ptms</em>-GFP has a rather low GFP expression. This may cause some difficulties in deciding whether <em>Ptms</em> functions in <i>E. coli</i> or not. However, referring to the curve (for GFP Intensity), the GFP expression for <em>Ptms</em> increased gradually with respect to time. This suggests that <em>Ptms</em> functions in <i>E. coli</i> DH10B strain, although with a low efficiency. A possible reason for its low efficiency could be that <em>Ptms</em> was originally from <i>B. subtilis</i> but was functioning in a heterologous system when placed in <i>E. coli</i>. Due to time constraints, we were unable to characterize the promoter in <i>B. subtilis</i>, and we still hope that we can address this in the future.<br />
</p><br />
<br><br />
<p><strong>Reference</strong><br /><br />
Moran, C., Lang, N., LeGrice, S., Lee, G., Stephens, M., Sonenshein, A., et al. (1982). Nucleotide sequences that signal the initiation of transcription and translation in <i>Bacillus subtilis</i>..<i>Molecular and General Genetics MGG,186,</i> 339-346.<br />
</p><br />
<br><br />
<p><strong>Supplemented M9 Medium Composition</strong><br/><br />
1. 5X M9 Salt Composition (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 64g Na<font size="1"><small>2</small></font>HPO<font size="1"><small>4</small></font>﹒7H<font size="1"><small>2</small></font>O<br><br />
(2) 15g KH<font size="1"><small>2</small></font>PO<font size="1"><small>4</small></font><br><br />
(3) 2.5g NaCl<br><br />
(4) 5.0g NH<font size="1"><small>4</small></font>CL<br><br />
<br />
</div><br />
2. Minimal 1X M9 medium (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 200ml of 5X M9 Salt <br><br />
(2) 2ml of 1M MgSO<font size="1"><small>4</small></font><br><br />
(3) 100μl of 1M CaCl<font size="1"><small>2</small></font><br><br />
(4) 5ml of 40% glycerol<br><br />
<br />
</div><br />
3. Supplement (for the final medium) <br><br />
<div style="margin-left:25px"><br />
(1) 1mM thiamine hydrochloride<br><br />
(2) 0.2% casamino acids<br />
</div><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="paragraph3" class="bodyParagraphs"><br />
<div align="right"><br />
<h1>Xylose Inducible Promoter</h1><br />
</div><br />
<br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/ce/Xylose_promoter_1.JPG" width="50%" /></p><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/e/eb/Xylose_promoter_2.JPG" width="60%" /></p><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/7/7b/Xylose_promoter_3.JPG" width="60%" /></p><br />
<br />
<br />
<br />
<br />
<br />
<p><strong>Background Information <u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control" target="_blank" >(link to Regulation and Control Module)</a></u></strong><br /><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/cf/Promoter_characterization_2.JPG" width="50%" /></p><br />
<br />
The reason for using the xylose inducible promoter is to enable control on the expression of toxin and BMP2. Xylose is not toxic and normally not present in the human colon. This provides us an easy way to induce BMP2 expression without disrupting normal human body function.</p><br><br />
<p><strong>Objective</strong><br /><br />
On characterization, we want to test whether the promoter works in <i>E. coli</i> DH10B strain and if it works, what is the absolute promoter activity under varied experimental condition (i.e. xylose concentration).</p><br />
<br><br />
<p><strong>Intended Result</strong><br /><br />
<br />
1. Xylose inducible promoter is functional in <i>E. coli</i>.<br />
<br><br />
2. After the inducer concentration has reached a certain level, a relatively stationary GFP expression level (expression upper-limit) should be observed.<br />
<br />
</p><br />
<br />
<br><br />
<p><strong>Method</strong><br /><br />
The absolute promoter activity was measured with respect to xylose concentration. <br><br />
The same reporter gene (BBa_E0240) was used to indicate promoter activity. <i>E. coli</i> carrying the right construct was cultured to log phase. Following the addition of xylose at various predetermined concentrations, at a time point around the mid-log phase, the GFP intensity and OD595 were measured for every 30 mins (up to 120 mins). Independent curves indicating the GFP intensity units (of various xylose concentrations) with respect to time were then plotted, following which the respective absolute promoter activities were calculated.<br />
</p><br />
<br><br />
<p><strong>Characterization Procedure</strong></p><br />
<ol><br />
<li>Constructing <em>xylR-PxylA</em>-BBa_E0240-pSB1A2</li><br />
<li>Preparing supplemented M9 medium (see below);</u></li><br />
<li>Culturing <i>E. coli</i> carrying <em>xylR-PxylA</em>-BBa_E0240-pSB1A2 and <i>E. coli</i> without constructs in supplemented M9 medium and measuring the growth curve respectively;</li><br />
<li>Culturing the above mentioned bacteria in supplemented M9 medium to log phase;</li><br />
<li>Adding xylose at different concentrations to different sets of bacterial culture;</li><br />
<li>Measuring the GFP intensity and OD595 values across time for every set of bacterial culture containing different xylose concentrations;</li><br />
<li>Plotting independent curves showing the GFP intensity units of various xylose concentrations with respect to time;</li><br />
<li>Plotting a graph to demonstrate the absolute promoter activity under different inducer concentrations;</li><br />
<li>Compiling the results.</li><br />
<br />
</ol><br />
<br><br />
<p><strong>Data Processing</strong></p><br />
<ol><br />
<li>After <i>E. coli</i> carrying the right construct was grown to mid-log phase, GFP intensity and OD595 were measured every 30 minutes (up to 120 mins);</li><br />
<li>For GFP intensity, curve reflecting GFP expression change was plotted; for OD595, average value was taken;</u></li><br />
<li>GFP synthesis rate was then obtained by calculating the slope of linear regression line of the above mentioned curve;</li><br />
<li>Absolute promoter activity for the promoter under different inducer concentrations were calculated by dividing the corresponding GFP synthesis rate over the average OD595 value;</li><br />
<li>Averaged absolute promoter activity was then obtained by averaging the respective sets of absolute promoter activity values.</li><br />
<br />
<br />
</ol><br />
<br><br />
<p><strong>Result</strong></p><br />
<ol><br />
<li>Shown in the figure below, with the addition of xylose, GFP expression increased. This tells us that the xylose inducible promoter is functional in <i>E. coli</i> DH10B strain.</li><br />
<li>When no xylose was added, a limited amount of GFP was expressed. This suggests that the xylose inducible promoter is to some extent leaky.</li><br />
<li>A relatively stationary GFP expression level was observed at xylose concentrations of 1% to 5%. Despite some other variables (see discussion for more details), the data suggests that the minimum inducer concentration for triggering a full induction should lie somewhere between 0% and 1%</li><br />
<li>For 10% inducer concentration, the GFP expression was relatively lower. There could be several reasons for this occurence, such as xylose metabolism by the bacteria. (see discussion for more details)</li><br />
</ol><br />
<p align="center"><br />
<img src="https://static.igem.org/mediawiki/2012/4/4c/PXylGFP.jpg" width="75%" /><br />
</p><br />
<br><br />
<br />
<p><strong>Discussion</strong></p><br />
<ol><br />
<li>It is quite obvious that addition of xylose induces GFP expression in this construct. However, a slight issue remains: even when no xylose was added, a minute but detectable amount of GFP was still expressed. This shows that the xylose inducible promoter is leaky. It should be noteworthy that this version of the xylose inducible promoter has undergone mutagenesis on 3 different sites [XX*XX]<br />
Reason for this could be that three mutagenesis had been done to the repressive gene of this promoter. Although we had adopted the most frequently used codon in <i>B.subtilis </i>for the mutagenesis, this may not work as our expectation in<i> E.coli.</i></li><br />
<li>For the observation of full induction. Our biggest problem is that the E.coli strain we used contains the xylose metabolic operon, which means xylose might be metabolized by the bacteria. To eliminate error caused by this factor, we chose to use relatively higher concentration for experiment. This further caused another problem on determining the minimum xylose concentration for full GFP induction as when xylose concentration increased to 1%, the observed GFP expression level already entered a relatively stationary phase. Therefore, based on this result, we would say that due to bacterial metabolism of xylose, we are not sure whether the real GFP maximum level is higher than our current observation. However, since for a xylose concentration above 1%, a relative stationary level of GFP was observed, we would say that the minimum xylose concentration to trigger the full induction lies below 1%. We hope that in the future we can confirm the exact concentration.</li><br />
<li>For the decreased GFP expression at 10% xylose concentration, one possible reason is that the high osmotic pressure caused by the medium may inhibit the growth and metabolism of bacteria, thus reducing the GFP expression. Another possible reason could be that the over expression of induced GFP expression may disturb the normal bacteria function, leading to a low overall GFP expression.</li><br />
</ol><br><br />
<p><strong>Supplemented M9 Medium Composition</strong><br/><br />
1. 5X M9 Salt Composition (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 64g Na<font size="1"><small>2</small></font>HPO<font size="1"><small>4</small></font>﹒7H<font size="1"><small>2</small></font>O<br><br />
(2) 15g KH<font size="1"><small>2</small></font>PO<font size="1"><small>4</small></font><br><br />
(3) 2.5g NaCl<br><br />
(4) 5.0g NH<font size="1"><small>4</small></font>CL<br><br />
<br />
</div><br />
2. Minimal 1X M9 medium (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 200ml of 5X M9 Salt <br><br />
(2) 2ml of 1M MgSO<font size="1"><small>4</small></font><br><br />
(3) 100μl of 1M CaCl<font size="1"><small>2</small></font><br><br />
(4) 5ml of 40% glycerol<br><br />
<br />
</div><br />
3. Supplement (for the final medium) <br><br />
<div style="margin-left:25px"><br />
(1) 1mM thiamine hydrochloride<br><br />
(2) 0.2% casamino acids<br />
</div><br />
<br />
</p><br />
<br />
</div><br />
<div id="paragraph4" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>ydcD-E Growth Inhibition Device</h1><br />
</div><br />
<p><strong>Background Information <u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control" target="_blank" >(link to Regulation and Control Module)</a></u></strong><br /><br />
The rationale to include this growth inhibition device is that over-dose BMP-2 can cause unexpected proliferation of normal colon cells.(Zhang et al., 2012) Thus, a growth inhibition device is introduced and needs to be characterized.<br />
</p><br />
<p><strong>Objective</strong><br /><br />
The objective of this characterization is to find out what is the minimal concentration of xylose to inhibit the growth of our B. hercules.<br />
</p><br />
<p><strong>Method</strong><br /><br />
<i>I. Construct </i> <br><br />
<div style="margin-left: 30px"><br />
<p align="center"><img src="https://static.igem.org/mediawiki/2012/0/08/CGIDchar.JPG" width="50%" /></p><br />
<br><br />
xylR: The transcriptional regulator for the xylose inducible promoter. <br><br />
PxylA: The xylose inducible promoter. <br><br />
ydcE (ndoA): The toxin gene encoding EndoA. <br><br />
pTms: The low efficient constitutive promoter. <br><br />
ydcD (endB): The antitoxin gene encoding YdcD. <br><br />
</div><br />
<br><br />
<br />
<i>II. Culture Medium </i> <br><br />
Supplemented M9 minimal medium (M9 salt, 1 mM thiamine hydrochloride, 0.2% casamino acids, 0.1 M MgSO<font size="1"><small>4</small></font>, 0.5 M CaCl<font size="1"><small>2</small></font>, 0.4% glycerol) was used for our characterization. The reason for this medium and 0.4% glycerol as the carbon source is that glucose can repress the induction of xylose. (Kim, Mogk & Schumann,. 1996) 25 mg/mL chloramphenicol was diluted 100 times and added to the medium to select the bacteria with our intended vectors. The final concentration gradient of xylose in the supplemented M9 minimal medium is: 0.05%, 0.10%, 0.15%, 0.20% and 0.25%.<br><br />
<br><br />
<br />
<i>III. Control and Experiment Group </i> <br><br />
Control Group: <i>E. coli DH10β</i> without any vector was engaged in characterization as control. It was inoulated into the supplemented M9 minimal medium with xylose concentration: 0.00%, 0.05%, 0.10%, 0.15%, 0.20%, 0.25%. Note that in the control group, the medium was not added with chloramphenicol.<br><br />
Experiment Group: <i>E. coli DH10β</i> with our cell growth inhibition device were inoculated in the supplemented M9 minimal medium with xylose concentration: 0.00%, 0.05%, 0.10%, 0.15%, 0.20%, 0.25%. The total volume of the culture was 2mL for each test tube.<br><br><br />
<br />
<i>IV. Experiment </i> <br><br />
The bacteria cultures were incubated in 37 degree Celsius, shaked with 200 rpm for exactly 16 hours. After 16-hour incubation, the turbidity of the cultures were checked and photographed. Later, 50uL culture from one set of the experiments were taken and be spread on chloramphenicol 25 ug/mL LB plate for overnight incubation. <br><br><br />
<br />
</p><br />
<br />
<br />
<p><strong>Result</strong> </p><br />
<p><br />
<div style="margin-left":40px><br />
<img src="http://partsregistry.org/wiki/images/f/f9/CGIDC.png" width="50%" /><br><br />
Note that after spreading the culture on the plates, there were bacteria growing for all the tubes in the experiment groups. Admittedly, there were distinguishable difference between the concentration of 0.00%, 0.05% and 0.10% and the concentration of 0.15%, 0.20% and 0.25%: for the left three groups, the number of bacteria was much more than that in the right three ones. This result indicated that our<i> E. coli </i>did not die for the xylose induction, but its growth was inhibited.<br><br />
</div><br />
</p><br />
<br><br />
<p><strong>Reference</strong><br /><br />
Pellegrini O, Mathy N, Gogos A, Shapiro L, and Condon C. "The<i> Bacillus subtilis </i>ydcDE operon encodes an endoribonuclease of the MazF/PemK family and its inhibitor.." <i>Molecular microbiology.</i> 56.5 (2005): 1139-1148. Print.<br><br />
Kim, L., Mogk, A., & Schumann, W. (1996). A xylose-inducible <i>Bacillus subtilis</i> integration vector and its application.. <i>Gene, 181</i>(1-2), 71-76. <br><br />
Zhang J, Ge Y, Sun L, Cao J, Wu Q, Guo L, Wang Z. Effect of Bone Morphogenetic Protein-2 on Proliferation and Apoptosis of Gastric Cancer Cells.<i> Int J Med Sci </i>2012; 9(2):184-192.<br />
</p><br />
<br />
</div><br />
<div id="paragraph5" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Colon Tumor Binding System</h1><br />
</div><br />
<p><strong>Abstract<u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding" target="_blank" >(link to Target Binding Module)</a></u></strong><br><br />
A phage displaying peptide, RPMrel, was reported to have the ability to bind to poorly differentiate colon cancer cells while having significant lower binding ability to well-differentiate colon cancer cell and other normal tissue including lung, liver and stomach. (Kelly & Jones, 2003). Displaying RPMrel peptide on <em>B. subtilis</em> cell wall is expected to enable vegetative <em>B. subtilis</em> binding to colon cancer cell line specifically without adhering to other normal epithelial cell. In this characterization, <em>B. subtilis</em> was transfected with integration plasmid pDG1661- BBa_K733007 in order to displaying RPMrel on its cell wall. Empty vector pDG1661 is also transformed into <em>B. subtilis</em> as control. HT-29 (cancer adenocarcinoma) and HBE-16 (Human Bronchial epithelial cell) are engaged for adherence test to compare the binding affinity of experiment and control <em>B. subtilis</em> on cancer cell. The binding specificity of RPMrel displaying <em>Bacillus subtilis</em> was also investigated in this characterization.</p><br><br />
<strong>Materials and Method</strong><br><br />
<li><strong>Constructing part for <em>B. subtilis</em> characterization</strong><br><br />
In order to characterize biobrick BBa_K733007 and demonstrate that it functions as expected in <em>Bacillus subtilis</em>, the recombinant DNA constructed needs to be inserted into integration plasmid pDG1661. Therefore, K733007 was first inserted into pBluescript ii KS+ through EcoRI and PstI site. Construct in pBluescript ii KS+ was further digested with EcoRI and BamHI site in order to insert into integration vector pDG1661. pDG1661-K733007 was transformed into <i>E. coli</i> DH10B and selected on Ampicillin plate (150 μg/ml). After replicated in <i>E coli</i>, pDG1661-K733007 was extracted and transformed into <em>B. subtilis</em>. LB plate containing 5μg/ml Chloramphenicol is used to select transformed <em>B. subtilis</em>. All <i>E. coli</i> and <em>B. subtilis</em> transformation were performed strictly follow the protocol uploaded in protocol section. </li><br><br />
<li><strong>Mammalian cell culture</strong><br>Colon adenocarcinoma (HT-29) was cultured in McCoy’s 5A medium supplement with 10% FBS in 5% CO2, 37℃ incubator. Normal human bronchial epithelial cell (HBE-16) was cultured in MEM medium supplemented with 10% FBS in 5%CO2, 37℃ incubator. 12-well plate was engaged to culture both cell into confluent. </li><br><br />
<li><strong>Bacillus subtilic culture</strong><br><br />
<em>Bacillus subtilis</em> transformed with pDG1661-K733007 and the one transformed with pDG1661 empty vector were cultured separately in LB medium. Overnight cultures were diluted to OD650=0.1 and sub-culture for another 3 hours until OD650 reached 1. Bacteria were washed in 0.1M PBS 3 times and then re-suspended in McCoy' 5A (without FBS) and MEM medium (without FBS) respectively.</li> <br><br />
<li><strong>Co-culture Bacillus subtilis with mammalian cell: </strong><br><br />
Confluent mammalian cells were washed with 0.1M PBS once before adding bacteria. 1ml <em>B. subtilis</em> suspensions were added into each well of mammalian cell culture plate. After co-culturing the mammalian cell with bacteria, 5 times washing with 0.1M PBS was performed then to wash away the free bacteria without attachment and move into further characterization.</li><br><br />
<li><strong>Gram staining for detecting the binding between Bacillus subtilis and colon cancer cell:</strong><br><br />
Cells were fixed with 1% paraformaldehyde for 15 minutes in room temperature. After fixation, 0.0007 % crystal violet was used to stain cells overnight. Stains were washed away the next day with water and observed under inverted microscope with 400X magnificence.</li><br><br />
<li><strong>Adherence assay through CFU calculation</strong><br><br />
0.1% Triton X-100 in 0.1M PBS was added into well after PBS washing and incubated for 10 minutes. Cells were then pellet and re-suspended in LB medium, plating on LB plate to determine CFU. (Sheng et al, 2011)</li><br><br />
<strong>Result</strong><br><br />
<p><li><strong>Gram staining </strong><br><br />
Co-cultured <i>Bacillus subtilis</i> with RPMrel peptide on HT-29 and controlled <i>Bacillus subtilis</i> on HT-29 were stained and observed under inverted microscope with 400X magnificence. As shown in figure 1, <i>Bacillus subtilis</i> and nucleus of HT-29 cell were stained in purple and both types of <i>B. subtilis</i> can be detected on HT -29 cell.</li><br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/e/ea/HKUST_Characterization_of_RPMrel_construct_and_BMP2_construct.jpg" width="40%" style="float:left"/><img src="https://static.igem.org/mediawiki/2012/6/68/HKUST_Characterization_of_RPMrel_construct_and_BMP2_construct-2.jpg" width="40%" style="float:left"/></p><br />
<br />
<br />
<p style="clear:both"><br />
Figure 1: Gram stain of B. subtilis on confluent HT-29 cell.<br><br />
A: Gram stain of HT-29 co-cultured with B. subtilsi with RPMrel peptide.<br><br />
B: Gram stain of HT-29 co-cultured with control bacteria, B. subtilis without RPMrel peptide.<br></p><br />
<p><li><strong>CFU calculation </strong><br><br />
Serial dilutions were performed before plating and plates with colony between 25~300 were counted to calculate the CFU/ml. As shown in table 1 and figure 1, more <i>Bacillus subtilis</i> with empty vector pDG1661 was detected on HT-29 cell line than the one of <i>B. subtilis</i> with RPMrel peptide on HT-29. Comparing the number of <i>Bacillus subtilis</i> with RPMrel retained on HT-29 and HBE16, more <i>Bacillus subtilis</i> can be detected on HBE16 cell. Two round of T-tests were further performed and it showed that no significant differences in the binding affinity between <i>Bacillus subtilis</i> with or without RPMrel to HT-29 cell (P>0.05) but the number of <i>Bacillus subtilis</i> with RPMrel peptide binding to HBE16 cells is significantly higher than the same bacteria bind to HT-29.</li><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/a/aa/HKUST_table_for_colon_cancer_binding_steven.jpg" width="50%"/></p><br />
<br />
Table 1: Number of Bacillus subtilis retained on different mammalian cell line.<br><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/3/30/HKUST_Number_of_Bacillus_subtilis_retained_on_mammalian_cell.jpg" width="50%"/></p><br />
Figure 2: Number of Bacillus subtilis retained on different mammalian cell line</p><br><br />
<br />
<br />
<p><strong>Discussion</strong></p><br />
<p><li><strong>Experiment result to some extent reject our hypothesis but no solid conclusion can be made at this stage:</strong><br></p><br />
<p>Based on the result from table 1 and figure 2 and two t-test performed, it can be stated that <i>B. subtilis</i> with RPMrel displaying have no significant increase in binding ability to cancer cell line and the peptide displaying results in significant improvement in binding to normal epithelial tissue. <br></p><br />
<p>However, the statement above is just based on the evidence we have now. Because of time limitation, we haven’t demonstrated that LytC system can facilitate the displaying successfully be displaying on cell wall. Therefore, we can hardly tell the unexpected result is caused by the unexpected structure changes of RPMrel when displaying on cell wall or because of the failure of LytC system in transporting and localizing RPMrel on cell wall.<br></p><br />
<p>In addition, the gram staining method used in our characterization is not consistence during our one-month characterization work. Over staining happened from time to time and the cell layers were easily detached from the bottom of well after adding crystal violet.<br></p><br />
<p>Besides, more proper control group is needed for our experiment. Because of the limitation of source and time we have, no normal epithelial cell line from digestive system can be found and used in our work. Engaging HBE16 cells in experiment is a compromised but best choice we have so far. If possible, we will try to engage othrt cell lines in our experiment in order to draw solid conclusion in the future. <br></p><br />
<p><li><strong>Future work</strong></li></p><ol><br />
<li>Using BBa_K733008 (LytC system with flag tag on its C terminus) to verify the proper functioning of the cell wall binding system.</li><br />
<li>Developing some more reliable staining method to demonstrate the adherence between <i>B. subtilis</i> and mammalian cell.</i><br />
<li>Proper control bacteria and proper control cell line need to be added in our characterization in order to obtain reliable and solid conclusions. </i><br />
</ol><br />
<br><br />
<p><strong>Reference</strong></p><br />
<p>Haiqing Sheng, Wang Jing, Lim Ji Youn, Davitt Christine, Minnich Scott A. & Hovde Carolyn J. 2012. Internalization of <i>Escherichia coli</i> O157:H7 by bovine rectal epithelial cells. <i>Frontiers of Microbiology.</i> (2012.2.32)</p><br />
<p>Kimberly A. Kelly & Jones David A.2003. Isolation of a Colon Tumor Specific Binding Peptide Using Phage Display Selection. <i>Neoplasia.</i> 5: 437 – 444</p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br />
</div><br />
<div id="paragraph6" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Characterization of BMP2</h1><br />
</div><br />
<p><strong>Characterization of Biobrick BBa_K733017:</strong><br /><br />
<strong>Abstract:</strong><br /><br />
This characterization is intended to demonstrate that <em>B. subtilis </em>transformed with BMP2 expression and secretion construct can trigger the apoptosis of colon cancer. In this characterization, <em>B. subtilis</em> was co-cultured with HT-29 cell. MTT assay which is widely used to cell proliferation and viability assay was engaged in our experiment to investigate the growth suppression effect on colon cancer cell.</p><br />
<p><strong>Material and Method:</strong></p><br />
<ul><br />
<li><strong>Constructing part for <em>B. subtilis</em> characterization : </strong></li><br />
</ul><br />
<p align="left">In order to characterize this construct in B. subtilis, the K733017 was inserted into integration vector pDG1661. Detailed methods can be referred to the characterization of BBa_K733007. </p><br />
<ul><br />
<li><strong>Mammalian cell culture:</strong></li><br />
</ul><br />
<p>Colon adenocarcinoma (HT-29) was cultured in McCoy&rsquo;s 5A medium supplement with 10% FBS in 5% CO2, 37℃ incubator. They were seeded in 96 well plate for further characterization.</p><br />
<ul><br />
<li><strong><em>Bacillus subtilic</em></strong><strong> culture: </strong></li><br />
</ul><br />
<p><em>Bacillus subtilis</em> transformed with pDG1661-K733017 and the one transformed with pDG1661 empty vector were cultured separately in LB medium. Overnight cultures were diluted to OD650=0.1 and subculture to OD650 reaching 1.0.<em> B. subtilis</em> were washed three times with 0.1M PBS and diluted to OD=0.1, 0.01, 0.001 and 0.0001 in McCoy&rsquo;s 5A medium with 10%FBS supplemented. </p><br />
<ul><br />
<li><strong>Co-culture <em>Bacillus subtilis</em> with mammalian cell: </strong></li><br />
</ul><br />
<p>3000 HT-29 cells in 100μl were seeded in 96 well plate. After overnight incubation, 100μl <em>B.subtilis</em> suspension is added into each well and co-cultured with HT-29 cell for 48 hours. </p><br />
<ul><br />
<li><strong>MTT assay: </strong></li><br />
</ul><br />
<p>Cells were washed 5 times with 0.1M PBS. 0.5% MTT solution was added and incubated in 37℃ for 4 hours. After incubation, 100ul DMSO was added into each well, shacking for 5 minutes in order to obtain homogenized solution. A570 were measured then to reflect the viability of cells. Percentage of viability was calculated through equation <img width="342" height="26" src="file:///F|/iGEM/wiki/clip_image002.png" /> <br /><br />
<strong>Result: </strong><br /><br />
A decline trend of cell proliferation can be clearly observed when more bacteria were co-cultured with HT-29 cell as shown in figure 1. Comparing the proliferation rate HT-29 cells which were co-cultured with BMP2 producing<em> B. subtilis</em> and non-BMP2 produced <em>B. subtilis</em>, a significant decline can be detected when initial OD650 of <em>B. subtilis </em>equal to 0.1 and 0.01. (P&lt;0.05 ). No significant difference can be detected when OD650 decreased to 0.001. When it OD650 comes to 0.0001, significant increase in cell proliferation rate can be detected in experiment group. </p><img width=80% src="https://static.igem.org/mediawiki/2012/7/7f/Mmm.jpg"><br />
<p style="clear:both"><strong>Discussion: </strong><br /><br />
In this characterization, <em>Bacillus subtilis</em> transformed with plasmid pDG161-K733017 execute significant growth inhibition effect when OD650 is above 0.01. However, no supporting experiment like western blot has been successfully carried out to confirm the expression of BMP2 in <em>B. subtilis</em>. Therefore, more experiment need to be done in order to fully characterize this biobrick.</p><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Section_Heading{<br />
width:auto;<br />
height:50px;<br />
padding:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#33FF33;<br />
opacity:0.8;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
clear:both;<br />
}<br />
.Section_Heading h3 p{<br />
color:#000;<br />
}<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:autopx;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph4{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph5{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:autopx;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph6{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Characterization
Team:HKUST-Hong Kong/Characterization
2012-09-26T20:26:26Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align="center"><font size="20">Characterization</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Introduction</h1><br />
</div><br />
<p>In our project, we have characterized two promoters and the cell death device using different methods. The results indicate that our parts are functional and we can quantitatively control their activities by changing the experimental conditions.</p><br />
</div><br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>Low Efficiency Constitutive Promoter <em>Ptms</em></h1><br />
</div><br />
<p><strong>Background Information <u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control" target="_blank" >(link to Regulation and Control Module)</a></u></strong><br /><br />
<br />
<br />
<br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/c3/Promoter_characterization_1.JPG" width="50%" /></p><br />
<br />
<br />
<br />
<br />
The key reason for using this low efficiency constitutive promoter in our construct is to enable our bacteria to express a low level of antitoxin so that the bacterial cell can only tolerate a certain amount of toxin. As the expression of BMP2 is tightly linked to the toxin, its expression can be regulated accordingly.</p><br><br />
<p><strong>Objective</strong><br /><br />
Our objective in characterizing this promoter is to test whether <em>Ptms</em> works in <i>E. coli</i> DH10B strain and determine its relative promoter unit (RPU) compared to the standard constitutive promoter (a promoter whose activity is arbitrarily valued at 1.0 by partsregistry.org).</p><br />
<br><br />
<p><strong>Intended Result</strong><br /><br />
1. <em>Ptms</em> should work in <i>E. coli</i>. This is supported by previous research (Moran et al., 1982). <br><br />
2. The activity of <em>Ptms</em> should be relatively low.<br />
</p><br />
<br />
<br><br />
<p><strong>Method</strong><br /><br />
Instead of using the absolute promoter activity as the final result, our characterization was based on obtaining the in vivo activity of this constitutive promoter. Adopting this method enables us to eliminate errors caused by different experimental conditions and give a more convincing result.<br /><br />
By linking the promoter with GFP (BBa_E0240), the promoter activity was represented by the GFP synthesis rate which can be easily measured.<i> E. coli </i>carrying the right construct was then cultured to log phase. At a time point around the mid-log phase, the GFP intensity and OD595 values were measured to obtain the Relative Promoter Units (RPU).</p><br><br />
<p><strong>Characterization Procedure</strong></p><br />
<ol><br />
<li>Constructing BBa_K733009-pSB3K3 (<em>Ptms</em>-BBa_E0240-pSB3K3); Transforming BBa_I20260-pSB3K3 (Standard Constitutive Promoter/Reference Promoter) from the 2012 Distribution Kit;</li><br />
<li>Preparing supplemented M9 medium (see below); </li><br />
<li>Culturing <i>E. coli</i> DH10B strain carrying BBa_K733009-pSB3K3 and <i>E. coli</i> carrying BBa_I20260-pSB3K3 in supplemented M9 medium and measuring the respective growth curves;</li><br />
<li>Measuring the GFP intensity and OD595 values every 15 minutes after the above mentioned<i> E. coli</i> strains are cultured to mid-log phase;</li><br />
<li>Calculating the Relative Promoter Units (RPU) using the obtained data;</li><br />
<li>Compiling the results.</li><br />
</ol><br />
<br />
<br><br />
<p><strong>Data Processing</strong></p><br />
<ol><br />
<li>After <i>E. coli</i> carrying the right construct was grown to mid-log phase, GFP intensity and OD595 were measured every 15 minutes (up to 60 mins);</li><br />
<li>For GFP intensity, curve reflecting GFP expression change was plotted; for OD595, average values were taken;</li><br />
<li>GFP synthesis rate was then obtained by calculating the slope of linear regression line of the above mentioned curve;</li><br />
<li>Absolute promoter activity of <em>Ptms</em> and BBa_I20260 were calculated by dividing the corresponding GFP synthesis rate over the average OD595 value;</li><br />
<li>Averaged absolute promoter activity was then obtained by averaging the respective sets of absolute promoter activity values;</li><br />
<li>Finally, R.P.U was calculated by dividing the averaged <em>Ptms</em> absolute promoter activity over the averaged BBa_I20260 absolute promoter activity.</li><br />
</ol><br />
<br />
<br><br />
<p><strong>Result</strong><br /><br />
<div style="margin-left: 25px"><br />
1. Suggested by the GFP expression curve we plotted, <em>Ptms</em> functions in <i>E.coli </i>DH10B strain.<br />
<br><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/d/d9/PTms_GFP.jpg" width="75%" /></p><br />
<br><br />
<i> * Above: GFP expression curve for one set of data</i><br><br />
<br><br />
2. The RPU of <em>Ptms</em> obtained was 0.046497. This shows that <em>Ptms</em> has a very low promoter efficiency in <i>E.coli</i> DH10B strain.<br />
<br><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/a/ae/PTms_Promoter.jpg" width="75%" /></p><br />
<br><br />
</div><br />
</p><br />
<br><br />
<p><strong>Discussion</strong><br /><br />
Compared to BBa_I20260, it seems that <i>E. coli</i> carrying <em>Ptms</em>-GFP has a rather low GFP expression. This may cause some difficulties in deciding whether <em>Ptms</em> functions in <i>E. coli</i> or not. However, referring to the curve (for GFP Intensity), the GFP expression for <em>Ptms</em> increased gradually with respect to time. This suggests that <em>Ptms</em> functions in <i>E. coli</i> DH10B strain, although with a low efficiency. A possible reason for its low efficiency could be that <em>Ptms</em> was originally from <i>B. subtilis</i> but was functioning in a heterologous system when placed in <i>E. coli</i>. Due to time constraints, we were unable to characterize the promoter in <i>B. subtilis</i>, and we still hope that we can address this in the future.<br />
</p><br />
<br><br />
<p><strong>Reference</strong><br /><br />
Moran, C., Lang, N., LeGrice, S., Lee, G., Stephens, M., Sonenshein, A., et al. (1982). Nucleotide sequences that signal the initiation of transcription and translation in <i>Bacillus subtilis</i>..<i>Molecular and General Genetics MGG,186,</i> 339-346.<br />
</p><br />
<br><br />
<p><strong>Supplemented M9 Medium Composition</strong><br/><br />
1. 5X M9 Salt Composition (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 64g Na<font size="1"><small>2</small></font>HPO<font size="1"><small>4</small></font>﹒7H<font size="1"><small>2</small></font>O<br><br />
(2) 15g KH<font size="1"><small>2</small></font>PO<font size="1"><small>4</small></font><br><br />
(3) 2.5g NaCl<br><br />
(4) 5.0g NH<font size="1"><small>4</small></font>CL<br><br />
<br />
</div><br />
2. Minimal 1X M9 medium (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 200ml of 5X M9 Salt <br><br />
(2) 2ml of 1M MgSO<font size="1"><small>4</small></font><br><br />
(3) 100μl of 1M CaCl<font size="1"><small>2</small></font><br><br />
(4) 5ml of 40% glycerol<br><br />
<br />
</div><br />
3. Supplement (for the final medium) <br><br />
<div style="margin-left:25px"><br />
(1) 1mM thiamine hydrochloride<br><br />
(2) 0.2% casamino acids<br />
</div><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="paragraph3" class="bodyParagraphs"><br />
<div align="right"><br />
<h1>Xylose Inducible Promoter</h1><br />
</div><br />
<br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/ce/Xylose_promoter_1.JPG" width="50%" /></p><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/e/eb/Xylose_promoter_2.JPG" width="60%" /></p><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/7/7b/Xylose_promoter_3.JPG" width="60%" /></p><br />
<br />
<br />
<br />
<br />
<br />
<p><strong>Background Information <u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control" target="_blank" >(link to Regulation and Control Module)</a></u></strong><br /><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/cf/Promoter_characterization_2.JPG" width="50%" /></p><br />
<br />
The reason for using the xylose inducible promoter is to enable control on the expression of toxin and BMP2. Xylose is not toxic and normally not present in the human colon. This provides us an easy way to induce BMP2 expression without disrupting normal human body function.</p><br><br />
<p><strong>Objective</strong><br /><br />
On characterization, we want to test whether the promoter works in <i>E. coli</i> DH10B strain and if it works, what is the absolute promoter activity under varied experimental condition (i.e. xylose concentration).</p><br />
<br><br />
<p><strong>Intended Result</strong><br /><br />
<br />
1. Xylose inducible promoter is functional in <i>E. coli</i>.<br />
<br><br />
2. After the inducer concentration has reached a certain level, a relatively stationary GFP expression level (expression upper-limit) should be observed.<br />
<br />
</p><br />
<br />
<br><br />
<p><strong>Method</strong><br /><br />
The absolute promoter activity was measured with respect to xylose concentration. <br><br />
The same reporter gene (BBa_E0240) was used to indicate promoter activity. <i>E. coli</i> carrying the right construct was cultured to log phase. Following the addition of xylose at various predetermined concentrations, at a time point around the mid-log phase, the GFP intensity and OD595 were measured for every 30 mins (up to 120 mins). Independent curves indicating the GFP intensity units (of various xylose concentrations) with respect to time were then plotted, following which the respective absolute promoter activities were calculated.<br />
</p><br />
<br><br />
<p><strong>Characterization Procedure</strong></p><br />
<ol><br />
<li>Constructing <em>xylR-PxylA</em>-BBa_E0240-pSB1A2</li><br />
<li>Preparing supplemented M9 medium (see below);</u></li><br />
<li>Culturing <i>E. coli</i> carrying <em>xylR-PxylA</em>-BBa_E0240-pSB1A2 and <i>E. coli</i> without constructs in supplemented M9 medium and measuring the growth curve respectively;</li><br />
<li>Culturing the above mentioned bacteria in supplemented M9 medium to log phase;</li><br />
<li>Adding xylose at different concentrations to different sets of bacterial culture;</li><br />
<li>Measuring the GFP intensity and OD595 values across time for every set of bacterial culture containing different xylose concentrations;</li><br />
<li>Plotting independent curves showing the GFP intensity units of various xylose concentrations with respect to time;</li><br />
<li>Plotting a graph to demonstrate the absolute promoter activity under different inducer concentrations;</li><br />
<li>Compiling the results.</li><br />
<br />
</ol><br />
<br><br />
<p><strong>Data Processing</strong></p><br />
<ol><br />
<li>After <i>E. coli</i> carrying the right construct was grown to mid-log phase, GFP intensity and OD595 were measured every 30 minutes (up to 120 mins);</li><br />
<li>For GFP intensity, curve reflecting GFP expression change was plotted; for OD595, average value was taken;</u></li><br />
<li>GFP synthesis rate was then obtained by calculating the slope of linear regression line of the above mentioned curve;</li><br />
<li>Absolute promoter activity for the promoter under different inducer concentrations were calculated by dividing the corresponding GFP synthesis rate over the average OD595 value;</li><br />
<li>Averaged absolute promoter activity was then obtained by averaging the respective sets of absolute promoter activity values.</li><br />
<br />
<br />
</ol><br />
<br><br />
<p><strong>Result</strong></p><br />
<ol><br />
<li>Shown in the figure below, with the addition of xylose, GFP expression increased. This tells us that the xylose inducible promoter is functional in <i>E. coli</i> DH10B strain.</li><br />
<li>When no xylose was added, a limited amount of GFP was expressed. This suggests that the xylose inducible promoter is to some extent leaky.</li><br />
<li>A relatively stationary GFP expression level was observed at xylose concentrations of 1% to 5%. Despite some other variables (see discussion for more details), the data suggests that the minimum inducer concentration for triggering a full induction should lie somewhere between 0% and 1%</li><br />
<li>For 10% inducer concentration, the GFP expression was relatively lower. There could be several reasons for this occurence, such as xylose metabolism by the bacteria. (see discussion for more details)</li><br />
</ol><br />
<p align="center"><br />
<img src="https://static.igem.org/mediawiki/2012/4/4c/PXylGFP.jpg" width="75%" /><br />
</p><br />
<br><br />
<br />
<p><strong>Discussion</strong></p><br />
<ol><br />
<li>It is quite obvious that addition of xylose induces GFP expression in this construct. However, a slight issue remains: even when no xylose was added, a minute but detectable amount of GFP was still expressed. This shows that the xylose inducible promoter is leaky. It should be noteworthy that this version of the xylose inducible promoter has undergone mutagenesis on 3 different sites [XX*XX]<br />
Reason for this could be that three mutagenesis had been done to the repressive gene of this promoter. Although we had adopted the most frequently used codon in <i>B.subtilis </i>for the mutagenesis, this may not work as our expectation in<i> E.coli.</i></li><br />
<li>For the observation of full induction. Our biggest problem is that the E.coli strain we used contains the xylose metabolic operon, which means xylose might be metabolized by the bacteria. To eliminate error caused by this factor, we chose to use relatively higher concentration for experiment. This further caused another problem on determining the minimum xylose concentration for full GFP induction as when xylose concentration increased to 1%, the observed GFP expression level already entered a relatively stationary phase. Therefore, based on this result, we would say that due to bacterial metabolism of xylose, we are not sure whether the real GFP maximum level is higher than our current observation. However, since for a xylose concentration above 1%, a relative stationary level of GFP was observed, we would say that the minimum xylose concentration to trigger the full induction lies below 1%. We hope that in the future we can confirm the exact concentration.</li><br />
<li>For the decreased GFP expression at 10% xylose concentration, one possible reason is that the high osmotic pressure caused by the medium may inhibit the growth and metabolism of bacteria, thus reducing the GFP expression. Another possible reason could be that the over expression of induced GFP expression may disturb the normal bacteria function, leading to a low overall GFP expression.</li><br />
</ol><br><br />
<p><strong>Supplemented M9 Medium Composition</strong><br/><br />
1. 5X M9 Salt Composition (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 64g Na<font size="1"><small>2</small></font>HPO<font size="1"><small>4</small></font>﹒7H<font size="1"><small>2</small></font>O<br><br />
(2) 15g KH<font size="1"><small>2</small></font>PO<font size="1"><small>4</small></font><br><br />
(3) 2.5g NaCl<br><br />
(4) 5.0g NH<font size="1"><small>4</small></font>CL<br><br />
<br />
</div><br />
2. Minimal 1X M9 medium (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 200ml of 5X M9 Salt <br><br />
(2) 2ml of 1M MgSO<font size="1"><small>4</small></font><br><br />
(3) 100μl of 1M CaCl<font size="1"><small>2</small></font><br><br />
(4) 5ml of 40% glycerol<br><br />
<br />
</div><br />
3. Supplement (for the final medium) <br><br />
<div style="margin-left:25px"><br />
(1) 1mM thiamine hydrochloride<br><br />
(2) 0.2% casamino acids<br />
</div><br />
<br />
</p><br />
<br />
</div><br />
<div id="paragraph4" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>ydcD-E Growth Inhibition Device</h1><br />
</div><br />
<p><strong>Background Information <u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control" target="_blank" >(link to Regulation and Control Module)</a></u></strong><br /><br />
The rationale to include this growth inhibition device is that over-dose BMP-2 can cause unexpected proliferation of normal colon cells.(Zhang et al., 2012) Thus, a growth inhibition device is introduced and needs to be characterized.<br />
</p><br />
<p><strong>Objective</strong><br /><br />
The objective of this characterization is to find out what is the minimal concentration of xylose to inhibit the growth of our B. hercules.<br />
</p><br />
<p><strong>Method</strong><br /><br />
<i>I. Construct </i> <br><br />
<div style="margin-left: 30px"><br />
<p align="center"><img src="https://static.igem.org/mediawiki/2012/0/08/CGIDchar.JPG" width="50%" /></p><br />
<br><br />
xylR: The transcriptional regulator for the xylose inducible promoter. <br><br />
PxylA: The xylose inducible promoter. <br><br />
ydcE (ndoA): The toxin gene encoding EndoA. <br><br />
pTms: The low efficient constitutive promoter. <br><br />
ydcD (endB): The antitoxin gene encoding YdcD. <br><br />
</div><br />
<br><br />
<br />
<i>II. Culture Medium </i> <br><br />
Supplemented M9 minimal medium (M9 salt, 1 mM thiamine hydrochloride, 0.2% casamino acids, 0.1 M MgSO<font size="1"><small>4</small></font>, 0.5 M CaCl<font size="1"><small>2</small></font>, 0.4% glycerol) was used for our characterization. The reason for this medium and 0.4% glycerol as the carbon source is that glucose can repress the induction of xylose. (Kim, Mogk & Schumann,. 1996) 25 mg/mL chloramphenicol was diluted 100 times and added to the medium to select the bacteria with our intended vectors. The final concentration gradient of xylose in the supplemented M9 minimal medium is: 0.05%, 0.10%, 0.15%, 0.20% and 0.25%.<br><br />
<br><br />
<br />
<i>III. Control and Experiment Group </i> <br><br />
Control Group: <i>E. coli DH10β</i> without any vector was engaged in characterization as control. It was inoulated into the supplemented M9 minimal medium with xylose concentration: 0.00%, 0.05%, 0.10%, 0.15%, 0.20%, 0.25%. Note that in the control group, the medium was not added with chloramphenicol.<br><br />
Experiment Group: <i>E. coli DH10β</i> with our cell growth inhibition device were inoculated in the supplemented M9 minimal medium with xylose concentration: 0.00%, 0.05%, 0.10%, 0.15%, 0.20%, 0.25%. The total volume of the culture was 2mL for each test tube.<br><br><br />
<br />
<i>IV. Experiment </i> <br><br />
The bacteria cultures were incubated in 37 degree Celsius, shaked with 200 rpm for exactly 16 hours. After 16-hour incubation, the turbidity of the cultures were checked and photographed. Later, 50uL culture from one set of the experiments were taken and be spread on chloramphenicol 25 ug/mL LB plate for overnight incubation. <br><br><br />
<br />
</p><br />
<br />
<br />
<p><strong>Result</strong> </p><br />
<p><br />
<div style="margin-left":40px><br />
<img src="http://partsregistry.org/wiki/images/f/f9/CGIDC.png" width="50%" /><br><br />
Note that after spreading the culture on the plates, there were bacteria growing for all the tubes in the experiment groups. Admittedly, there were distinguishable difference between the concentration of 0.00%, 0.05% and 0.10% and the concentration of 0.15%, 0.20% and 0.25%: for the left three groups, the number of bacteria was much more than that in the right three ones. This result indicated that our<i> E. coli </i>did not die for the xylose induction, but its growth was inhibited.<br><br />
</div><br />
</p><br />
<br><br />
<p><strong>Reference</strong><br /><br />
Pellegrini O, Mathy N, Gogos A, Shapiro L, and Condon C. "The<i> Bacillus subtilis </i>ydcDE operon encodes an endoribonuclease of the MazF/PemK family and its inhibitor.." <i>Molecular microbiology.</i> 56.5 (2005): 1139-1148. Print.<br><br />
Kim, L., Mogk, A., & Schumann, W. (1996). A xylose-inducible <i>Bacillus subtilis</i> integration vector and its application.. <i>Gene, 181</i>(1-2), 71-76. <br><br />
Zhang J, Ge Y, Sun L, Cao J, Wu Q, Guo L, Wang Z. Effect of Bone Morphogenetic Protein-2 on Proliferation and Apoptosis of Gastric Cancer Cells.<i> Int J Med Sci </i>2012; 9(2):184-192.<br />
</p><br />
<br />
</div><br />
<div id="paragraph5" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Colon Tumor Binding System</h1><br />
</div><br />
<p><strong>Abstract<u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding" target="_blank" >(link to Target Binding Module)</a></u></strong><br><br />
A phage displaying peptide, RPMrel, was reported to have the ability to bind to poorly differentiate colon cancer cells while having significant lower binding ability to well-differentiate colon cancer cell and other normal tissue including lung, liver and stomach. (Kelly & Jones, 2003). Displaying RPMrel peptide on <em>B. subtilis</em> cell wall is expected to enable vegetative <em>B. subtilis</em> binding to colon cancer cell line specifically without adhering to other normal epithelial cell. In this characterization, <em>B. subtilis</em> was transfected with integration plasmid pDG1661- BBa_K733007 in order to displaying RPMrel on its cell wall. Empty vector pDG1661 is also transformed into <em>B. subtilis</em> as control. HT-29 (cancer adenocarcinoma) and HBE-16 (Human Bronchial epithelial cell) are engaged for adherence test to compare the binding affinity of experiment and control <em>B. subtilis</em> on cancer cell. The binding specificity of RPMrel displaying <em>Bacillus subtilis</em> was also investigated in this characterization.</p><br><br />
<strong>Materials and Method</strong><br><br />
<li><strong>Constructing part for <em>B. subtilis</em> characterization</strong><br><br />
In order to characterize biobrick BBa_K733007 and demonstrate that it functions as expected in <em>Bacillus subtilis</em>, the recombinant DNA constructed needs to be inserted into integration plasmid pDG1661. Therefore, K733007 was first inserted into pBluescript ii KS+ through EcoRI and PstI site. Construct in pBluescript ii KS+ was further digested with EcoRI and BamHI site in order to insert into integration vector pDG1661. pDG1661-K733007 was transformed into <i>E. coli</i> DH10B and selected on Ampicillin plate (150 μg/ml). After replicated in <i>E coli</i>, pDG1661-K733007 was extracted and transformed into <em>B. subtilis</em>. LB plate containing 5μg/ml Chloramphenicol is used to select transformed <em>B. subtilis</em>. All <i>E. coli</i> and <em>B. subtilis</em> transformation were performed strictly follow the protocol uploaded in protocol section. </li><br><br />
<li><strong>Mammalian cell culture</strong><br>Colon adenocarcinoma (HT-29) was cultured in McCoy’s 5A medium supplement with 10% FBS in 5% CO2, 37℃ incubator. Normal human bronchial epithelial cell (HBE-16) was cultured in MEM medium supplemented with 10% FBS in 5%CO2, 37℃ incubator. 12-well plate was engaged to culture both cell into confluent. </li><br><br />
<li><strong>Bacillus subtilic culture</strong><br><br />
<em>Bacillus subtilis</em> transformed with pDG1661-K733007 and the one transformed with pDG1661 empty vector were cultured separately in LB medium. Overnight cultures were diluted to OD650=0.1 and sub-culture for another 3 hours until OD650 reached 1. Bacteria were washed in 0.1M PBS 3 times and then re-suspended in McCoy' 5A (without FBS) and MEM medium (without FBS) respectively.</li> <br><br />
<li><strong>Co-culture Bacillus subtilis with mammalian cell: </strong><br><br />
Confluent mammalian cells were washed with 0.1M PBS once before adding bacteria. 1ml <em>B. subtilis</em> suspensions were added into each well of mammalian cell culture plate. After co-culturing the mammalian cell with bacteria, 5 times washing with 0.1M PBS was performed then to wash away the free bacteria without attachment and move into further characterization.</li><br><br />
<li><strong>Gram staining for detecting the binding between Bacillus subtilis and colon cancer cell:</strong><br><br />
Cells were fixed with 1% paraformaldehyde for 15 minutes in room temperature. After fixation, 0.0007 % crystal violet was used to stain cells overnight. Stains were washed away the next day with water and observed under inverted microscope with 400X magnificence.</li><br><br />
<li><strong>Adherence assay through CFU calculation</strong><br><br />
0.1% Triton X-100 in 0.1M PBS was added into well after PBS washing and incubated for 10 minutes. Cells were then pellet and re-suspended in LB medium, plating on LB plate to determine CFU. (Sheng et al, 2011)</li><br><br />
<strong>Result</strong><br><br />
<p><li><strong>Gram staining </strong><br><br />
Co-cultured <i>Bacillus subtilis</i> with RPMrel peptide on HT-29 and controlled <i>Bacillus subtilis</i> on HT-29 were stained and observed under inverted microscope with 400X magnificence. As shown in figure 1, <i>Bacillus subtilis</i> and nucleus of HT-29 cell were stained in purple and both types of <i>B. subtilis</i> can be detected on HT -29 cell.</li><br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/e/ea/HKUST_Characterization_of_RPMrel_construct_and_BMP2_construct.jpg" width="40%" style="float:left"/><img src="https://static.igem.org/mediawiki/2012/6/68/HKUST_Characterization_of_RPMrel_construct_and_BMP2_construct-2.jpg" width="40%" style="float:left"/></p><br />
<br />
<br />
<p style="clear:both"><br />
Figure 1: Gram stain of B. subtilis on confluent HT-29 cell.<br><br />
A: Gram stain of HT-29 co-cultured with B. subtilsi with RPMrel peptide.<br><br />
B: Gram stain of HT-29 co-cultured with control bacteria, B. subtilis without RPMrel peptide.<br></p><br />
<p><li><strong>CFU calculation </strong><br><br />
Serial dilutions were performed before plating and plates with colony between 25~300 were counted to calculate the CFU/ml. As shown in table 1 and figure 1, more <i>Bacillus subtilis</i> with empty vector pDG1661 was detected on HT-29 cell line than the one of <i>B. subtilis</i> with RPMrel peptide on HT-29. Comparing the number of <i>Bacillus subtilis</i> with RPMrel retained on HT-29 and HBE16, more <i>Bacillus subtilis</i> can be detected on HBE16 cell. Two round of T-tests were further performed and it showed that no significant differences in the binding affinity between <i>Bacillus subtilis</i> with or without RPMrel to HT-29 cell (P>0.05) but the number of <i>Bacillus subtilis</i> with RPMrel peptide binding to HBE16 cells is significantly higher than the same bacteria bind to HT-29.</li><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/a/aa/HKUST_table_for_colon_cancer_binding_steven.jpg" width="50%"/></p><br />
<br />
Table 1: Number of Bacillus subtilis retained on different mammalian cell line.<br><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/3/30/HKUST_Number_of_Bacillus_subtilis_retained_on_mammalian_cell.jpg" width="50%"/></p><br />
Figure 2: Number of Bacillus subtilis retained on different mammalian cell line</p><br><br />
<br />
<br />
<p><strong>Discussion</strong></p><br />
<p><li><strong>Experiment result to some extent reject our hypothesis but no solid conclusion can be made at this stage:</strong><br></p><br />
<p>Based on the result from table 1 and figure 2 and two t-test performed, it can be stated that <i>B. subtilis</i> with RPMrel displaying have no significant increase in binding ability to cancer cell line and the peptide displaying results in significant improvement in binding to normal epithelial tissue. <br></p><br />
<p>However, the statement above is just based on the evidence we have now. Because of time limitation, we haven’t demonstrated that LytC system can facilitate the displaying successfully be displaying on cell wall. Therefore, we can hardly tell the unexpected result is caused by the unexpected structure changes of RPMrel when displaying on cell wall or because of the failure of LytC system in transporting and localizing RPMrel on cell wall.<br></p><br />
<p>In addition, the gram staining method used in our characterization is not consistence during our one-month characterization work. Over staining happened from time to time and the cell layers were easily detached from the bottom of well after adding crystal violet.<br></p><br />
<p>Besides, more proper control group is needed for our experiment. Because of the limitation of source and time we have, no normal epithelial cell line from digestive system can be found and used in our work. Engaging HBE16 cells in experiment is a compromised but best choice we have so far. If possible, we will try to engage othrt cell lines in our experiment in order to draw solid conclusion in the future. <br></p><br />
<p><li><strong>Future work</strong></li></p><ol><br />
<li>Using BBa_K733008 (LytC system with flag tag on its C terminus) to verify the proper functioning of the cell wall binding system.</li><br />
<li>Developing some more reliable staining method to demonstrate the adherence between <i>B. subtilis</i> and mammalian cell.</i><br />
<li>Proper control bacteria and proper control cell line need to be added in our characterization in order to obtain reliable and solid conclusions. </i><br />
</ol><br />
<br><br />
<p><strong>Reference</strong></p><br />
<p>Haiqing Sheng, Wang Jing, Lim Ji Youn, Davitt Christine, Minnich Scott A. & Hovde Carolyn J. 2012. Internalization of <i>Escherichia coli</i> O157:H7 by bovine rectal epithelial cells. <i>Frontiers of Microbiology.</i> (2012.2.32)</p><br />
<p>Kimberly A. Kelly & Jones David A.2003. Isolation of a Colon Tumor Specific Binding Peptide Using Phage Display Selection. <i>Neoplasia.</i> 5: 437 – 444</p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br />
</div><br />
<div id="paragraph6" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Characterization of BMP2</h1><br />
</div><br />
<p><strong>Characterization of Biobrick BBa_K733017:</strong><br /><br />
<strong>Abstract:</strong><br /><br />
This characterization is intended to demonstrate that <em>B. subtilis </em>transformed with BMP2 expression and secretion construct can trigger the apoptosis of colon cancer. In this characterization, <em>B. subtilis</em> was co-cultured with HT-29 cell. MTT assay which is widely used to cell proliferation and viability assay was engaged in our experiment to investigate the growth suppression effect on colon cancer cell.</p><br />
<p><strong>Material and Method:</strong></p><br />
<ul><br />
<li><strong>Constructing part for <em>B. subtilis</em> characterization : </strong></li><br />
</ul><br />
<p align="left">In order to characterize this construct in B. subtilis, the K733017 was inserted into integration vector pDG1661. Detailed methods can be referred to the characterization of BBa_K733007. </p><br />
<ul><br />
<li><strong>Mammalian cell culture:</strong></li><br />
</ul><br />
<p>Colon adenocarcinoma (HT-29) was cultured in McCoy&rsquo;s 5A medium supplement with 10% FBS in 5% CO2, 37℃ incubator. They were seeded in 96 well plate for further characterization.</p><br />
<ul><br />
<li><strong><em>Bacillus subtilic</em></strong><strong> culture: </strong></li><br />
</ul><br />
<p><em>Bacillus subtilis</em> transformed with pDG1661-K733017 and the one transformed with pDG1661 empty vector were cultured separately in LB medium. Overnight cultures were diluted to OD650=0.1 and subculture to OD650 reaching 1.0.<em> B. subtilis</em> were washed three times with 0.1M PBS and diluted to OD=0.1, 0.01, 0.001 and 0.0001 in McCoy&rsquo;s 5A medium with 10%FBS supplemented. </p><br />
<ul><br />
<li><strong>Co-culture <em>Bacillus subtilis</em> with mammalian cell: </strong></li><br />
</ul><br />
<p>3000 HT-29 cells in 100μl were seeded in 96 well plate. After overnight incubation, 100μl <em>B.subtilis</em> suspension is added into each well and co-cultured with HT-29 cell for 48 hours. </p><br />
<ul><br />
<li><strong>MTT assay: </strong></li><br />
</ul><br />
<p>Cells were washed 5 times with 0.1M PBS. 0.5% MTT solution was added and incubated in 37℃ for 4 hours. After incubation, 100ul DMSO was added into each well, shacking for 5 minutes in order to obtain homogenized solution. A570 were measured then to reflect the viability of cells. Percentage of viability was calculated through equation <img width="342" height="26" src="file:///F|/iGEM/wiki/clip_image002.png" /> <br /><br />
<strong>Result: </strong><br /><br />
A decline trend of cell proliferation can be clearly observed when more bacteria were co-cultured with HT-29 cell as shown in figure 1. Comparing the proliferation rate HT-29 cells which were co-cultured with BMP2 producing<em> B. subtilis</em> and non-BMP2 produced <em>B. subtilis</em>, a significant decline can be detected when initial OD650 of <em>B. subtilis </em>equal to 0.1 and 0.01. (P&lt;0.05 ). No significant difference can be detected when OD650 decreased to 0.001. When it OD650 comes to 0.0001, significant increase in cell proliferation rate can be detected in experiment group. </p><img width=80% src="https://static.igem.org/mediawiki/2012/7/7f/Mmm.jpg"><br />
<p style="clear:both"><strong>Discussion: </strong><br /><br />
In this characterization, <em>Bacillus subtilis</em> transformed with plasmid pDG161-K733017 execute significant growth inhibition effect when OD650 is above 0.01. However, no supporting experiment like western blot has been successfully carried out to confirm the expression of BMP2 in <em>B. subtilis</em>. Therefore, more experiment need to be done in order to fully characterize this biobrick.</p><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Section_Heading{<br />
width:auto;<br />
height:50px;<br />
padding:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#33FF33;<br />
opacity:0.8;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
clear:both;<br />
}<br />
.Section_Heading h3 p{<br />
color:#000;<br />
}<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:autopx;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph4{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph5{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:autopx;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph6{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<br />
<div id="Sitemap"><br />
<div class="Sitemap_Content"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Device</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:145px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Characterization
Team:HKUST-Hong Kong/Characterization
2012-09-26T20:26:04Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align="center"><font size="20">Characterization</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Introduction</h1><br />
</div><br />
<p>In our project, we have characterized two promoters and the cell death device using different methods. The results indicate that our parts are functional and we can quantitatively control their activities by changing the experimental conditions.</p><br />
</div><br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>Low Efficiency Constitutive Promoter <em>Ptms</em></h1><br />
</div><br />
<p><strong>Background Information <u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control" target="_blank" >(link to Regulation and Control Module)</a></u></strong><br /><br />
<br />
<br />
<br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/c3/Promoter_characterization_1.JPG" width="50%" /></p><br />
<br />
<br />
<br />
<br />
The key reason for using this low efficiency constitutive promoter in our construct is to enable our bacteria to express a low level of antitoxin so that the bacterial cell can only tolerate a certain amount of toxin. As the expression of BMP2 is tightly linked to the toxin, its expression can be regulated accordingly.</p><br><br />
<p><strong>Objective</strong><br /><br />
Our objective in characterizing this promoter is to test whether <em>Ptms</em> works in <i>E. coli</i> DH10B strain and determine its relative promoter unit (RPU) compared to the standard constitutive promoter (a promoter whose activity is arbitrarily valued at 1.0 by partsregistry.org).</p><br />
<br><br />
<p><strong>Intended Result</strong><br /><br />
1. <em>Ptms</em> should work in <i>E. coli</i>. This is supported by previous research (Moran et al., 1982). <br><br />
2. The activity of <em>Ptms</em> should be relatively low.<br />
</p><br />
<br />
<br><br />
<p><strong>Method</strong><br /><br />
Instead of using the absolute promoter activity as the final result, our characterization was based on obtaining the in vivo activity of this constitutive promoter. Adopting this method enables us to eliminate errors caused by different experimental conditions and give a more convincing result.<br /><br />
By linking the promoter with GFP (BBa_E0240), the promoter activity was represented by the GFP synthesis rate which can be easily measured.<i> E. coli </i>carrying the right construct was then cultured to log phase. At a time point around the mid-log phase, the GFP intensity and OD595 values were measured to obtain the Relative Promoter Units (RPU).</p><br><br />
<p><strong>Characterization Procedure</strong></p><br />
<ol><br />
<li>Constructing BBa_K733009-pSB3K3 (<em>Ptms</em>-BBa_E0240-pSB3K3); Transforming BBa_I20260-pSB3K3 (Standard Constitutive Promoter/Reference Promoter) from the 2012 Distribution Kit;</li><br />
<li>Preparing supplemented M9 medium (see below); </li><br />
<li>Culturing <i>E. coli</i> DH10B strain carrying BBa_K733009-pSB3K3 and <i>E. coli</i> carrying BBa_I20260-pSB3K3 in supplemented M9 medium and measuring the respective growth curves;</li><br />
<li>Measuring the GFP intensity and OD595 values every 15 minutes after the above mentioned<i> E. coli</i> strains are cultured to mid-log phase;</li><br />
<li>Calculating the Relative Promoter Units (RPU) using the obtained data;</li><br />
<li>Compiling the results.</li><br />
</ol><br />
<br />
<br><br />
<p><strong>Data Processing</strong></p><br />
<ol><br />
<li>After <i>E. coli</i> carrying the right construct was grown to mid-log phase, GFP intensity and OD595 were measured every 15 minutes (up to 60 mins);</li><br />
<li>For GFP intensity, curve reflecting GFP expression change was plotted; for OD595, average values were taken;</li><br />
<li>GFP synthesis rate was then obtained by calculating the slope of linear regression line of the above mentioned curve;</li><br />
<li>Absolute promoter activity of <em>Ptms</em> and BBa_I20260 were calculated by dividing the corresponding GFP synthesis rate over the average OD595 value;</li><br />
<li>Averaged absolute promoter activity was then obtained by averaging the respective sets of absolute promoter activity values;</li><br />
<li>Finally, R.P.U was calculated by dividing the averaged <em>Ptms</em> absolute promoter activity over the averaged BBa_I20260 absolute promoter activity.</li><br />
</ol><br />
<br />
<br><br />
<p><strong>Result</strong><br /><br />
<div style="margin-left: 25px"><br />
1. Suggested by the GFP expression curve we plotted, <em>Ptms</em> functions in <i>E.coli </i>DH10B strain.<br />
<br><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/d/d9/PTms_GFP.jpg" width="75%" /></p><br />
<br><br />
<i> * Above: GFP expression curve for one set of data</i><br><br />
<br><br />
2. The RPU of <em>Ptms</em> obtained was 0.046497. This shows that <em>Ptms</em> has a very low promoter efficiency in <i>E.coli</i> DH10B strain.<br />
<br><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/a/ae/PTms_Promoter.jpg" width="75%" /></p><br />
<br><br />
</div><br />
</p><br />
<br><br />
<p><strong>Discussion</strong><br /><br />
Compared to BBa_I20260, it seems that <i>E. coli</i> carrying <em>Ptms</em>-GFP has a rather low GFP expression. This may cause some difficulties in deciding whether <em>Ptms</em> functions in <i>E. coli</i> or not. However, referring to the curve (for GFP Intensity), the GFP expression for <em>Ptms</em> increased gradually with respect to time. This suggests that <em>Ptms</em> functions in <i>E. coli</i> DH10B strain, although with a low efficiency. A possible reason for its low efficiency could be that <em>Ptms</em> was originally from <i>B. subtilis</i> but was functioning in a heterologous system when placed in <i>E. coli</i>. Due to time constraints, we were unable to characterize the promoter in <i>B. subtilis</i>, and we still hope that we can address this in the future.<br />
</p><br />
<br><br />
<p><strong>Reference</strong><br /><br />
Moran, C., Lang, N., LeGrice, S., Lee, G., Stephens, M., Sonenshein, A., et al. (1982). Nucleotide sequences that signal the initiation of transcription and translation in <i>Bacillus subtilis</i>..<i>Molecular and General Genetics MGG,186,</i> 339-346.<br />
</p><br />
<br><br />
<p><strong>Supplemented M9 Medium Composition</strong><br/><br />
1. 5X M9 Salt Composition (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 64g Na<font size="1"><small>2</small></font>HPO<font size="1"><small>4</small></font>﹒7H<font size="1"><small>2</small></font>O<br><br />
(2) 15g KH<font size="1"><small>2</small></font>PO<font size="1"><small>4</small></font><br><br />
(3) 2.5g NaCl<br><br />
(4) 5.0g NH<font size="1"><small>4</small></font>CL<br><br />
<br />
</div><br />
2. Minimal 1X M9 medium (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 200ml of 5X M9 Salt <br><br />
(2) 2ml of 1M MgSO<font size="1"><small>4</small></font><br><br />
(3) 100μl of 1M CaCl<font size="1"><small>2</small></font><br><br />
(4) 5ml of 40% glycerol<br><br />
<br />
</div><br />
3. Supplement (for the final medium) <br><br />
<div style="margin-left:25px"><br />
(1) 1mM thiamine hydrochloride<br><br />
(2) 0.2% casamino acids<br />
</div><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="paragraph3" class="bodyParagraphs"><br />
<div align="right"><br />
<h1>Xylose Inducible Promoter</h1><br />
</div><br />
<br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/ce/Xylose_promoter_1.JPG" width="50%" /></p><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/e/eb/Xylose_promoter_2.JPG" width="60%" /></p><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/7/7b/Xylose_promoter_3.JPG" width="60%" /></p><br />
<br />
<br />
<br />
<br />
<br />
<p><strong>Background Information <u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control" target="_blank" >(link to Regulation and Control Module)</a></u></strong><br /><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/cf/Promoter_characterization_2.JPG" width="50%" /></p><br />
<br />
The reason for using the xylose inducible promoter is to enable control on the expression of toxin and BMP2. Xylose is not toxic and normally not present in the human colon. This provides us an easy way to induce BMP2 expression without disrupting normal human body function.</p><br><br />
<p><strong>Objective</strong><br /><br />
On characterization, we want to test whether the promoter works in <i>E. coli</i> DH10B strain and if it works, what is the absolute promoter activity under varied experimental condition (i.e. xylose concentration).</p><br />
<br><br />
<p><strong>Intended Result</strong><br /><br />
<br />
1. Xylose inducible promoter is functional in <i>E. coli</i>.<br />
<br><br />
2. After the inducer concentration has reached a certain level, a relatively stationary GFP expression level (expression upper-limit) should be observed.<br />
<br />
</p><br />
<br />
<br><br />
<p><strong>Method</strong><br /><br />
The absolute promoter activity was measured with respect to xylose concentration. <br><br />
The same reporter gene (BBa_E0240) was used to indicate promoter activity. <i>E. coli</i> carrying the right construct was cultured to log phase. Following the addition of xylose at various predetermined concentrations, at a time point around the mid-log phase, the GFP intensity and OD595 were measured for every 30 mins (up to 120 mins). Independent curves indicating the GFP intensity units (of various xylose concentrations) with respect to time were then plotted, following which the respective absolute promoter activities were calculated.<br />
</p><br />
<br><br />
<p><strong>Characterization Procedure</strong></p><br />
<ol><br />
<li>Constructing <em>xylR-PxylA</em>-BBa_E0240-pSB1A2</li><br />
<li>Preparing supplemented M9 medium (see below);</u></li><br />
<li>Culturing <i>E. coli</i> carrying <em>xylR-PxylA</em>-BBa_E0240-pSB1A2 and <i>E. coli</i> without constructs in supplemented M9 medium and measuring the growth curve respectively;</li><br />
<li>Culturing the above mentioned bacteria in supplemented M9 medium to log phase;</li><br />
<li>Adding xylose at different concentrations to different sets of bacterial culture;</li><br />
<li>Measuring the GFP intensity and OD595 values across time for every set of bacterial culture containing different xylose concentrations;</li><br />
<li>Plotting independent curves showing the GFP intensity units of various xylose concentrations with respect to time;</li><br />
<li>Plotting a graph to demonstrate the absolute promoter activity under different inducer concentrations;</li><br />
<li>Compiling the results.</li><br />
<br />
</ol><br />
<br><br />
<p><strong>Data Processing</strong></p><br />
<ol><br />
<li>After <i>E. coli</i> carrying the right construct was grown to mid-log phase, GFP intensity and OD595 were measured every 30 minutes (up to 120 mins);</li><br />
<li>For GFP intensity, curve reflecting GFP expression change was plotted; for OD595, average value was taken;</u></li><br />
<li>GFP synthesis rate was then obtained by calculating the slope of linear regression line of the above mentioned curve;</li><br />
<li>Absolute promoter activity for the promoter under different inducer concentrations were calculated by dividing the corresponding GFP synthesis rate over the average OD595 value;</li><br />
<li>Averaged absolute promoter activity was then obtained by averaging the respective sets of absolute promoter activity values.</li><br />
<br />
<br />
</ol><br />
<br><br />
<p><strong>Result</strong></p><br />
<ol><br />
<li>Shown in the figure below, with the addition of xylose, GFP expression increased. This tells us that the xylose inducible promoter is functional in <i>E. coli</i> DH10B strain.</li><br />
<li>When no xylose was added, a limited amount of GFP was expressed. This suggests that the xylose inducible promoter is to some extent leaky.</li><br />
<li>A relatively stationary GFP expression level was observed at xylose concentrations of 1% to 5%. Despite some other variables (see discussion for more details), the data suggests that the minimum inducer concentration for triggering a full induction should lie somewhere between 0% and 1%</li><br />
<li>For 10% inducer concentration, the GFP expression was relatively lower. There could be several reasons for this occurence, such as xylose metabolism by the bacteria. (see discussion for more details)</li><br />
</ol><br />
<p align="center"><br />
<img src="https://static.igem.org/mediawiki/2012/4/4c/PXylGFP.jpg" width="75%" /><br />
</p><br />
<br><br />
<br />
<p><strong>Discussion</strong></p><br />
<ol><br />
<li>It is quite obvious that addition of xylose induces GFP expression in this construct. However, a slight issue remains: even when no xylose was added, a minute but detectable amount of GFP was still expressed. This shows that the xylose inducible promoter is leaky. It should be noteworthy that this version of the xylose inducible promoter has undergone mutagenesis on 3 different sites [XX*XX]<br />
Reason for this could be that three mutagenesis had been done to the repressive gene of this promoter. Although we had adopted the most frequently used codon in <i>B.subtilis </i>for the mutagenesis, this may not work as our expectation in<i> E.coli.</i></li><br />
<li>For the observation of full induction. Our biggest problem is that the E.coli strain we used contains the xylose metabolic operon, which means xylose might be metabolized by the bacteria. To eliminate error caused by this factor, we chose to use relatively higher concentration for experiment. This further caused another problem on determining the minimum xylose concentration for full GFP induction as when xylose concentration increased to 1%, the observed GFP expression level already entered a relatively stationary phase. Therefore, based on this result, we would say that due to bacterial metabolism of xylose, we are not sure whether the real GFP maximum level is higher than our current observation. However, since for a xylose concentration above 1%, a relative stationary level of GFP was observed, we would say that the minimum xylose concentration to trigger the full induction lies below 1%. We hope that in the future we can confirm the exact concentration.</li><br />
<li>For the decreased GFP expression at 10% xylose concentration, one possible reason is that the high osmotic pressure caused by the medium may inhibit the growth and metabolism of bacteria, thus reducing the GFP expression. Another possible reason could be that the over expression of induced GFP expression may disturb the normal bacteria function, leading to a low overall GFP expression.</li><br />
</ol><br><br />
<p><strong>Supplemented M9 Medium Composition</strong><br/><br />
1. 5X M9 Salt Composition (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 64g Na<font size="1"><small>2</small></font>HPO<font size="1"><small>4</small></font>﹒7H<font size="1"><small>2</small></font>O<br><br />
(2) 15g KH<font size="1"><small>2</small></font>PO<font size="1"><small>4</small></font><br><br />
(3) 2.5g NaCl<br><br />
(4) 5.0g NH<font size="1"><small>4</small></font>CL<br><br />
<br />
</div><br />
2. Minimal 1X M9 medium (1L) <br><br />
<div style="margin-left:25px"><br />
(1) 200ml of 5X M9 Salt <br><br />
(2) 2ml of 1M MgSO<font size="1"><small>4</small></font><br><br />
(3) 100μl of 1M CaCl<font size="1"><small>2</small></font><br><br />
(4) 5ml of 40% glycerol<br><br />
<br />
</div><br />
3. Supplement (for the final medium) <br><br />
<div style="margin-left:25px"><br />
(1) 1mM thiamine hydrochloride<br><br />
(2) 0.2% casamino acids<br />
</div><br />
<br />
</p><br />
<br />
</div><br />
<div id="paragraph4" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>ydcD-E Growth Inhibition Device</h1><br />
</div><br />
<p><strong>Background Information <u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control" target="_blank" >(link to Regulation and Control Module)</a></u></strong><br /><br />
The rationale to include this growth inhibition device is that over-dose BMP-2 can cause unexpected proliferation of normal colon cells.(Zhang et al., 2012) Thus, a growth inhibition device is introduced and needs to be characterized.<br />
</p><br />
<p><strong>Objective</strong><br /><br />
The objective of this characterization is to find out what is the minimal concentration of xylose to inhibit the growth of our B. hercules.<br />
</p><br />
<p><strong>Method</strong><br /><br />
<i>I. Construct </i> <br><br />
<div style="margin-left: 30px"><br />
<p align="center"><img src="https://static.igem.org/mediawiki/2012/0/08/CGIDchar.JPG" width="50%" /></p><br />
<br><br />
xylR: The transcriptional regulator for the xylose inducible promoter. <br><br />
PxylA: The xylose inducible promoter. <br><br />
ydcE (ndoA): The toxin gene encoding EndoA. <br><br />
pTms: The low efficient constitutive promoter. <br><br />
ydcD (endB): The antitoxin gene encoding YdcD. <br><br />
</div><br />
<br><br />
<br />
<i>II. Culture Medium </i> <br><br />
Supplemented M9 minimal medium (M9 salt, 1 mM thiamine hydrochloride, 0.2% casamino acids, 0.1 M MgSO<font size="1"><small>4</small></font>, 0.5 M CaCl<font size="1"><small>2</small></font>, 0.4% glycerol) was used for our characterization. The reason for this medium and 0.4% glycerol as the carbon source is that glucose can repress the induction of xylose. (Kim, Mogk & Schumann,. 1996) 25 mg/mL chloramphenicol was diluted 100 times and added to the medium to select the bacteria with our intended vectors. The final concentration gradient of xylose in the supplemented M9 minimal medium is: 0.05%, 0.10%, 0.15%, 0.20% and 0.25%.<br><br />
<br><br />
<br />
<i>III. Control and Experiment Group </i> <br><br />
Control Group: <i>E. coli DH10β</i> without any vector was engaged in characterization as control. It was inoulated into the supplemented M9 minimal medium with xylose concentration: 0.00%, 0.05%, 0.10%, 0.15%, 0.20%, 0.25%. Note that in the control group, the medium was not added with chloramphenicol.<br><br />
Experiment Group: <i>E. coli DH10β</i> with our cell growth inhibition device were inoculated in the supplemented M9 minimal medium with xylose concentration: 0.00%, 0.05%, 0.10%, 0.15%, 0.20%, 0.25%. The total volume of the culture was 2mL for each test tube.<br><br><br />
<br />
<i>IV. Experiment </i> <br><br />
The bacteria cultures were incubated in 37 degree Celsius, shaked with 200 rpm for exactly 16 hours. After 16-hour incubation, the turbidity of the cultures were checked and photographed. Later, 50uL culture from one set of the experiments were taken and be spread on chloramphenicol 25 ug/mL LB plate for overnight incubation. <br><br><br />
<br />
</p><br />
<br />
<br />
<p><strong>Result</strong> </p><br />
<p><br />
<div style="margin-left":40px><br />
<img src="http://partsregistry.org/wiki/images/f/f9/CGIDC.png" width="50%" /><br><br />
Note that after spreading the culture on the plates, there were bacteria growing for all the tubes in the experiment groups. Admittedly, there were distinguishable difference between the concentration of 0.00%, 0.05% and 0.10% and the concentration of 0.15%, 0.20% and 0.25%: for the left three groups, the number of bacteria was much more than that in the right three ones. This result indicated that our<i> E. coli </i>did not die for the xylose induction, but its growth was inhibited.<br><br />
</div><br />
</p><br />
<br><br />
<p><strong>Reference</strong><br /><br />
Pellegrini O, Mathy N, Gogos A, Shapiro L, and Condon C. "The<i> Bacillus subtilis </i>ydcDE operon encodes an endoribonuclease of the MazF/PemK family and its inhibitor.." <i>Molecular microbiology.</i> 56.5 (2005): 1139-1148. Print.<br><br />
Kim, L., Mogk, A., & Schumann, W. (1996). A xylose-inducible <i>Bacillus subtilis</i> integration vector and its application.. <i>Gene, 181</i>(1-2), 71-76. <br><br />
Zhang J, Ge Y, Sun L, Cao J, Wu Q, Guo L, Wang Z. Effect of Bone Morphogenetic Protein-2 on Proliferation and Apoptosis of Gastric Cancer Cells.<i> Int J Med Sci </i>2012; 9(2):184-192.<br />
</p><br />
<br />
</div><br />
<div id="paragraph5" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Colon Tumor Binding System</h1><br />
</div><br />
<p><strong>Abstract<u><a href ="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding" target="_blank" >(link to Target Binding Module)</a></u></strong><br><br />
A phage displaying peptide, RPMrel, was reported to have the ability to bind to poorly differentiate colon cancer cells while having significant lower binding ability to well-differentiate colon cancer cell and other normal tissue including lung, liver and stomach. (Kelly & Jones, 2003). Displaying RPMrel peptide on <em>B. subtilis</em> cell wall is expected to enable vegetative <em>B. subtilis</em> binding to colon cancer cell line specifically without adhering to other normal epithelial cell. In this characterization, <em>B. subtilis</em> was transfected with integration plasmid pDG1661- BBa_K733007 in order to displaying RPMrel on its cell wall. Empty vector pDG1661 is also transformed into <em>B. subtilis</em> as control. HT-29 (cancer adenocarcinoma) and HBE-16 (Human Bronchial epithelial cell) are engaged for adherence test to compare the binding affinity of experiment and control <em>B. subtilis</em> on cancer cell. The binding specificity of RPMrel displaying <em>Bacillus subtilis</em> was also investigated in this characterization.</p><br><br />
<strong>Materials and Method</strong><br><br />
<li><strong>Constructing part for <em>B. subtilis</em> characterization</strong><br><br />
In order to characterize biobrick BBa_K733007 and demonstrate that it functions as expected in <em>Bacillus subtilis</em>, the recombinant DNA constructed needs to be inserted into integration plasmid pDG1661. Therefore, K733007 was first inserted into pBluescript ii KS+ through EcoRI and PstI site. Construct in pBluescript ii KS+ was further digested with EcoRI and BamHI site in order to insert into integration vector pDG1661. pDG1661-K733007 was transformed into <i>E. coli</i> DH10B and selected on Ampicillin plate (150 μg/ml). After replicated in <i>E coli</i>, pDG1661-K733007 was extracted and transformed into <em>B. subtilis</em>. LB plate containing 5μg/ml Chloramphenicol is used to select transformed <em>B. subtilis</em>. All <i>E. coli</i> and <em>B. subtilis</em> transformation were performed strictly follow the protocol uploaded in protocol section. </li><br><br />
<li><strong>Mammalian cell culture</strong><br>Colon adenocarcinoma (HT-29) was cultured in McCoy’s 5A medium supplement with 10% FBS in 5% CO2, 37℃ incubator. Normal human bronchial epithelial cell (HBE-16) was cultured in MEM medium supplemented with 10% FBS in 5%CO2, 37℃ incubator. 12-well plate was engaged to culture both cell into confluent. </li><br><br />
<li><strong>Bacillus subtilic culture</strong><br><br />
<em>Bacillus subtilis</em> transformed with pDG1661-K733007 and the one transformed with pDG1661 empty vector were cultured separately in LB medium. Overnight cultures were diluted to OD650=0.1 and sub-culture for another 3 hours until OD650 reached 1. Bacteria were washed in 0.1M PBS 3 times and then re-suspended in McCoy' 5A (without FBS) and MEM medium (without FBS) respectively.</li> <br><br />
<li><strong>Co-culture Bacillus subtilis with mammalian cell: </strong><br><br />
Confluent mammalian cells were washed with 0.1M PBS once before adding bacteria. 1ml <em>B. subtilis</em> suspensions were added into each well of mammalian cell culture plate. After co-culturing the mammalian cell with bacteria, 5 times washing with 0.1M PBS was performed then to wash away the free bacteria without attachment and move into further characterization.</li><br><br />
<li><strong>Gram staining for detecting the binding between Bacillus subtilis and colon cancer cell:</strong><br><br />
Cells were fixed with 1% paraformaldehyde for 15 minutes in room temperature. After fixation, 0.0007 % crystal violet was used to stain cells overnight. Stains were washed away the next day with water and observed under inverted microscope with 400X magnificence.</li><br><br />
<li><strong>Adherence assay through CFU calculation</strong><br><br />
0.1% Triton X-100 in 0.1M PBS was added into well after PBS washing and incubated for 10 minutes. Cells were then pellet and re-suspended in LB medium, plating on LB plate to determine CFU. (Sheng et al, 2011)</li><br><br />
<strong>Result</strong><br><br />
<p><li><strong>Gram staining </strong><br><br />
Co-cultured <i>Bacillus subtilis</i> with RPMrel peptide on HT-29 and controlled <i>Bacillus subtilis</i> on HT-29 were stained and observed under inverted microscope with 400X magnificence. As shown in figure 1, <i>Bacillus subtilis</i> and nucleus of HT-29 cell were stained in purple and both types of <i>B. subtilis</i> can be detected on HT -29 cell.</li><br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/e/ea/HKUST_Characterization_of_RPMrel_construct_and_BMP2_construct.jpg" width="40%" style="float:left"/><img src="https://static.igem.org/mediawiki/2012/6/68/HKUST_Characterization_of_RPMrel_construct_and_BMP2_construct-2.jpg" width="40%" style="float:left"/></p><br />
<br />
<br />
<p style="clear:both"><br />
Figure 1: Gram stain of B. subtilis on confluent HT-29 cell.<br><br />
A: Gram stain of HT-29 co-cultured with B. subtilsi with RPMrel peptide.<br><br />
B: Gram stain of HT-29 co-cultured with control bacteria, B. subtilis without RPMrel peptide.<br></p><br />
<p><li><strong>CFU calculation </strong><br><br />
Serial dilutions were performed before plating and plates with colony between 25~300 were counted to calculate the CFU/ml. As shown in table 1 and figure 1, more <i>Bacillus subtilis</i> with empty vector pDG1661 was detected on HT-29 cell line than the one of <i>B. subtilis</i> with RPMrel peptide on HT-29. Comparing the number of <i>Bacillus subtilis</i> with RPMrel retained on HT-29 and HBE16, more <i>Bacillus subtilis</i> can be detected on HBE16 cell. Two round of T-tests were further performed and it showed that no significant differences in the binding affinity between <i>Bacillus subtilis</i> with or without RPMrel to HT-29 cell (P>0.05) but the number of <i>Bacillus subtilis</i> with RPMrel peptide binding to HBE16 cells is significantly higher than the same bacteria bind to HT-29.</li><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/a/aa/HKUST_table_for_colon_cancer_binding_steven.jpg" width="50%"/></p><br />
<br />
Table 1: Number of Bacillus subtilis retained on different mammalian cell line.<br><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/3/30/HKUST_Number_of_Bacillus_subtilis_retained_on_mammalian_cell.jpg" width="50%"/></p><br />
Figure 2: Number of Bacillus subtilis retained on different mammalian cell line</p><br><br />
<br />
<br />
<p><strong>Discussion</strong></p><br />
<p><li><strong>Experiment result to some extent reject our hypothesis but no solid conclusion can be made at this stage:</strong><br></p><br />
<p>Based on the result from table 1 and figure 2 and two t-test performed, it can be stated that <i>B. subtilis</i> with RPMrel displaying have no significant increase in binding ability to cancer cell line and the peptide displaying results in significant improvement in binding to normal epithelial tissue. <br></p><br />
<p>However, the statement above is just based on the evidence we have now. Because of time limitation, we haven’t demonstrated that LytC system can facilitate the displaying successfully be displaying on cell wall. Therefore, we can hardly tell the unexpected result is caused by the unexpected structure changes of RPMrel when displaying on cell wall or because of the failure of LytC system in transporting and localizing RPMrel on cell wall.<br></p><br />
<p>In addition, the gram staining method used in our characterization is not consistence during our one-month characterization work. Over staining happened from time to time and the cell layers were easily detached from the bottom of well after adding crystal violet.<br></p><br />
<p>Besides, more proper control group is needed for our experiment. Because of the limitation of source and time we have, no normal epithelial cell line from digestive system can be found and used in our work. Engaging HBE16 cells in experiment is a compromised but best choice we have so far. If possible, we will try to engage othrt cell lines in our experiment in order to draw solid conclusion in the future. <br></p><br />
<p><li><strong>Future work</strong></li></p><ol><br />
<li>Using BBa_K733008 (LytC system with flag tag on its C terminus) to verify the proper functioning of the cell wall binding system.</li><br />
<li>Developing some more reliable staining method to demonstrate the adherence between <i>B. subtilis</i> and mammalian cell.</i><br />
<li>Proper control bacteria and proper control cell line need to be added in our characterization in order to obtain reliable and solid conclusions. </i><br />
</ol><br />
<br><br />
<p><strong>Reference</strong></p><br />
<p>Haiqing Sheng, Wang Jing, Lim Ji Youn, Davitt Christine, Minnich Scott A. & Hovde Carolyn J. 2012. Internalization of <i>Escherichia coli</i> O157:H7 by bovine rectal epithelial cells. <i>Frontiers of Microbiology.</i> (2012.2.32)</p><br />
<p>Kimberly A. Kelly & Jones David A.2003. Isolation of a Colon Tumor Specific Binding Peptide Using Phage Display Selection. <i>Neoplasia.</i> 5: 437 – 444</p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</p><br />
<br />
</div><br />
<div id="paragraph6" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Characterization of BMP2</h1><br />
</div><br />
<p><strong>Characterization of Biobrick BBa_K733017:</strong><br /><br />
<strong>Abstract:</strong><br /><br />
This characterization is intended to demonstrate that <em>B. subtilis </em>transformed with BMP2 expression and secretion construct can trigger the apoptosis of colon cancer. In this characterization, <em>B. subtilis</em> was co-cultured with HT-29 cell. MTT assay which is widely used to cell proliferation and viability assay was engaged in our experiment to investigate the growth suppression effect on colon cancer cell.</p><br />
<p><strong>Material and Method:</strong></p><br />
<ul><br />
<li><strong>Constructing part for <em>B. subtilis</em> characterization : </strong></li><br />
</ul><br />
<p align="left">In order to characterize this construct in B. subtilis, the K733017 was inserted into integration vector pDG1661. Detailed methods can be referred to the characterization of BBa_K733007. </p><br />
<ul><br />
<li><strong>Mammalian cell culture:</strong></li><br />
</ul><br />
<p>Colon adenocarcinoma (HT-29) was cultured in McCoy&rsquo;s 5A medium supplement with 10% FBS in 5% CO2, 37℃ incubator. They were seeded in 96 well plate for further characterization.</p><br />
<ul><br />
<li><strong><em>Bacillus subtilic</em></strong><strong> culture: </strong></li><br />
</ul><br />
<p><em>Bacillus subtilis</em> transformed with pDG1661-K733017 and the one transformed with pDG1661 empty vector were cultured separately in LB medium. Overnight cultures were diluted to OD650=0.1 and subculture to OD650 reaching 1.0.<em> B. subtilis</em> were washed three times with 0.1M PBS and diluted to OD=0.1, 0.01, 0.001 and 0.0001 in McCoy&rsquo;s 5A medium with 10%FBS supplemented. </p><br />
<ul><br />
<li><strong>Co-culture <em>Bacillus subtilis</em> with mammalian cell: </strong></li><br />
</ul><br />
<p>3000 HT-29 cells in 100μl were seeded in 96 well plate. After overnight incubation, 100μl <em>B.subtilis</em> suspension is added into each well and co-cultured with HT-29 cell for 48 hours. </p><br />
<ul><br />
<li><strong>MTT assay: </strong></li><br />
</ul><br />
<p>Cells were washed 5 times with 0.1M PBS. 0.5% MTT solution was added and incubated in 37℃ for 4 hours. After incubation, 100ul DMSO was added into each well, shacking for 5 minutes in order to obtain homogenized solution. A570 were measured then to reflect the viability of cells. Percentage of viability was calculated through equation <img width="342" height="26" src="file:///F|/iGEM/wiki/clip_image002.png" /> <br /><br />
<strong>Result: </strong><br /><br />
A decline trend of cell proliferation can be clearly observed when more bacteria were co-cultured with HT-29 cell as shown in figure 1. Comparing the proliferation rate HT-29 cells which were co-cultured with BMP2 producing<em> B. subtilis</em> and non-BMP2 produced <em>B. subtilis</em>, a significant decline can be detected when initial OD650 of <em>B. subtilis </em>equal to 0.1 and 0.01. (P&lt;0.05 ). No significant difference can be detected when OD650 decreased to 0.001. When it OD650 comes to 0.0001, significant increase in cell proliferation rate can be detected in experiment group. </p><img width=50% src="https://static.igem.org/mediawiki/2012/7/7f/Mmm.jpg"><br />
<p style="clear:both"><strong>Discussion: </strong><br /><br />
In this characterization, <em>Bacillus subtilis</em> transformed with plasmid pDG161-K733017 execute significant growth inhibition effect when OD650 is above 0.01. However, no supporting experiment like western blot has been successfully carried out to confirm the expression of BMP2 in <em>B. subtilis</em>. Therefore, more experiment need to be done in order to fully characterize this biobrick.</p><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Section_Heading{<br />
width:auto;<br />
height:50px;<br />
padding:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#33FF33;<br />
opacity:0.8;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
clear:both;<br />
}<br />
.Section_Heading h3 p{<br />
color:#000;<br />
}<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:autopx;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph4{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph5{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:autopx;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph6{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<br />
<div id="Sitemap"><br />
<div class="Sitemap_Content"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Device</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:145px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong
Team:HKUST-Hong Kong
2012-09-26T20:10:53Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:auto;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<div id="Side_Bar" align=center><br />
<object type="application/x-shockwave-flash" height="120" width="250" data="http://www.usflashmap.com/component/cdt_new/cdt2_1.swf"><br />
<param name="movie" value="http://www.usflashmap.com/component/cdt_new/cdt2_1.swf" /><br />
<param name="base" value="http://www.usflashmap.com/component/cdt_new/" /><br />
<param name="flashvars" value="<br />
&timer=1&<br />
&time_template=3:ss;2:mm;1:hh;0:dd&<br />
&time_color=0x000000&<br />
&label_color=0x000000&<br />
&background_color=0xFFFFFF&<br />
&flare_view=true&<br />
&time_label=d:DAY;h:HOUR;m:MIN;s:SEC&<br />
&time_zone=Local time&<br />
&event_time=year:2012;month:10;day:6;hour:0;minute:0;seconds:0&<br />
&event_duration=year:0;month:0;day:0;hour:0;minute:0;seconds:0&<br />
&event_recursion=hourly&<br />
&onpress_url=-&<br />
&event_onpress_url=-&<br />
&title=time to HKUST!&<br />
&event_title=event&<br />
&sound_file=-&<br />
&event_sound_file=-&<br />
&transparent=true&<br />
" /><br />
<param name="quality" value="high" /><br />
<param name="wmode" value="transparent" /><br />
<param name="scale" value="noscale" /><br />
<param name="salign" value="lt" /><br />
</object><br />
<br />
<div id="Chrome_Rec" width="240px" height="40px" style="padding:10px;"><br />
<img src="https://static.igem.org/mediawiki/2012/c/c1/Google_Chrome.png" width="35px" height="35px" id="Chrome_Logo" style="float:left;"><br />
<div style="float:left; margin-left:5px;" align=left><font size="1"><a href="https://www.google.com/intl/en/chrome/browser/?hl=en&brand=CHMB&utm_campaign=zh-HK&utm_source=zh-HK-ha-apac-hk-sk&utm_medium=ha">Google Chrome</a> is recommended<br> for viewing this page.</font></div><br />
<div class="Sitemap_Content"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
<div id="Slideshow"><br />
<ul><br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/8/81/HKUST2012Team.jpg" width="670" height="420" /><br />
<br />
</li><br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/b/ba/Bhercules.jpg" width="670" height="420" /><br />
<br />
</li><br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/c/cf/BsubtilisIntegration.JPG" width="670" height="420" /><br />
<br />
</li><br />
<br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/2/20/InhibitionDevice.jpg" width="670" height="420" /><br />
<br />
</li><br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/b/b8/Plasmid_Overview.jpeg" width="670" height="420" /><br />
<br />
</li><br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/4/49/HKUST_RED_BIRD.jpg" width="670" height="420" /><br />
<br />
</li><br />
</ul><br />
<br />
<br />
</div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p align = "center" ><font size=50>B. hercules</font><br>------<i>The Terminator of Colon Cancer</i></p></h1><br />
<p>Millions of cancer patients around the world currently depend on conventional cancer therapies to extend their lives. These conventional therapies, composed of surgery, radiotherapy and chemotherapies, all have their own limitations and shortcomings. Short-term and long-term side effects include vomiting, hair loss, organ failure, or even induction of a second tumor brought about by the spreading toxicity of anti-tumor chemicals in the circulatory system, thus prompting active research into alternative cancer therapies. We, the 2012 HKUST iGEM team, have chosen to focus on colorectal carcinomas, the fourth most common cancer type around the world, as our study object. We aim to use genetically modified <i>Bacillus subtilis</i> to execute targeted drug delivery to cancer cells in the intestinal tract, offering an advantage of minimal harm of the drug to normal colon epithelial cells. <br><br> Our project hopes to engineer <i>B. subtilis</i> to enable them to recognize colon carcinomas. This specific targeting is to be achieved by expressing a colon tumor specific binding peptide on the cell wall using a cell wall binding system.<br><br> After binding, an anti-tumor chemokine is to be synthesized and secreted from the bacterial cells with the help of a signaling peptide fused to the protein. To minimize over-production of this tumor suppressor, an inducible production system is introduced. This option of external inducible control will allow us to initiate chemokine release at a time when optimum effect can be achieved; that is, when the killer bacteria are close enough to the colon cancer cells. <br><br> Finally, in consideration of both biosafety issues and the possible harm from an over-dosage of antitumor drug, a toxin-antitoxin system is to be employed in our bacterial vector. This system is supposed to provide a minimum threshold of antitumor drug production and at the same time, minimizing the risk of plasmid lateral transfer among gut flora. </p> <br />
</div><br />
<br />
<br />
<style type="text/css"><br />
<br />
#Slideshow{<br />
width:4000px;<br />
box-shadow: 5px 5px 5px #888888;<br />
}<br />
<br />
#Slideshow ul{<br />
list-style:none;<br />
width:4000px;<br />
margin:0;<br />
padding:0;<br />
position:relative; <br />
}<br />
<br />
#Slideshow li{<br />
display:inline;<br />
float:left; <br />
}<br />
<br />
</style><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.3.2/jquery.min.js"></script><br />
<script type="text/javascript" src="https://static.igem.org/mediawiki/2012/9/91/Slide_Show.txt"></script><br />
<br />
<script type="text/javascript"><br />
<br />
$(function(){<br />
<br />
$('#Slideshow').infiniteCarousel();<br />
<br />
});<br />
<br />
</script><br />
</div><br />
<br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="center"><br />
<h1><p align = "center" ><font size=30>Why B. hercules?</font></p></h1> </div><br />
<p><br />
Cancer, as one of the most obstinate diseases around the world, is well-known for its immortal proliferation. Its name originates from one of the Zodiac ‘Cancer’ which represents death and reincarnation. Next to Cancer, there is a constellation called Heracles. It is named after the most famous Greek hero Heracles (whose Roman name is Hercules). In Greek myth, Hera sent Karkinos (Cancer or crab in Greek) to distract Heracles in his battle with Hedra, the second labour for Heracles. However, during the battle, Heracles easily smashed the crab’s (Cancer) shell by foot.</p><br />
<p><br />
B. hercules, our engineered <i>B. subtilis</i> executing anti-tumor function, is named after this hero. We would like to have our hero, B. hercules, combat and eliminate colon cancer in a breeze, but leaving the innocent unharmed. </p><br />
<p><br />
That’s the mission we gave to our B. hercules.<br />
</p><br />
</div> <br />
</div><br />
<br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:680px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:680px;<br />
height:330px;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:680px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Sitemap_Content{<br />
background-color:#CCFFCC;<br />
opacity:0.8;<br />
width:230px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong
Team:HKUST-Hong Kong
2012-09-26T20:09:57Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:auto;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
<div id="Side_Bar" align=center><br />
<object type="application/x-shockwave-flash" height="120" width="250" data="http://www.usflashmap.com/component/cdt_new/cdt2_1.swf"><br />
<param name="movie" value="http://www.usflashmap.com/component/cdt_new/cdt2_1.swf" /><br />
<param name="base" value="http://www.usflashmap.com/component/cdt_new/" /><br />
<param name="flashvars" value="<br />
&timer=1&<br />
&time_template=3:ss;2:mm;1:hh;0:dd&<br />
&time_color=0x000000&<br />
&label_color=0x000000&<br />
&background_color=0xFFFFFF&<br />
&flare_view=true&<br />
&time_label=d:DAY;h:HOUR;m:MIN;s:SEC&<br />
&time_zone=Local time&<br />
&event_time=year:2012;month:10;day:6;hour:0;minute:0;seconds:0&<br />
&event_duration=year:0;month:0;day:0;hour:0;minute:0;seconds:0&<br />
&event_recursion=hourly&<br />
&onpress_url=-&<br />
&event_onpress_url=-&<br />
&title=time to HKUST!&<br />
&event_title=event&<br />
&sound_file=-&<br />
&event_sound_file=-&<br />
&transparent=true&<br />
" /><br />
<param name="quality" value="high" /><br />
<param name="wmode" value="transparent" /><br />
<param name="scale" value="noscale" /><br />
<param name="salign" value="lt" /><br />
</object><br />
<br />
<div id="Chrome_Rec" width="240px" height="40px" style="padding:10px;"><br />
<img src="https://static.igem.org/mediawiki/2012/c/c1/Google_Chrome.png" width="35px" height="35px" id="Chrome_Logo" style="float:left;"><br />
<div style="float:left; margin-left:5px;" align=left><font size="1"><a href="https://www.google.com/intl/en/chrome/browser/?hl=en&brand=CHMB&utm_campaign=zh-HK&utm_source=zh-HK-ha-apac-hk-sk&utm_medium=ha">Google Chrome</a> is recommended<br> for viewing this page.</font></div><br />
<div class="Sitemap_Content"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
<div id="Slideshow"><br />
<ul><br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/8/81/HKUST2012Team.jpg" width="670" height="420" /><br />
<br />
</li><br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/b/ba/Bhercules.jpg" width="670" height="420" /><br />
<br />
</li><br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/c/cf/BsubtilisIntegration.JPG" width="670" height="420" /><br />
<br />
</li><br />
<br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/2/20/InhibitionDevice.jpg" width="670" height="420" /><br />
<br />
</li><br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/b/b8/Plasmid_Overview.jpeg" width="670" height="420" /><br />
<br />
</li><br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/4/49/HKUST_RED_BIRD.jpg" width="670" height="420" /><br />
<br />
</li><br />
</ul><br />
<br />
<br />
</div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p align = "center" ><font size=50>B. hercules</font><br>------<i>The Terminator of Colon Cancer</i></p></h1><br />
<p>Millions of cancer patients around the world currently depend on conventional cancer therapies to extend their lives. These conventional therapies, composed of surgery, radiotherapy and chemotherapies, all have their own limitations and shortcomings. Short-term and long-term side effects include vomiting, hair loss, organ failure, or even induction of a second tumor brought about by the spreading toxicity of anti-tumor chemicals in the circulatory system, thus prompting active research into alternative cancer therapies. We, the 2012 HKUST iGEM team, have chosen to focus on colorectal carcinomas, the fourth most common cancer type around the world, as our study object. We aim to use genetically modified <i>Bacillus subtilis</i> to execute targeted drug delivery to cancer cells in the intestinal tract, offering an advantage of minimal harm of the drug to normal colon epithelial cells. <br><br> Our project hopes to engineer <i>B. subtilis</i> to enable them to recognize colon carcinomas. This specific targeting is to be achieved by expressing a colon tumor specific binding peptide on the cell wall using a cell wall binding system.<br><br> After binding, an anti-tumor chemokine is to be synthesized and secreted from the bacterial cells with the help of a signaling peptide fused to the protein. To minimize over-production of this tumor suppressor, an inducible production system is introduced. This option of external inducible control will allow us to initiate chemokine release at a time when optimum effect can be achieved; that is, when the killer bacteria are close enough to the colon cancer cells. <br><br> Finally, in consideration of both biosafety issues and the possible harm from an over-dosage of antitumor drug, a toxin-antitoxin system is to be employed in our bacterial vector. This system is supposed to provide a minimum threshold of antitumor drug production and at the same time, minimizing the risk of plasmid lateral transfer among gut flora. </p> <br />
</div><br />
<br />
<br />
<style type="text/css"><br />
<br />
#Slideshow{<br />
width:4000px;<br />
box-shadow: 5px 5px 5px #888888;<br />
}<br />
<br />
#Slideshow ul{<br />
list-style:none;<br />
width:4000px;<br />
margin:0;<br />
padding:0;<br />
position:relative; <br />
}<br />
<br />
#Slideshow li{<br />
display:inline;<br />
float:left; <br />
}<br />
<br />
</style><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.3.2/jquery.min.js"></script><br />
<script type="text/javascript" src="https://static.igem.org/mediawiki/2012/9/91/Slide_Show.txt"></script><br />
<br />
<script type="text/javascript"><br />
<br />
$(function(){<br />
<br />
$('#Slideshow').infiniteCarousel();<br />
<br />
});<br />
<br />
</script><br />
</div><br />
<br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="center"><br />
<h1><p align = "center" ><font size=30>Why B. hercules?</font></p></h1> </div><br />
<p><br />
Cancer, as one of the most obstinate diseases around the world, is well-known for its immortal proliferation. Its name originates from one of the Zodiac ‘Cancer’ which represents death and reincarnation. Next to Cancer, there is a constellation called Heracles. It is named after the most famous Greek hero Heracles (whose Roman name is Hercules). In Greek myth, Hera sent Karkinos (Cancer or crab in Greek) to distract Heracles in his battle with Hedra, the second labour for Heracles. However, during the battle, Heracles easily smashed the crab’s (Cancer) shell by foot.</p><br />
<p><br />
B. hercules, our engineered <i>B. subtilis</i> executing anti-tumor function, is named after this hero. We would like to have our hero, B. hercules, combat and eliminate colon cancer in a breeze, but leaving the innocent unharmed. </p><br />
<p><br />
That’s the mission we gave to our B. hercules.<br />
</p><br />
</div> <br />
</div><br />
<br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:680px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:680px;<br />
height:330px;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:680px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Sitemap_Content{<br />
background-color:#CCFFCC;<br />
opacity:0.8;<br />
width:230px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong
Team:HKUST-Hong Kong
2012-09-26T20:07:59Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:auto;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<div id="News_Bar" align=center style="float:right;"><br />
<h3 id="News_Click">Click to See What's New!!!<br />
<br> Wiki editing record below </br><br />
<br> http://goo.gl/H0A25 </br><br />
<br />
</h3><br />
<div id="News_Content"><br />
<p><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project" target="_new">**Our Project Description has been uploaded, click here to view our project description!</a> </p><br />
<p><br />
<a href="https://igem.org/About" target="_new">**Don't know what's iGEM? Click here to learn more!</a><br />
</p><br />
<p><br />
<a href="https://igem.org/Team_Wikis?year=2012" target="_new">**Check out what other teams are doing!</a><br />
</p><br />
<p><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety"> **Check out our page on Safety Issues!**</a><br />
</p><br />
<p><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction"> **Click here to see our Project Abstraction!**</a><br />
</p><br />
</div><br />
<br />
</div><br />
<br />
<div id="Side_Bar" align=center><br />
<object type="application/x-shockwave-flash" height="120" width="250" data="http://www.usflashmap.com/component/cdt_new/cdt2_1.swf"><br />
<param name="movie" value="http://www.usflashmap.com/component/cdt_new/cdt2_1.swf" /><br />
<param name="base" value="http://www.usflashmap.com/component/cdt_new/" /><br />
<param name="flashvars" value="<br />
&timer=1&<br />
&time_template=3:ss;2:mm;1:hh;0:dd&<br />
&time_color=0x000000&<br />
&label_color=0x000000&<br />
&background_color=0xFFFFFF&<br />
&flare_view=true&<br />
&time_label=d:DAY;h:HOUR;m:MIN;s:SEC&<br />
&time_zone=Local time&<br />
&event_time=year:2012;month:10;day:6;hour:0;minute:0;seconds:0&<br />
&event_duration=year:0;month:0;day:0;hour:0;minute:0;seconds:0&<br />
&event_recursion=hourly&<br />
&onpress_url=-&<br />
&event_onpress_url=-&<br />
&title=time to HKUST!&<br />
&event_title=event&<br />
&sound_file=-&<br />
&event_sound_file=-&<br />
&transparent=true&<br />
" /><br />
<param name="quality" value="high" /><br />
<param name="wmode" value="transparent" /><br />
<param name="scale" value="noscale" /><br />
<param name="salign" value="lt" /><br />
</object><br />
<br />
<div id="Chrome_Rec" width="240px" height="40px" style="padding:10px;"><br />
<img src="https://static.igem.org/mediawiki/2012/c/c1/Google_Chrome.png" width="35px" height="35px" id="Chrome_Logo" style="float:left;"><br />
<div style="float:left; margin-left:5px;" align=left><font size="1"><a href="https://www.google.com/intl/en/chrome/browser/?hl=en&brand=CHMB&utm_campaign=zh-HK&utm_source=zh-HK-ha-apac-hk-sk&utm_medium=ha">Google Chrome</a> is recommended<br> for viewing this page.</font></div><br />
<div class="Sitemap_Content"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
<div id="Slideshow"><br />
<ul><br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/8/81/HKUST2012Team.jpg" width="670" height="420" /><br />
<br />
</li><br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/b/ba/Bhercules.jpg" width="670" height="420" /><br />
<br />
</li><br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/c/cf/BsubtilisIntegration.JPG" width="670" height="420" /><br />
<br />
</li><br />
<br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/2/20/InhibitionDevice.jpg" width="670" height="420" /><br />
<br />
</li><br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/b/b8/Plasmid_Overview.jpeg" width="670" height="420" /><br />
<br />
</li><br />
<li><br />
<img src="https://static.igem.org/mediawiki/2012/4/49/HKUST_RED_BIRD.jpg" width="670" height="420" /><br />
<br />
</li><br />
</ul><br />
<br />
<br />
</div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p align = "center" ><font size=50>B. hercules</font><br>------<i>The Terminator of Colon Cancer</i></p></h1><br />
<p>Millions of cancer patients around the world currently depend on conventional cancer therapies to extend their lives. These conventional therapies, composed of surgery, radiotherapy and chemotherapies, all have their own limitations and shortcomings. Short-term and long-term side effects include vomiting, hair loss, organ failure, or even induction of a second tumor brought about by the spreading toxicity of anti-tumor chemicals in the circulatory system, thus prompting active research into alternative cancer therapies. We, the 2012 HKUST iGEM team, have chosen to focus on colorectal carcinomas, the fourth most common cancer type around the world, as our study object. We aim to use genetically modified <i>Bacillus subtilis</i> to execute targeted drug delivery to cancer cells in the intestinal tract, offering an advantage of minimal harm of the drug to normal colon epithelial cells. <br><br> Our project hopes to engineer <i>B. subtilis</i> to enable them to recognize colon carcinomas. This specific targeting is to be achieved by expressing a colon tumor specific binding peptide on the cell wall using a cell wall binding system.<br><br> After binding, an anti-tumor chemokine is to be synthesized and secreted from the bacterial cells with the help of a signaling peptide fused to the protein. To minimize over-production of this tumor suppressor, an inducible production system is introduced. This option of external inducible control will allow us to initiate chemokine release at a time when optimum effect can be achieved; that is, when the killer bacteria are close enough to the colon cancer cells. <br><br> Finally, in consideration of both biosafety issues and the possible harm from an over-dosage of antitumor drug, a toxin-antitoxin system is to be employed in our bacterial vector. This system is supposed to provide a minimum threshold of antitumor drug production and at the same time, minimizing the risk of plasmid lateral transfer among gut flora. </p> <br />
</div><br />
<br />
<br />
<style type="text/css"><br />
<br />
#Slideshow{<br />
width:4000px;<br />
box-shadow: 5px 5px 5px #888888;<br />
}<br />
<br />
#Slideshow ul{<br />
list-style:none;<br />
width:4000px;<br />
margin:0;<br />
padding:0;<br />
position:relative; <br />
}<br />
<br />
#Slideshow li{<br />
display:inline;<br />
float:left; <br />
}<br />
<br />
</style><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.3.2/jquery.min.js"></script><br />
<script type="text/javascript" src="https://static.igem.org/mediawiki/2012/9/91/Slide_Show.txt"></script><br />
<br />
<script type="text/javascript"><br />
<br />
$(function(){<br />
<br />
$('#Slideshow').infiniteCarousel();<br />
<br />
});<br />
<br />
</script><br />
</div><br />
<br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="center"><br />
<h1><p align = "center" ><font size=30>Why B. hercules?</font></p></h1> </div><br />
<p><br />
Cancer, as one of the most obstinate diseases around the world, is well-known for its immortal proliferation. Its name originates from one of the Zodiac ‘Cancer’ which represents death and reincarnation. Next to Cancer, there is a constellation called Heracles. It is named after the most famous Greek hero Heracles (whose Roman name is Hercules). In Greek myth, Hera sent Karkinos (Cancer or crab in Greek) to distract Heracles in his battle with Hedra, the second labour for Heracles. However, during the battle, Heracles easily smashed the crab’s (Cancer) shell by foot.</p><br />
<p><br />
B. hercules, our engineered <i>B. subtilis</i> executing anti-tumor function, is named after this hero. We would like to have our hero, B. hercules, combat and eliminate colon cancer in a breeze, but leaving the innocent unharmed. </p><br />
<p><br />
That’s the mission we gave to our B. hercules.<br />
</p><br />
</div> <br />
</div><br />
<br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:680px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:680px;<br />
height:330px;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:680px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Sitemap_Content{<br />
background-color:#CCFFCC;<br />
opacity:0.8;<br />
width:230px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/File:Mmm.jpg
File:Mmm.jpg
2012-09-26T19:29:14Z
<p>Dynastywarrior: </p>
<hr />
<div></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Glossary
Team:HKUST-Hong Kong/Glossary
2012-09-26T19:16:20Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<div><p align="center"><font size="20">Glossary</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1></h1><br />
</div><br />
<p><strong>Signal peptide</strong> – transient &lsquo;zip code&rsquo; of premature protein which facilitates the secretion of protein in <em>Bacillus subtilis</em>.</p><br />
<p><strong>YbdN</strong> – Signal peptide of protein YbdN in <em>Bacillus subtilis.</em></p><br />
<p><strong><i>ybdN</i></strong> – Gene that codes for YbdN.</p><br />
<p><strong>YdjM</strong> – Signal peptide from protein YdjM in <em>Bacillus subtilis.</em></p><br />
<p><strong><i>ydjM</i></strong> – Gene that codes for YdjM.</p><br />
<p><strong>BMP2</strong> – Bone morphogenetic protein 2.</p><br />
<p><strong>LytC</strong> – <em>B. subtilis </em>inherent cell-wall associated hydrolase mediating cell-wall turnover.</p><br />
<p><strong><i>lytC</i></strong> – Gene that codes for the LytC hydrolase.</p><br />
<p><strong>(EAAAK)<sub>n</sub> type helical linker</strong> – Stiff, long helical linker designed to separate fusion proteins with minimal disturbance to the function of both proteins. </p><br />
<p><strong>RPMrel</strong> – A nine amino acid disulfide-constrained peptide with the amino acid sequence n-CPIEDRPMC-c. Product of screening to isolate peptides with positive affinity for HT29 colon carcinoma cells.</p><br />
<p><strong>FLAG™</strong> – 8 amino acid peptide tag trademarked by the Sigma-Aldrich Corp. used in attachment to the protein-of-interest to facilitate multiple assays.</p><br />
<p><strong><em>PxylA</em></strong> – The region containing the sigma A binding region for the xylose inducible promoter.</p><br />
<p><strong>XylR</strong> – The transcriptional regulator for PxylA promoter.</p><br />
<p><strong><em>Ptms</em></strong> – A low efficient constitutive promoter in <em>E. coli</em> and <em>B. subtilis.</em></p><br />
<p><strong>EndoA</strong> – Endoribonuclease that can inactivate cellular mRNAs by cleaving them at specific but frequently occurring sites (i.e. UAUAAU↓AC).</p><br />
<p><strong><i>ydcE</i></strong> – Gene that codes for the EndoA endoribonuclease.<br /></p><br />
<p><strong>YdcD</strong> – Antidote that counteracts the function of EndoA.</p><br />
<p><strong><i>ydcD</i> (<i>endB</i>)</strong> – Gene that codes for the YdcD antidote. </p><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement
Team:HKUST-Hong Kong/Acknowledgement
2012-09-26T19:15:50Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<div><p align="center"><font size="20">Acknowledgement</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1></h1><br />
</div><br />
<embed height=500px width=945px src="https://static.igem.org/mediawiki/2012/f/f2/Acknowledgement-final.pdf"></embed><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Attribution
Team:HKUST-Hong Kong/Attribution
2012-09-26T19:15:20Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align="center"><font size="20">Attribution</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1></h1><br />
</div><br />
<p>All the laboratory works done to construct out project were conducted by team member of 2012 HKUST iGEM Team; which include all the Biobricks submitted to Part Registry, characterization of Biobricks, Human Practice and Team Wiki.</p><br />
<p>Above all, all laboratory works were under supervision of Laboratory Technician, while we conducted all the experiments by ourselves.</p><br />
<br />
<br />
<br />
<p><strong>Team Member Contribution</strong><br><br />
<br />
Project Name: B. hercules<br><br />
Project Proposal: Sun Fei<br><br><br />
<strong>Laboratory Work</strong><br><br />
<p>2012 HKUST iGEM Leader: Sun Fei<br></p><br />
<p>I. Construct Development</p><br />
<p>Target Binding Module</p><br />
Sean Carim, Chan Yak Nok, Ka Chun Mok, Shi Tianxing, Carson Lam<br><br />
<p>Anti-tumor Molecule Secretion Module</p><br />
Yu Lai Cheong, Chelsilia Tanzil, Ilona Christy Unarta, Li Yiming, Sun Fei<br><br />
<p>Regulation and Control Module</p><br />
Wang Yuqi, Gu Bida, Qi Yi, Yu Xiaoying, Sun Fei<br><br />
<p>II. Characterizations of Biobricks</p><br />
Christopher Lee, Sun Fei, Li Yiming, Wang Yuqi, Gu Bida<br><br><br />
<strong>Human Practice</strong><br><br />
I. Interview: Sean Carim, Wang Yuqi, Li Yiming<br><br />
II. Presentation to Cancer Fund Organization: Sean Carim, Wang Yuqi<br><br><br />
<strong>Wiki Page</strong><br><br />
Leon Lee<br><br><br />
<strong>Poster</strong><br><br />
Shi Tianxing, Chelsilia Tanzil, Ilona Christy Unarta, Yang Yang<br><br><br />
<strong>T-shirt Design</strong><br><br />
Yu Lai Cheong, Shi Tianxing, Chan Yak Nok<br><br><br />
<strong>Mascot Design</strong><br><br />
Joel Yu, Shi Tianxing<br><br><br />
<strong>Other</strong><br><br />
Secretary of General Meeting<br><br />
Li Yiming, Chan Yak Nok<br><br />
<br />
<br />
</p><br />
<br />
<br />
<br />
<br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Safety
Team:HKUST-Hong Kong/Safety
2012-09-26T19:14:51Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>Biobrick Safety</p></h1><br />
</div><br />
<p>Our BioBricks, especially those containing the gene coding for the mature region of mouse Bone Morphogenetic Protein 2 (BMP2), all possess a degree of risk. In mammals, BMP2 is known to elicit a wide variety of biological effects on tissues; the most well known include induction of bone and cardiac cell differentiation. Being a defining member of the Transforming Growth Factor Beta (TGF-β) pathway, it also plays important roles in cell proliferation. Hence, induction of excess BMP2 may lead to undesirable tissue behavior in mammalian systems.<br><br />
<br />
<br> Documented adverse effects of recombinant human BMP2 include formation of cyst-like bony structures and soft swelling with hematomas when the gene product is applied in spinal fusion therapy. Further animal tests using mice with spine defects indicate that the occurrence and severity of these effects are positively correlated with BMP2 dosage. In addition, as BMP2 receptor transcription has been found to be up-regulated in certain cancer types (for example pancreatic cancer), confined delivery of the chemokine is critical.<br><br />
<br />
<br>See relevant documents by following links below:<br><br />
<a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3079169/pdf/ten.tea.2010.0555.pdf">High Doses of Bone Morphogenetic Protein 2 Induce Structurally Abnormal Bone and Inflammation In Vivo</a><br><a href="http://ajpgi.physiology.org/content/291/1/G135.full.pdf+html">Bone Morphogenetic Protein Signalling and Growth Suppression in Colon Cancer</a><br><br />
<br />
<br>We would recommend that future groups intending to use this gene do simultaneously incorporate methods to control production of BMP2 to minimize its contact with researchers and/or its release into the environment. Our strategy described in the 'Regulation and Control' module may be viewed as an initial attempt to achieve this.<br><br />
<br />
<br>Expression of BioBricks carrying code for the LytC protein cell wall binding domain and RPMrel phage display peptide will lead to the phenotype of RPMrel peptides anchored to the chassis cell wall. It is known that phages displaying this peptide bind preferentially to the highly tumorigenic HT-29 colorectal cell line than to the less tumorigenic HCT 116 colorectal cell line. The binding preference is characterized by an at least 10-fold increase in binding affinity. As expression of this peptide in bacterial cells is novel, steps should be taken to minimize the chance of its horizontal transfer to pathogenic bacterial species, which could result in increased infection activity of that species. Integration of this gene into the bacterial genome, an approach taken by our team, would be one way to work towards reducing horizontal gene transfer.<br><br />
<br />
<br>Please refer to the document below:<br><br />
<a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1550331/pdf/neo0505_0437.pdf">Isolation of a Colon Tumor Specific Binding Peptide Using Phage Display Selection</a><br><br />
<br />
<br>Elements of our toxin-antitoxin system for controlling cell lysis contain the <em>ydcDE</em> operon of <em>Bacillus subtilis</em>. The <em>ydcE</em> gene encodes an endoribonuclease that cleaves multiple regions of cellular mRNA, while the gene <em>ydcD</em> has been shown to inhibit this endonuclease activity <em>in vivo</em>. Our system employs those same gene products recombined with different promoters: <em>Pveg</em> promoter for <em>ydcD</em>, <em>Pxyl</em> promoter for <em>ydcE</em>. An investigation to determine whether expression of the <em>E. coli</em> <em>ydcE</em> homolog (<em>mazF</em>) in macaque monkeys is safe yielded results indicating an absence of tissue damage and antigen-specific antibody production. We therefore consider the <em>ydcE</em> product to be non-toxic to humans.<br><br />
<br />
<br>Please refer to the document below:<br><br />
<a href="http://www.plosone.org/article/fetchObjectAttachment.action;jsessionid=D783F7ED7A47A2BD2E10269D162F6D43?uri=info%3Adoi%2F10.1371%2Fjournal.pone.0023585&representation=PDF">In Vivo Safety and Persistence of Endoribonuclease Gene-Transduced CD4+ T Cells in Cynomolgus Macaques for HIV-1 Gene Therapy Model</a><br />
</p><br />
</div><br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="center"><br />
<h1><p>Researcher Safety</p></h1><br />
</div><br />
<p><br />
Construction and characterization of our project&rsquo;s assorted constructs involved work with two non-pathogenic bacterial strains: <em>Escherichia coli </em>DH10B and <em>Bacillus subtilis </em>168; both strains commonly used in research, education, and industry. In the manipulation of these strains, Biosafety Level 1 standard regulations were strictly followed. Our characterization also required the use of human colon carcinoma HT-29 cells, which were handled only by trained team members using a designated tissue culture hood with HEPA filters. Biosafety Level 2 safety requirements were observed. Gloves and laboratory coats were worn when performing laboratory work. <br><br />
<br />
<br>Notably toxic and/or mutagenic substances used in the lab include phenol, chloroform, and ethidium bromide. They were only used by members of the team who had received safety training to recognize the associated hazards and handle them appropriately. <br><br />
<br />
<br>Hypersensitive responses to the subtilisin enzyme excreted by <em>B. subtilis</em> (which is often found in detergent) is more likely. Standard precautions for handling microorganisms such as proper wearing of gloves to prevent direct contact will help to alleviate this risk. <br><br />
<br />
<br>Of the few documented cases of <em>B. subtilis</em> infection, the vast majority involved severely immunocompromised patients. Should one of our researchers enter such a state, he or she will not be allowed into the lab and will be expected to rest and seek treatment.<br><br />
</div><br />
<div id="paragraph3" class="bodyParagraphs"><br />
<div align="right"><br />
<h1><p>Public Safety</p></h1><br />
</div><br />
<p>The ultimate aim of our team&rsquo;s biological system is to perform act as an anti-cancer agent within the human digestive tract. Direct interaction with live human cells is a requirement of its function thus demanding particular considerations for safety. Similar precautions to protect cancer patients for whom the treatment is intended will also help in protecting the public in the off-chance our system enters the environment beyond the lab.<br><br />
<br />
<br>Firstly it must be made clear that no patient exhibiting immunodeficiency or under immunosuppression should be recommended for this treatment or any subsequent approved derivative of this treatment. There is a likelihood these patients will suffer from <em>B. subtilis</em> infection. <br><br />
<br />
<br><em>B. subtilis</em> is a known normal gut commensal and is considered a bacterial species conferring minimal risks to human. It produces no particles considered toxic to humans. Enzymes produced by <em>B. subtilis</em>, including carbohydrases and proteases contributing to its function as a part of the gut microbiome, are classified &lsquo;Generally Recognized As Safe&rsquo; (GRAS) by the FDA. The species has also been proven to function as a probiotic when consumed in certain food stuffs, most notably fermented soy bean. No recombined component of our biological system is known to confer negative effects on gut microbiome function.<br><br />
<br />
<br>Two regulatory functions were put in place to control BMP2 production and minimize its potential negative effects. Firstly, the BMP2 construct makes use of a xylose-inducible promoter. This induction system reduces the chance of BMP2 production in any unintended circumstance. Secondly, a cap is placed on maximum BMP2 production per cell by incorporating a toxin-antitoxin cassette that facilitates toxin transcription in direct correlation with BMP2 transcription. This cap is intended to prevent the onset of adverse effects caused by excessive BMP2 signalling. More information on these regulatory functions can be found in the Regulation and Control module.<br><br />
</div><br />
<div id="paragraph4" class="bodyParagraphs"><br />
<div align="center"><br />
<h1><p>Environmental Safety</p></h1><br />
</div><br />
<p>Steps were taken to limit the spread of potentially harmful genes should our biological system be leaked into the environment. <br><br />
<br />
<br>Both bacterial cell strains used (<em>E. coli</em> DH10B and <em>B. subtilis</em> 168) possess an amino acid metabolism deficiency that reduce their competitiveness in the wild. DH10B exhibits leucine deficiency while 168 exhibits tryptophan deficiency. Such phenotypes reduce the chance these bacterial strains have when surviving beyond the lab.<br><br />
<br />
<br><em>E. coli</em> DH10B was used exclusively when building our constructs. All DH10B cells are classified F- and thus do not possess the Fertility factor. The risk of these cells acting as a donor in horizontal gene transfer via conjugation is greatly reduced.<br><br />
<br />
<br>To limit the potential of <em>Bmp2</em> horizontal gene transfer, the antitoxin component of our toxin-antitoxin cassette has been designed into an integration plasmid with antibiotic resistance selectivity for integration. This means that while the genes for BMP2 and toxin expression exist in plasmid form and can potentially be transferred, the recipient cell cannot obtain the antitoxin and thus will be killed. <br><br />
<br />
<br>Prior to disposal, harmful waste (toxic and/or biohazardous) was clearly separated and sterilized, either by application of bleach, or autoclaving.<br><br />
</div><br />
<br />
<div id="paragraph5" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>Biosafety at Our University</p></h1><br />
</div><br />
<p><em>Laws &amp; Guidelines</em><br><br />
<br />
The Cartegena Protocol on Biosafety under the Convention on Biological Diversity (the Protocol) was implemented by China&rsquo;s central government in the year 2000 and was extended to the Hong Kong Special Administrative Region (HKSAR) in May 2011. Adoption of the Protocol was facilitated by introduction of Chapter 607, the Genetically Modified Organisms (Control of Release) Ordinance (the Ordinance) in March of the same year. Under the Ordinance, release of Genetically Modified Organisms (GMOs) knowingly without approval from the Director, the Deputy Director or an Assistant Director of the Agriculture, Fisheries and Conservation Department is considered an offence. The full text of Cap. 607 can be downloaded by following this <a href="http://www.legislation.gov.hk/blis_pdf.nsf/6799165D2FEE3FA94825755E0033E532/CD005BD8FCD84653482576EA0053077B/$FILE/CAP_607_e_b5.pdf">link</a>.<br><br />
<br />
<br>As activities being conducted by the HKUST iGEM 2012 team are concerned strictly with molecular cloning and the testing of recombinant technology biomolecules, no part of the project is destined for release into the environment. Application for approval to perform such a procedure under the Ordinance is therefore not required. <br><br />
<br />
<br>While every citizen in Hong Kong is subject to the Ordinance, laboratories in Hong Kong are to refer to the more detailed Guidelines on Biosafety in the Clinical Laboratory (the Guidelines), a publication of the Centre of Health Protection under the Department of Health. The full text of the Guidelines can be accessed <a href="http://www.chp.gov.hk/files/pdf/Guidelines_on_Biosafety_in_the_Clinical_Laboratory_2nd_Edn.pdf">here</a>. As our laboratory was constructed and is operated by the university&rsquo;s Division of Life Science, the design of the lab, as well as activities performed within the lab, adhere to the above Guidelines. <br><br />
<br />
<br><em>HKUST&rsquo;s HSEO</em><br><br />
<br />
The creation and enforcement of safety regulations is handled by the university&rsquo;s Health, Safety &amp; Environment Office (HSEO). The HSEO also acts in a support function to promote biosafety and other safe laboratory practices by providing safety training for staff and students. <br><br />
</div><br />
<br />
<div id="paragraph6" class="bodyParagraphs"><br />
<div align="center"><br />
<h1><p>Ideas for Safety Issues</p></h1><br />
</div><br />
<p>Measures for promoting the biosafety of our biological system employed by our team this year are nothing revolutionary. But we hope that future teams developing a system for which production of a signalling biomolecule is the aim always make efforts to control dosage. Linking well-characterized promoters to toxin/anti-toxin &lsquo;switches&rsquo; gives us greater control of dosage, allowing us to place a somewhat reliable and quantifiable upper limit on biomolecule production. <br><br />
<br />
<br>We did not find well-characterized inducible promoters for <em>B. subtilis</em> on the Registry. Our team therefore hopes to add some useful data about candidate promoters selected for our employed toxin/anti-toxin cassette. Furthermore, we strongly support efforts that seek to provide the synthetic biology community with more detailed knowledge on the transcriptional and translational efficiency of parts. Such knowledge would help the community employ more dosage-sensitive tools, increasing the repertoire of biological machinery. This year&rsquo;s (2012&rsquo;s) Carnegie Mellon University iGEM team has been working on a non-invasive, non-destructive characterization system that may help us take steps toward this end. See their wiki <a href="https://2012.igem.org/Team:Carnegie_Mellon">here</a>.</p><br />
</div><br />
<br />
<div id="paragraph7" class="bodyParagraphs"><br />
<div align="right"><br />
<h1><p>References</p></h1><br />
</div><br />
<p><br>Beck, Stayce E., Barbara H. Jung, Antonio Fiorino, Jessica Gomez, Eunice Del Rosario, Betty L. Cabrera, Sherry C. Huang, Jimmy Y. C. Chow, and John M. Carethers. "Bone morphogenetic protein signaling and growth suppression in colon cancer." <em>American Journal of Physiology - Gastrointestinal and Liver Physiology</em> 291 (2006): G135-G145. Print.</br><br />
<br />
<br>Chono, Hideto, Naoki Saito, Hiroshi Tsuda, Hiroaki Shibata, Naohide Ageyama, Keiji Terao, Yasuhiro Yasutomi, Junichi Mineno, and Ikunoshin Kato. "In Vivo Safety and Persistence of Endoribonuclease Gene-Transduced CD4+ T Cells in Cynomolgus Macaques for HIV-1 Gene Therapy Model." <em>PLoS ONE</em> 6.8 (2011): e23585. Print. </br><br />
<br />
<br>GENETICALLY MODIFIED ORGANISMS (CONTROL OF RELEASE) ORDINANCE. Cap 607. L.N. 170 of 2010. 1 March 2011. <em>Hong Kong Legislature</em>. Print.</br><br />
<br />
<br>Kelly, Kimberly A., and David A. Jones. "Isolation of a Colon Tumor Specific Binding Peptide Using Phage Display Selection." <em>Neoplasia</em> 5.5 (2003): 437-444. Print.</br><br />
<br />
<br>Zara, Janette N., Ronald K. Siu, Benjamin M. Wu, Kang Ting, Chia Soo, Xinli Zhang, Jia Shen, Richard Ngo, Min Lee, Weiming Li, Michael Chiang, Jonguk Chung, and Jinny Kwak. "High Doses of Bone Morphogenetic Protein 2 Induce Structurally Abnormal Bone and Inflammation In Vivo." <em>Journal of Tissue Engineering</em> 17.9, 10 (2011): 1389-1399. Print.<br />
</p><br />
</div><br />
<br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph4{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph5{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph6{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#paragraph7{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements
Team:HKUST-Hong Kong/Medal Requirements
2012-09-26T19:14:11Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align="center"><font size="20">Medal Requirement</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1></h1><br />
</div><br />
<br />
<p align="center"><br />
<img src="https://static.igem.org/mediawiki/2012/8/8a/Medal_Requirement_iGEM_%28updated_version%29.jpg" width="100%" /><br />
</p><br />
<br />
<br />
<br />
<br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Calendar
Team:HKUST-Hong Kong/Calendar
2012-09-26T19:13:32Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<div><p align="center"><font size="20">Calendar</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1></h1><br />
</div><br />
<p><a href="https://static.igem.org/mediawiki/2012/e/e1/Human_Practice_Calendar.pdf">Can't see? Click here</a></p><br />
<div><embed width=945px height=500px src="https://static.igem.org/mediawiki/2012/e/e1/Human_Practice_Calendar.pdf"></div><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Presentation
Team:HKUST-Hong Kong/Presentation
2012-09-26T19:13:02Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
</div><br />
<div><p align="center"><font size="20">Presentation</font></p></div><br />
<br />
<div><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview"><<< Back to Human Practice Overview</a></p></div><br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1> Overview </h1><br />
</div><br />
<br />
<p><br />
The steady increase in wealth of East Asian nations during the past few decades has seen the population transition towards diets comprising more fats and less fibre. And there is general consensus among the scientific and medical community that such a diet leads to higher incidence of colorectal cancer. Public health bodies including the World Health Organization (WHO) and National Cancer Centre of Singapore (NCCS) therefore predict that current increasing trends in colorectal cancer will only continue.<br />
</p><br />
<p><br />
Hong Kong, being a region that started developing earlier, observed a 190% increase in the crude rate of colorectal cancer incidence between 1983 and 2006. (See <a href="http://onlinelibrary.wiley.com/doi/10.1111/j.1440-1746.2009.06130.x/pdf">this</a> document.) It is on track to overtake lung cancer soon as Hong Kong’s deadliest form of cancer.<br />
</p> <br />
<p><br />
Thus we decided that at least one of our human practice activities would have to involve interacting with the local cancer therapy community in a certain way.<br />
</p><br />
</div><br />
<br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="left"><br />
<h1> Introduction</h1><br />
</div><br />
<p>Our work this year on colorectal cancer happened to coincide with a large awareness effort by the <a href="http://www.cancer-fund.org/en/?m=1">Hong Kong Cancer Fund (HKCF)</a> on the same topic. It therefore made perfect sense for us to contact them with the intention of forming a collaboration.<br />
</p><br />
<p>The HKCF is an influential force in Hong Kong with interests in promoting awareness about cancer and providing psychotherapy for cancer patients. They also provide funding for cancer therapy-related research efforts. <br />
</p><br />
<p>We approached them in the hope of spreading word about synthetic biology and other topics on the forefront of life science and bioengineering, and in particular inform them on notable ways cancer treatment is being pushed forward. Introduction to the field of synthetic biology was very exciting for our HKCF contacts. We were soon invited to speak about the topic at the Fund’s Wong Tai Sin ‘CancerLink’ centre. <br />
</p><br />
<p>Our audience was aged within their 30s and 40s and were (mostly female) volunteer nurses and administrative staff who work closely with cancer patients in the process of recovery. Some directly administer psychotherapy to these patients. We were asked to assume little to no scientific knowledge which was to be an extremely important factor in our considerations. Countless iGEM teams in the past have had to deal with the problem of communicating synthetic biology in a straightforward way. We approached it by employing several (sometimes cute) analogies and providing a significant amount of time for Q&A.<br />
</p><br />
</div><br />
<br />
<div id="paragraph3" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Presentation Details</h1><br />
</div><br />
<br />
<p><br />
Five members of our team went to Wong Tai Sin on the 26th of July, three of whom gave the presentation proper. The presentation was divided into the four sections detailed below.<br />
</p><br />
<p><i>The iGEM Competition</i></br><br />
We started with an explanation of what our team is doing by introducing the competition and the aims defining it. Emphasis was placed on dissecting the competition name and delivering the concept of a ‘Genetically Engineered Machine’. A coffee machine analogy was used to explain a machine in terms of inputs and outputs and the statement was made that a living machine can be similarly summarized.<br />
</p> <br />
<p><i>Synthetic Biology</i><br /><br />
As the term ‘synthetic biology’ itself may be unfamiliar, we started with ‘genetic engineering’, a well-used term in the news and popular culture. To separate ‘old-style’ genetic engineering from that represented by synthetic biology, we explained that humans have achieved the ability to design living organisms indirectly, by designing the DNA placed in them. Three major steps in research and technology leading to synthetic biology as we know it today were reported: 1) determining the functions of genes, 2) recombinant DNA technology and 3) DNA synthesis. <br />
</p><br />
<p><i>Our Project & Colorectal Cancer</i><br /><br />
To provide an example of what synthetic biology solutions could do for cancer treatment, we introduced our project’s design in terms of a bacterial ‘soldier’. Like a soldier, our bacteria possesses bullets (the BMP2 chemokine), a gunsight (the cell wall expression recognition peptide) and training to prevent it from causing excess damage (the xylose-inducible promoter and toxin-antitoxin cassette). <br />
</p><br />
<p><i>Future of Cancer Treatment<br />
</i><br /><br />
Weaknesses of current cancer treatment methods (surgery, chemotherapy and radiotherapy) were highlighted. Aspects of treatment where synthetic biology could provide options were then discussed (drug discovery, targeting and drug delivery). The presentation was ended with reiteration that synthetic biology effectively amounts to engineering life. And thus is possessed of all the controversy and intrigue that statement implies. <br />
</p><br />
<br />
</div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Q&A Session</h1><br />
</div><p><br />
In truth we did not plan it as such, but the Q&A session ended up lasting almost as long as our presentation itself. All team members present went up on stage and we were able to engage the audience in further discussion on synthetic biology in a freer, more conversational manner. Perhaps most importantly our audience could now receive responses in their native language, Cantonese. In retrospect, we found that with all assembled members present we could provide a more organized and detailed explanation of synthetic biology than was achieved during the presentation itself. <br />
</p><br />
<p><br />
The Q&A session was also the time for providing even more examples which could impress upon our audience the scope of synthetic biology and bring the subject within familiar territory. The topic of facial cleansers with living ingredients, for instance, inspired greater interest. <br />
</p><br />
<br />
</div><br />
<br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Reflections</h1><br />
</div><br />
<br />
<p><i>Item 1</i></br ><br />
To convey the promise of synthetic biology a lot of information needs to be transferred. For iGEMers and others new to the field, think of how much further you had to take your previous knowledge to perform the tasks you do now. When educating younger students, professionals in other fields or anyone else to whom concepts of manipulating DNA is foreign, we must force ourselves back to the big picture and leave the technical details for later. Key points can be distilled down to: 1) living organisms are like machines/tools, 2) DNA defines function and 3) designing DNA leads to designing the functions of living organisms. <br />
</p><br />
<p><i>Item 2</i></br ><br />
Since synthetic biology is a wholly new concept, the participants of the synthetic biology educational activity you initiate will not have much to base their expectations of the activity on. In practice this means it is difficult to meet the personal interests of the audience because too few people understand synthetic biology well enough to be interested in it. We found on several occasions that for preliminary introduction to the topic, categorizing ‘synthetic biology’ as ‘genetic engineering’ helps considerably. ‘Genetic engineering’ is a term that came out earlier and is regularly used in mass-media. Most well-informed people recognize it and, more importantly, have some preconceptions as to what it is about. <br />
</p><br />
<p><i>Item 3</i></br ><br />
It is important to make synthetic biology relevant to your activity participants. This is done by giving examples of how the synthetic biology revolution can change some aspect of the status quo significant to them. If points like this are made you can expect your participants to remember them particularly well. These points also allow your participants to begin to grasp the breadth of the synthetic biology revolution. We made it clear to our audience that synthetic biology has significant potential in the field of cancer treatment. According to our post-presentation survey, that was the message they remembered the best. <br />
</p><br />
<p><i>Item 4</i></br ><br />
Lastly, remember that you can only do so much spreading the word of synthetic biology by yourselves. Make the primary aim of your educational activity to inspire your participants such that they continue to discuss the topic with others days after the activity. Inspire first and foremost by getting a clear and accurate message across. Should you be successful then the topic of synthetic biology will reach many more ears, and more minds will be put to work conceiving how the technology will develop. <br />
</p><br />
</div><br />
<div id="paragraph3" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Appendix</h1><br />
</div><br />
</br><br />
<div><br />
Follow <a href="https://static.igem.org/mediawiki/2012/9/91/HKUST_Hum._Prac.Preset_SURVEY.pdf" target="_blank">this link</a> to read our complete survey. <br />
</div><br />
<br />
</div><br />
<br />
<style type="text/css"><br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph4{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph5{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Interview
Team:HKUST-Hong Kong/Interview
2012-09-26T19:12:38Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<div><p align="center"><font size="20">Interview</font></p></div><br />
<br />
<div><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview"><<< Back to Human Practice Overview</a></p></div><br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Background</h1><br />
</div><br />
<p>Last year, HKUST iGEM team conducted a survey that is subjected to people&rsquo;s perception of synthetic biology and the key factors that influence people&rsquo;s impression about this technology. However, the result shows that people in Hong Kong do not have much understanding of synthetic biology and that people may have certain stereotype towards it. Because of this result, it is hard to draw anything constructive to help human civilization address the issue of biotechnology. Therefore, it is necessary to educate people about synthetic biology before the survey. Rather than public education – during which people may have only superficial understanding and not enough attentiveness to the topic, we decide to conduct several interviews. Owing to the flexibility of the interview, we can present the knowledge of synthetic biology to the interviewees and raise more questions related to his/her personal concerns.</p><br />
</div><br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Purpose of Our Interviews</h1><br />
</div><br />
<ol><br />
<li><u>To get a deep understanding of people&rsquo;s attitudes over synthetic biology.</u> Considering that if the questionnaire of the survey does not include any possible responses, the lack of knowledge of synthetic biology and individual difference may make the result of the survey less valuable, we intend to use the flexibility of the interview to overcome this issue and get deep understanding of people&rsquo;s attitudes. The flexibility of the interview mainly concerns with the fact that we can present information to the audience if necessary and make variations to our questions to get deeper insight.</li><br />
<li><u>To be a foundation for future interviews.</u> Since interview is a relatively less popular method in collecting people's responses towards synthetic biology in iGEM, references for this sort of approach are limited. Thus, we may encounter numerous obstacles and need to overcome them. Yet, after successfully conducting our interviews, we hope that our experience can be a foundation to propagate this innovative means. </li><br />
<li><u>To be a foundation for future surveys.</u> As stated above, our interviews can reach a deeper level of understanding of people&rsquo;s attitudes towards synthetic biology. Thus, we can collect abundant responses which reflect people&rsquo;s attitudes. This collection of responses may broaden the range of questions of the survey, which can eventually be comprehensive enough to reflect people&rsquo;s real attitudes.</li><br />
</ol><br />
</div><br />
<div id="paragraph3" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Methods</h1><br />
</div><br />
<ol><br />
<li><u>About the interviewee:</u> we found four interviewees in different fields that may have direct or indirect influence over the field of synthetic biology: one politician, one journalist, one university student and one secondary school student </li><br />
<li><u>About the questions in the interview:</u> there are two features about the questions we ask: (1) bi-directional: we not only ask questions and see their response, but also present some information about synthetic biology to them if they do not have a clear picture of it; (2) the questions for different individuals achieve a balance of consistency and inconsistency: we ask similar questions and follow a similar outline, but because of the individuals&rsquo; variations and their distinctive response, we prepare and even improvise distinctive questions for different individuals.</li><br />
</ol><br />
</div><br />
<div id="paragraph4" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Four Interviews</h1><br />
</div><br />
<ol><br />
<li><em>The Politician</em></li><br />
<p> The politician we interviewed – Mr. Shum – is a local community officer of the Democratic Party in Hong Kong. Before the interview, he had little knowledge in synthetic biology.<br /><br />
In order to let Mr. Shum prepare for the interview, we initially asked him about his perspectives on new technology in general. Upon hearing the question, he praised the convenience brought by the new technology to the society. Then we move stepwise towards synthetic biology by first mentioning his perspectives on Genetically Modified food. In order to get deeper insight, we offered him a virtual situation that a group of people complained to you that Genetically Modified food is unethical, because humans cannot play God, and asked for his response. And his attitude towards Genetically Modified food is that even if there may be some people claiming the play-God side of the issue, he believed that the inclination of the majority and the development of the society are the determinants. <br /><br />
Later, a brief introduction of synthetic biology and our project is presented to Mr. Shum, to which he did not evaluate synthetic biology by the distinctive concepts it has, but he emphasized its influence on the society and on people. Comprehending his focus of the issue, we provided him with several imaginary situations to ask for his response. For example, we asked him &ldquo;<em>The science world has its own criteria related to animal rights protection, but it may not be enough for some animal right advocates. If we conduct animal experiments for the synthetic bacteria we made, and some animal lovers protest these experiments, what will you do?&rdquo;</em> and &ldquo;<em>Suppose that after our medication bacteria have passed all the safety tests and animal experiments, some patients register for the human trial, but the result yields negative. If one of the patients complain to you and accuse synthetic biology, what will you do?&rdquo;</em> Mr. Shum gave us a deep insight into a local politician. He held the view that he would be a responsible listener for people&rsquo;s complaints, but the decision addressed on synthetic biology should be guided by the majority opinions of people. He said that he would not interfere with the development of synthetic biology by his personal views.</p><br />
<li><em>The Journalist</em></li><br />
<p> The journalist we interviewed – Ms. Leung – is a journalist for a local magazine in Hong Kong. She has heard synthetic biology, because of the nature of her work.<br /><br />
Since Ms. Leung has some ideas of synthetic biology, we directly adopt the approach to ask her how she knows it. She recalled two examples, which she learned during her work. Considering that her work is related to public education, we wondered whether media she was familiar with nowadays promoted synthetic biology. Her answer was that this kind of material was not the mainstream in media, but public still had some interests in learning it. Developed from this topic, a question was put forward whether public should know more about synthetic biology. Her response was positive, because she thought that understanding was crucial, especially for the collapse of false or misleading advertisement.<br /><br />
Later, we elucidated our project to Ms. Leung. To our surprise, her first response was not to evaluate our project, but to give us advice on how to propagate our project. She suggested us using brief and concise methods like animation to promote our project and synthetic biology. Afterwards, she expressed her personal perspectives of the relationship between synthetic biology and media. She said that the main problem for promoting it in Hong Kong was the lack of platforms. And the attractiveness of the propagation and the applicability to multitudes were also factors that affected this sort of propagation. She further illustrated that media were more open-minded to new science and technology because they learned more. However, problems still existed; immoral merchants might mislead people for profits, or normal people would exaggerate certain science or technology.<br /><br />
After hearing all the valuable perspectives Ms. Leung gave us, at the very last, we let her imagine the prospect of synthetic biology. She speculated that the future would be bright and the public actually wanted to learn about it. Nevertheless, controversies, say patent of the scientists, animal tests, ethical problems, might hinder its progress.</p><br />
<li><em>The University Student</em></li><br />
<p> The university student - Mr. Au – has just finished his freshman year in the university. He used to be interested in biology and life science. Yet, he was a little bit confused about the definition of synthetic biology.<br /><br />
Like the case for the politician, we initiate the interview by asking him about his attitudes towards technology and some general questions related to technology, to which he acknowledged the significance of technology and he shared with us some thoughts over the public knowledge level of technology in Hong Kong and his peers&rsquo; interests in technology.<br /><br />
After this warm-up, Mr. Au was asked his perspectives on genetic engineering, which is topic he learned in high school. While he expressed his astonishment towards the fanciness of this technology, he still found it was frightening. His concerns mainly based on the knowledge he learned in high school. Mr. Au expressed that gene modification may introduce uncertainties in the eco-system. Due to this uncertainty, he thought that it could be a potential threat. <br /><br />
Completing the questions about genetic engineering, we went on to explain the exact definition and concepts of synthetic biology to him, and asked his immediate thoughts upon this technology. He expressed his fear that the technology may go extreme and can be dangerous. Then, the facts of the pros and cons of synthetic biology were given to him. He acknowledged that with this technology human beings can do more things with less resources. However, he regarded the eco-system and biological experiments so complicated that it was easy to go wrong and that a little mistake could lead to great risks. In order to evaluate the levels of fears he had in synthetic biology, we asked him to compare the widespread of synthetic biology with the widespread of computer technology. He stated that even if computers were infected by computer virus, it could be shut down, but for human beings, irreversible things could happen.<br /><br />
At the very last, we explain our project to him, and asked for his perspectives on animal tests. Mr. Au personally disliked this kind of test, but he would not object it because without it, human beings need to take the risks.</p><br />
<li><em>The Secondary School Student</em></li><br />
<p> The secondary school student we interviewed – Mr. Siu – has just finished his year 1 in his high school. In school, biology, chemistry and physics are his choices of his electives. Despite his interests in science, he still has not learned too much about science subjects.<br /><br />
Similar to other three interviews, we started our conversation by asking him some general questions about technology, such as &ldquo;do you welcome the latest technology&rdquo;, &ldquo;will you talk about technologies with your friends&rdquo; etc. We found that he would embrace the latest technology, but he still acknowledged the dual nature of it. As for his daily conversation with his friends, he suggested that he hardly talk about it, because he and his friend had little knowledge in this area.<br /><br />
Then we asked him about genetic engineering and genetically modified food. Mr. Siu had not heard of these two, but he speculated that this technology might be related to Dolly, the cloned sheep. From this kind of answer, we guessed that Mr. Siu tried to use his knowledge to evaluate certain things, but due to his current level of education, some links were not established properly. Later, we asked whether he thought genetic engineering is good or not. He initially said that it can raise the productivity of the society, so it is good, but later, after we introduced certain worries about this technology, he hesitated a little and expressed his concerns too. However, in general, he thought that everything has a dual nature, and proper assessment and regulation from the government are crucial, but the trend for the development of technology would not be hindered. <br /><br />
Apart from the genetic engineering, we presented to him the definition of synthetic biology. His perspective was simple, that it was quite amazing to design organisms, even like animals, but quite strange too. Later, we introduced the potential values of synthetic biology to him, like designing an organism with a wider range of capabilities, and also some possible risks, like uncertainties in the eco-system. His personal view was that everything should be tested and confirmed first. Although it could be convenient and progressive, he said, technologies with lives could affect us directly and might cause big troubles. Nevertheless, at last, he still thought this technology is good. At the end of our interviews, we explained our project details to him, and asked for his comments. He simply said that animal tests should be taken seriously, and that the safety of the new treatment should be confirmed.</p></ol><br />
</div><br />
<br />
<div id="paragraph5" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Achievement and Future Work</h1><br />
</div><br />
<p> First and foremost, <u>we do get a deeper understanding of our interviewee&rsquo;s understanding of synthetic biology. And we understand that various people have various focuses on the issues of synthetic biology</u>. From the four interviews we mentioned in the preceding section, we can appreciate that the <strong>flexibility </strong>of the interview helps us to give more specific and deep insight into people&rsquo;s attitudes. For example, in the politician case, after comprehending that he emphasized more on the social aspect of this technology, we used imaginary situations to ask for his viewpoints. As for the journalist, our questions not only include those consistent questions asked to every interviewee, but also cover some personal perspectives of the relationship between media and synthetic biology. It can be noted that in the interview, besides the consistent questions we should ask, some additional questions can be improvised during the interview, based on the responses of the interviewees. This improvisation will help us get a deeper insight into people&rsquo;s opinions.<br /><br />
Our four interviews, in addition, <u>provide a foundation for future interviews, and we hope that the range and number of the interviewees can be widened in the future.</u> From the four interviews mentioned above, we notice that the consistency of the supposed consistent questions is not strong enough. Like any psychological experiments, it is easy to have deviations for all the observers. Not to mention in an interview like ours, the interviewee should have certain leading roles to give us deeper insight. Thus, if any future iGEM team is going to expand this new means of human practice, logistically, we suggest that intensive training is necessary for all the interviewers. And we hope that our suggestion and experience can lay a solid foundation for propagating our interviews.<br /><br />
At the very last, <u>due to the keen insight gained via the interviews, the range and number of the questions which can be asked in a survey are enlarged, laying a firm basis for future survey design.</u> Concerning the problems we faced in our last year survey, it is inevitable that the survey designer may not take all the possible thoughts people may have into consideration. And it is hard to both collect data and get genuine responses if we use too many open-end questions. Since our interviews enlighten us with various perspectives people can have, and an interviewee can hardly be careless during an interview, we can collect more insightful opinions from people and use them to design the questionnaire in future surveys.</p><br />
</div><br />
<div style="clear:both"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/IAppendix1"><font size="3">***Interview Appendix I: The Record of our Interviews***</font></a></p></div><br />
<div><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/IAppendix2"><font size="3">***Interview Appendix II: Future Interview***</font></a></p></div><br />
<style type="text/css"><br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph4{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph5{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Achievement
Team:HKUST-Hong Kong/Achievement
2012-09-26T19:12:07Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<div><p align="center"><font size="20">Achievement</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1></h1><br />
</div><br />
<p>Our iGEM journey has spanned the length of six months; from the day our project was first proposed in mid-March to the day we ended wet lab work in mid-September. <br /><br />
We are proud to say that within our three months of wet lab work we have achieved the following:</p><br />
<ol><br />
<li>Successfully constructed the parts for displaying recognition peptide, RPMrel, on the cell wall of <i>Bacillus subtilis</i> (<a href="http://partsregistry.org/Part:BBa_K733007" target="_blank">BBa_K733007</a>).</li><br />
<li>Successfully constructed two parts for BMP2 synthesis and excretion using signaling peptides YbdN and YdjM respectively (<a href="http://partsregistry.org/Part:BBa_K733016" target="_blank">BBa_K733016</a>, <a href="http://partsregistry.org/Part:BBa_K733017" target="_blank">BBa_K733017</a>).</li><br />
<li>Successfully constructed a cell growth inhibition device for regulating BMP2 production (<a href="http://partsregistry.org/Part:BBa_K733012" target="_blank">BBa_K733012</a>).</li><br />
<li>Successfully characterized the low efficiency promoter Ptms which was used to drive the expression of antitoxin YdcD (<a href="http://partsregistry.org/Part:BBa_K733009" target="_blank">BBa_K733009</a>, <a href="http://partsregistry.org/Part:BBa_K733018" target="_blank">BBa_K733018</a>).</li><br />
<li>Successfully characterized a xylose-inducible promoter that was used to control the expression of BMP2 and toxin YdcE.</li><br />
<li>Successfully characterized the cell growth inhibition device.</li><br />
</ol><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Notebook
Team:HKUST-Hong Kong/Notebook
2012-09-26T19:11:43Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<div><p align="center"><font size="20">Notebook</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Click to see our Logbook</a></h1><br />
</div><br />
<p></p><br />
</div><br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Click to see our Protocol</a></h1><br />
</div><br />
<p></p><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device
Team:HKUST-Hong Kong/Parts and Device
2012-09-26T19:08:25Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align="center"><font size="20">Parts and Devices</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>Overview</p></h1><br />
</div><br />
<p>The HKUST iGEM 2012 team has submitted 18 BioBricks in total. Please click <b><a href="https://static.igem.org/mediawiki/2012/7/73/Parts_and_Device.pdf" target="_blank">here</a></b> for our <b>full list</b> of BioBricks.</br><br />
<br />
<br>For the Target Binding module, two BioBricks were built to display the colon tumor recognition peptide, RPMrel, on the cell wall of <i>B. subtilis</i>. In the Anti-tumor Molecule Secretion module, two BioBricks were built for BMP2 synthesis and secretion while the other five were built to facilitate the accomplishment of BMP2 synthesis. 11 BioBricks were built for the Regulation and Control module. They are mainly used to drive the toxin-antitoxin system, which controls the expression of BMP2. Our submitted BioBricks, sorted by <b>modules</b>, are shown in <b><a href="https://static.igem.org/mediawiki/2012/e/ee/Sorted_by_Module.pdf" target="_blank"> this page</a></b>.<br><br />
<br />
<br>Among all 18 parts, three of them have been well characterized. They are <u><a href="http://partsregistry.org/Part:BBa_K733009">BBa_K733009</a></u>, a GFP generator driven by <i>Ptms</i> promoter; <u><a href="http://partsregistry.org/Part:BBa_K733018" target="_blank">BBa_K733018</a></u>, a GFP generator driven by xylose inducible promoter and <u><a href="http://partsregistry.org/Part:BBa_K733012" target="_blank">BBa_K733012</a></u>, the cell growth inhibition device. For detailed <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">characterization data</a> please refer to the information of these three BioBricks or our Characterization sections on the wiki.<br><br />
<br />
<br>For the convenience of other parties in using and searching for BioBricks, we have also sorted our BioBricks based on their <b>types</b>. For detailed information please access <b><a target="_blank" href="https://static.igem.org/mediawiki/2012/d/d0/Sorted_by_Type.pdf">this link</a></b>.<br><br />
<br />
<br><b><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction" target="_blank">Construction >>></a></b><br />
<p><b><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly" target="_blank">Assembly >>></a></b></p><br />
<br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis
Team:HKUST-Hong Kong/Design Chassis
2012-09-26T19:07:37Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<div><p align="center"><font size="20">Design - Chassis</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1></h1><br />
</div><br />
<p>We chose <i>Bacillus subtilis</i> - a model Gram-positive bacterial species often used in laboratory study - as our chassis. It is ideal as a base for designing mechanisms to fulfill our project aims for reasons we mention below.<br><br />
<br />
<br><b>Safety.</b><br />
<p>The safety issues concerning synthetic biology are numerous, particularly when it comes to the area of medical treatment. To reduce the chance of recombinant bacteria causing harm, synthetic biologists try to develop and utilize solutions that minimize the potential hazards of their products. Regarding safety issues, we the HKUST iGEM 2012 team chose to use <i>B. subtilis</i>, a non-pathogenic chassis.<br><br />
<br />
<br><b>Low degree of virulence.</b><br />
<p>As a natural member of the human gut microbiome, <i>B. subtilis</i> is considered to be non-pathogenic to humans. There are very few cases of humans being infected by <i>B. subtilis</i>, and of those who have been infected the vast majority had severe immune deficiency. According to Edberg (Edberg 1991), <i>B. subtilis</i> does not produce significant quantities of extracellular enzymes or possess other virulence factors that would predispose it to cause infection. In other word, <i>B. subtilis</i> possesses low virulence to humans and has a low risk of adverse effects to human health. <br><br />
<br />
<br><b>Establishment of integration vectors.</b><br />
<p>The discovery of natural integration in <i>B. subtilis</i> raised great attention in the field of molecular genetics in 1978. A series of integration vectors for <i>B. subtilis</i> were designed later for different purposes. For our project we employed an integration vector not only for its stability in <i>B. subtilis</i>, but also its advantages in safety. The employment of the integration vector to some extent minimizes the risk of antibiotic resistance spreading within the normal flora in gut. In addition, since the exposure of BMP2 to normal tissues can induce adverse effects, integrating target genes into the genome can reduce the chance of spreading the <i>Bmp2</i> gene through horizontal gene transfer and avoid non-specific drug release in gut.<br><br />
<br />
<br><b>Protein secretion.</b><br />
<p>Compared with <i>E. coli</i>, another commonly used chassis in iGEM, <i>B. subtilis</i> is preferred because of its reliability in secreting proteins directly to the extracellular environment. As a Gram-positive eubacteria, <i>B. subtilis</i> lacks an outer membrane, featuring only a 10-50nm peptidoglycan layer beyond its the plasma membrane. Since we are aiming for bacterial secretion of BMP2 out into the digestive tract in the vicinity of colon cancer cells, this property suits our purposes well.<br><br />
<br />
<br><b>Peptide display.</b><br />
<p>Without an outer membrane, <i>B. subtilis</i> is ideal for displaying items on its surface. The cell wall of <i>B. subtilis</i> is the surface of the bacterium and contains approximately 9% of the total protein in the cell. The discovery and study of cell wall binding devices produced from cell wall bound proteins provides an attractive tool for surface display of peptide (Pooley et al. 1996). Aiming to display the tumor-binding peptide, RPMrel, on bacteria surface, we decided to take advantage of the cell wall display system, LytC, in <i>B. subtilis</i>. Thus, the ease of peptide display serves as one of our reasons to choose <i>B. subtilis</i> as our chassis. <br><br />
<br />
<br><b>Part of gut commensal flora.</b><br />
<p><i>B. subtilis</i> does not only exist widely in nature, but also contributes to part of the normal flora in the gut (Collin and Gibson 1999). Regarded as a probiotic, it has been proved to have positive effects on patients suffering from functional abdominal bloating (Corazza et al. 1992). Using <i>B. subtilis</i> as our chassis will in theory mean we will not be introducing any exotic species into the gut. <br><br />
<br />
<br><b>References.</b><br><br />
<p>Collins M. D. and Gibson G. R.. 1999. Probiotics, prebiotics and synbiotics: Approaches for modulating the microbial ecology of the gut. <i>Am. J. Clin. Nutr.</i> 69:1052S–1057S
<br />
<br />
<p>Corazza G.R., Benati G., Strocchi A., Sorge M. & Gasbarrini G.. 1992. Treatment with <i>Bacillus subtilis</i> reduces intestinal hydrogen production in patients with gaseous symptoms. <i>Current therapeutic research</i>. 52.1: 144-151<br />
<br />
<p>Edberg, S.C.. 1991. US EPA human health assessment: <i>Bacillus subtilis</i>. Unpublished, U.S. Environmental Protection Agency, Washington, D.C.
<br />
<br />
<p>Pooley H. M., Merchante R. and Karamata D.. 1996. Overall protein content and induced enzyme components of the periplasm of <i>Bacillus subtilis</i>. <i>Microb. Drug Resist</i>.2:9–15.
</p><br />
<br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Module
Team:HKUST-Hong Kong/Module
2012-09-26T19:07:00Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<div><p align="center"><font size="20">MODULE</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p align=center>Target Binding Module</p></h1><br />
</div><br />
<p>Our decision to pursue colorectal carcinoma suppression arose from two key points obtained from preliminary research: 1) bone morphogenetic protein 2 (BMP-2) suppresses the growth of colon cancer cell growth <i>in vivo</i>, and 2) the phage display peptide RPMrel confers specific and preferential binding to non-differentiated colon cancer cells......<a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Click to see more</a></p><br />
</div><br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p align=center>Anti-tumor Molecule Secretion Module</p></h1><br />
</div><br />
<p>As our team objective is to provide a specific and efficient drug for Colon cancer, the way of drug synthesis and releasing is a significant part of our whole project. Hence this module is focusing on the production and delivery of anti-tumor drug......<a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">click to see more</a></p><br />
</div><br />
<div id="paragraph3" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p align=center>Regulation and Control Module</p></h1><br />
</div><br />
<p>Our module aims at regulating our synthetic bacteria B. hercules. We first introduce a xylose inducible promoter, which can help us control the timing of BMP-2 expression. Our choice of xylose as an inducer stems from its induction efficiency, its little existence and low absorption rate in colon......<a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">click here to see more</a></p><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Module
Team:HKUST-Hong Kong/Module
2012-09-26T19:05:24Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:80px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/b/b0/UCL-Igem.png');<br />
background-size:70px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
</style><br />
</head><br />
<br />
<body><br />
<div id="Navigation_top"><br />
<div id="iGEM_Logo" class="Upper_Logos"></div><br />
<div id="HKUST_Logo" class="Upper_Logos"></div><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Project Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project">Project Description</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Background and<br> Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module">Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Chassis">Chassis</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Expectation">Expectation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Potential_Application">Potential applicaiton</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Device</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Prospect">Prospect</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Site_Map">Site Map</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Photo_Gallery">Photo Gallery</a></p></div><br />
</div><br />
</div><br />
<div><p align="center"><font size="20">MODULE</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p align=center>Target Binding Module</p></h1><br />
</div><br />
<p>Our decision to pursue colorectal carcinoma suppression arose from two key points obtained from preliminary research: 1) bone morphogenetic protein 2 (BMP-2) suppresses the growth of colon cancer cell growth <i>in vivo</i>, and 2) the phage display peptide RPMrel confers specific and preferential binding to non-differentiated colon cancer cells......<a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Click to see more</a></p><br />
</div><br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p align=center>Anti-tumor Molecule Secretion Module</p></h1><br />
</div><br />
<p>As our team objective is to provide a specific and efficient drug for Colon cancer, the way of drug synthesis and releasing is a significant part of our whole project. Hence this module is focusing on the production and delivery of anti-tumor drug......<a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">click to see more</a></p><br />
</div><br />
<div id="paragraph3" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p align=center>Regulation and Control Module</p></h1><br />
</div><br />
<p>Our module aims at regulating our synthetic bacteria B. hercules. We first introduce a xylose inducible promoter, which can help us control the timing of BMP-2 expression. Our choice of xylose as an inducer stems from its induction efficiency, its little existence and low absorption rate in colon......<a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">click here to see more</a></p><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding
Team:HKUST-Hong Kong/Module/Target binding
2012-09-26T19:05:05Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align="center"><font size="20">Target Binding Module</font></p></div><br />
<div><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module"><<< Back to Modules</a></p></div><br />
<br />
<br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/1/18/Cwbd.JPG" width="50%" /></p><br />
<br><br />
<br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>Overview</p></h1><br />
</div><br />
<br />
<p>Our decision to pursue colorectal carcinoma suppression arose from two key points obtained from preliminary research: 1) bone morphogenetic protein 2 (BMP2) suppresses the growth of colon cancer cell growth <em>in vivo</em>, and 2) the phage display peptide RPMrel confers specific and preferential binding to non-differentiated colon cancer cells. </p><br />
<br />
<p>With these two pieces of knowledge we had respectively: 1) our carcinoma suppression drug, and 2) a tool for specifically targeting cancerous cells. Thus the objective of this module was to identify and then construct a suitable mechanism making use of the RPMrel peptide to make the delivery of BMP2 targeted. </p><br />
<br />
</div><br />
<br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>Design</p></h1><br />
</div><br />
<br />
<p><b>Considering limitations.</b></p><br />
<br />
<p>Design of a solution starts with considering existing limitations. Since this is iGEM, the clearest limitation was that the solution must be a biological one and thus must involve a living component. Only a certain set of living organisms lie within our reasonable capacity to engineer them, and of these we decided on <i>Bacillus subtilis</i> (see <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Chassis</a> page).</p><br />
<br />
<p>We then examined the treatment environment. Carcinomas of the colon protrude into the digestive tract and items within the tract can interact with them directly. We decided on the concept that our biological system would be ingested, then produce and release the drug in the vicinity of the tumor for direct action.</p><br />
<br />
<p>As a ligand in the Transforming Growth Factor β (TGF-β) signalling pathway, BMP2 had to be expressed in mature form to have any effect. It was thus decided that it would be synthesized within our chassis and then released into the external environment by secretion. Since the polypeptide sequence and conformation of BMP2 must be preserved, it was decided to bring the drug to the vicinity of the carcinoma by conferring the binding ability of RPMrel to the chassis as a whole.</p><br />
<br />
<p>To do this, RPMrel had to be expressed on the cell surface in a functional form. We conducted research into several methods to do this on <i>B. subtilis</i> and concluded that cell wall expression of the peptide was ideal. Imperial College London’s 2010 team had performed that same task using the cell wall binding domain of the hydrolase lytC as their peptide anchor and a helical linker of their design. We decided to employ that same system for surface expression of RPMrel. <br><br />
<br />
<br><b>RPMrel, and colon tumor specific binding.</b></p><br />
<br />
<p>Using phage display to compile peptide libraries that confer specific binding to certain antigens is a now common way to come up with useful peptides. RPMrel, a 9 amino acid disulfide-constrained peptide, was screened out of the New England Biolabs <a href="http://www.neb.com/nebecomm/products/producte8100.asp">Ph.D.-C7C library</a> for positive binding to poorly differentiated HT-29 cells, and negative binding to well differentiated HCT 116 cells. All peptides in the Ph.D.-C7C library have random sequences of 7 amino acids bounded by cystines at the N- and C- terminals. Further screening of the peptides was done by performing 6 successive incubation-wash-elution cycles against HT-29. See <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1550331/pdf/neo0505_0437.pdf">Kelly &amp; Jones (2003)</a>. &lsquo;RPM&rsquo; - for an arginine-proline-methionine amino acid sequence immediately before the C-terminal cystine - emerged as a consensus motif for late selection of high-affinity peptides, thus giving the peptide&rsquo;s name. RPMrel&rsquo;s full amino acid sequence is n-CPIEDRPMC-c.<br />
<br />
<p>The binding properties of RPMrel were identified during Kelly &amp; Jones&rsquo; study when it was fused to the surface-exposed p3 minor coat protein of the bacteriophage M13KE. This module will lead to its novel fusion to the cell wall binding domain of lytC, exposing it to the extracellular environment. <br><br />
<br />
<br><strong>LytC, and its cell wall binding domain.</strong></p><br />
<br />
<p>LytC, a cell surface hydrolase, is native to <em>B. subtilis</em> and binds non-covalently to its cell wall interacting with it electrostatically. This property was previously determined to make it superior for exposure of bound peptides. Furthermore, as compared to other surface expression methods we investigated (including peptide expression on an engineered S-layer), the lytC model was much better studied. </p><br />
<br />
<p>According to the study conducted by <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC262103/pdf/0628.pdf">Yamamoto et al (2003)</a> LytC is localized uniformly on <em>B. subtilis</em> cells grown past log phase, making it more ideal than the more specifically localized LytE and LytF for expression of RPMrel. It was further found that - compared to the others - LytC was particularly resistant to degradation by the cell surface protease WprA and extracellular protease Epr, both producing in <em>B. subtilis </em>. In this study, 3xFLAG (a <a href="http://www.sigmaaldrich.com/life-science/proteomics/recombinant-protein-expression/purification-detection/flag-system.html">standard peptide epitope</a> designed by Sigma-Aldrich Corp.) was successfully fused to the protein via a short linker and was successfully exposed to specific antibodies.</p><br />
<br />
<p>The full sequence of <em>lytC</em> gene is 1488bp, but its cell wall binding domain was isolated by Imperial College London&rsquo;s 2010 team as the region encoded by the first 954bp. This means the natural function of LytC - cell wall turnover and autolysis for cell growth and separation - is removed from the recombinant protein we will use. </p><br />
<br />
</div><br />
<br />
<div id="paragraph3" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>Parts Assembly</p></h1><br />
</div><br />
<br />
<p><strong>A GFP reporter.</strong></p><br />
<br />
<p>Preliminary work of generating a reporter expression construct was done first. This reporter construct was produced by PCR amplification of the sequence encoding for green fluorescence protein (GFP) and double terminator from <a href="http://partsregistry.org/Part:BBa_E0840">BBa_E0840</a> with the simultaneous attachment of the <em>B. subtilis </em>consensus RBS embedded within the forward primer. </p><br />
<br />
<p>The product of this reaction was thus [consensus RBS + GFP + double terminator] and was inserted into pSB1C3 for future use. When this GFP reporter is expressed at the same time as RPMrel fused to the lytC cell wall binding domain, the engineered bacteria will resolve in green under UV illumination. </p><br />
<br />
<p><strong>Amplification of BBa_K316037.</strong></p><br />
<br />
<p>Exploratory work began by taking the submitted constructed <a href="http://partsregistry.org/Part:BBa_K316037">BBa_K316037</a> as the starting point. BBa_K316037, originally submitted by Imperial College London&rsquo;s 2010 team, contains the following regions in order: [Pveg promoter, spoVG RBS, cell wall binding domain of lytC, helical linker, elastase cleavage site, auto-inducing peptide and his tag]. The regions we wanted include the part from Pveg promoter to helical linker only.</p><br />
<br />
<p>RPMrel - a 9 amino acid peptide - can be synthesized <em>de novo</em> by PCR by embedding within a primer. We chose to codon-optimize the amino acid sequence for expression in <em>B. subtilis</em> and embed the resultant 27 nucleotide sequence in the design of a reverse primer. This reverse primer was then used in a PCR reaction that amplified [<i>Pveg</i> + spoVG + <i>lytC</i> + linker] from BBa_K316037 and simultaneously attached the sequence of RPMrel to the end of the linker. </p><br />
<br />
<p>Design of that reverse primer is detailed as follows.<br />
<br />
<p>5' - [8bp cap] [7bp SpeI restriction site] [6bp reverse-complementary double stop codon] [27bp reverse-complementary sequence of codon optimized RPMrel] [15bp reverse-complementary overlap with linker] - 3'</p><br />
<br />
<p>The exact sequence is as follows.<br />
5&rsquo; - GTTTCTTCACTAGTATTATTAACACATCGGGCGATCTTCGATCGGACAGGCCGCGGCTTTCGC - 3&rsquo; (63bp)</p><br />
<br />
<p><strong>Assembly of PCR products.</strong></p><br />
<br />
<p>The product of this PCR reaction in linear form comprised [<i>Pveg</i> + spoVG + <i>lytC</i> + linker + RPMrel]. Standard assembly methods were then used to join it in front of the aforementioned [consensus RBS + GFP + double terminator] construct in pSB1C3. Following this step, the construct used in this module now comprised [<i>Pveg</i> + spoVG + <i>lytC</i> + linker + RPMrel + consensus RBS + GFP + double terminator], and it was submitted to the Registry after successful assembly (see <a href="http://partsregistry.org/Part:BBa_K733007">BBa_K733007</a>). </p><br />
<br />
<p>Further cloning work was done to put this key construct of the module into pDG1661, an integration vector for <em>B. subtilis</em> which was its final destination for characterization. For more details about pDG1661, see <a href="http://www.bgsc.org/catpart4.pdf">this document</a> produced by the Bacillus Genetic Stock Center (BGSC). </p><br />
<br />
</div><br />
<br />
<div id="paragraph4" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p>Testing (Characterization & Results)</p></h1><br />
</div><br />
<br />
<p>Expression of BBa_K733007 is supposed to be involved in the production of two gene products: 1) the <i>lytC</i> + RPMrel fusion protein localized to the cell wall, and 2) green fluorescence protein. <em>B. subtilis </em>cells transformed. As a result, the construct is expected to exhibit the binding affinity for HT-29 cells as well as the green fluorescence under UV illumination. </p><br />
<br />
<p>The module is to be tested by washing fixed and stained HT-29 colorectal cancer cells with <em>B. subtilis </em>168 transformed with the construct contained in <a href="http://partsregistry.org/Part:BBa_K733007">BBa_K733007</a> in mammalian cell media. Following successive washes with phosphate buffered saline (PBS), the fixed cells will be imaged by fluorescence microscopy at a magnification resolving the HT-29 cells. </p><br />
<br />
<p>The same process will be conducted using <em>B. subtilis</em>168 cells transformed with only GFP in the same plasmid backbone as the negative control. By comparing the relative localization of fluorescence between the two images, the effect of the <i>lytC</i> + RPMrel fusion protein on the recombinant bacteria&rsquo;s binding ability can be visualized. </p><br />
</div><br />
<br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<br />
<style type="text/css"><br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph4{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control
Team:HKUST-Hong Kong/Module/Regulation and control
2012-09-26T19:04:24Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align="center"><font size="20">Regulation and Control Module</font></p></div><br />
<div><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module"><<< Back to Module</a></p></div><br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1></h1><br />
</div><br />
<p><strong>Overview:</strong><br /><br />
We first introduce a xylose inducible promoter, which can help us control the timing of anti-tumor drug, BMP2 expression and secretion. Our choice of xylose as an inducer stems from its induction efficiency, its little existence and low absorption rate in colon.<a href="#_ftn1" name="_ftnref1" title="" id="_ftnref1"> </a>(Yuasa <i>et al.</i>, 1997) Besides the timing regulation, we introduce a cell growth inhibition device to prevent the overexpression of BMP2. This device is achieved by a balance between a toxin and antitoxin pair, YdcE and YdcD. By these two regulation systems, our B. hercules can have more reliable and controllable performance.</p><br />
<p><strong>Objective:</strong></p><br />
<ol><br />
<li>To regulate the expression of BMP2 by a xylose inducible promoter. (Timing regulation)</li><br />
<li>To control the overexpression of BMP2. (Dosage regulation)</li><br />
</ol><br />
<p><strong>Our Module in B. hercules:</strong></p><br />
<ol><br />
<li><em>The inducible promoter. <a href="http://partsregistry.org/Part:BBa_K733002">BBa_K733002</a></em></li><br />
<p>In the consideration of our B. hercules, one of our concerns is that our bacteria may secrete BMP2 before its binding to colon cancer cells. As a growth factor, although BMP2 triggers the apoptosis of colon cancer cell, it can also stimulate the proliferation of normal epithelial cells in digestive tract. <a href="#_ftn2" name="_ftnref2" title="" id="_ftnref2"> </a>(Zhang <i>et al.</i>, 2012) Thus, we intend to introduce a regulatory timing system into our <em>B. hercules</em> by incorporating an inducible promoter into our device.<br /><br /><br />
Admittedly, there are many different induction systems in <em>Bacillus subtilis</em>. However, to achieve the induction when our B. hercules is inside human colon, two conditions needed to take into consideration: first, the inducer should not normally exists <em>in vivo</em>, but can be created in human colon; secondly, the inducer should not vitiate the healthy state of the individual. Besides, though high efficiency of the induction is not strictly required, it will still be considerably helpful if could be achieved.<br /><br /><br />
With those concerns in mind, xylose comes up to our mind to be the inducer for our B. hercules. Xylose, as the main building block for hemicellulose, can only be found in plants. Largely absorbed in jejunum before reaching colon, xylose is not present in colon.(Yuasa <i>et al.</i>, 1997) Besides, the absorption rate of xylose in colon is low indicated by Yuasa. Thus, well scheduled diet and medication can prevent the interaction of xylose and B. hercules in intestine, and induction can therefore be achieved by xylose delivered in enteric capsule or from anus.<br /><br /><br />
Besides its rare existence in the human colon, xylose is an efficient inducer as for PxylA promoter. When ligated with gene <em>bgaB</em>, 200-fold induction was achieved 30 minutes after the induction of xylose.<a href="#_ftn3" name="_ftnref3" title="" id="_ftnref3"> </a> (Kim <i>et al</i>. 1996)<br /><br /><br />
</p><br />
<br />
<li><em>The Cell Growth Inhibition Device. <a href="http://partsregistry.org/Part:BBa_K733012">BBa_K733012</a></em></li></em></li><br />
<p>Considering the problems caused by the unexpected proliferation of normal colon cells induced by over-dose BMP2, a regulatory system is necessary for the dosage control of BMP2 expression.(Zhang <i>et al.</i>, 2012)<br /><br /><br />
In order to build this controlling system, we came up with a cell growth inhibition device to manage this task. Understanding that toxin-antitoxin operons exist abundantly in bacteria, we intend to link the expression of BMP2 with a toxin gene. However, the only existence of the toxin gene is not enough. Stabilization, to a certain extent, is necessary, so that our B. hercules will not die after a low level of BMP2 expression. And this short-term stabilization could be achieved by introducing the corresponding anti-toxin gene of the previous toxin gene. <br /><br /><br />
In order to practically implement the ideas above, a toxin-antitoxin pair – ydcE and ydcD – is used. <i>ydcE</i> can encode an endoribonuclease – EndoA, which can cause cell growth inhibition, regarding as "toxin" in this case. On the other hand, <i>ydcD</i> can encode YdcD (EndoAI), counteracting the effect of EndoA, treating as "anti-toxin" then. <a href="#_ftn4" name="_ftnref4" title="" id="_ftnref4"> </a>(Pellegrini, O. et al. 2005) By linking <i>ydcE</i> immediately after <i>Bmp2</i> gene, and put <i>ydcD</i> after <i>Ptms</i> promoter, a relatively low efficient constitutive promoter, EndoA can be expressed simultaneously with the expression of BMP2 under the control of xylose inducible promoter, and cell growth inhibition will not occur until the produced EndoA outweighs the effect of accumulated YdcD (EndoAI).</p></ol><br />
<br />
<p align="center"><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/d/dd/CGIDfunction2..jpg" width="99%" /><br />
<img src="https://static.igem.org/mediawiki/2012/7/74/CGIDFunction.jpg" width="80%" /><br />
<br />
</p><br />
<br />
<div><br><br><br />
<p>Reference:</p><br />
<div id="ftn1"><br />
<a href="#_ftnref1" name="_ftn1" title="" id="_ftn1"> </a> Yuasa, H., Kuno, C., &amp; Watanabe, J. (1997). Comparative assessment of D-xylose absorption between small intestine and large intestine..&nbsp;<em>The journal of pharmacy and pharmocology</em>,<em>49</em>, 26-29. </div><br />
<div id="ftn2"><br />
<p><a href="#_ftnref2" name="_ftn2" title="" id="_ftn2"> </a> Zhang J, Ge Y, Sun L, Cao J, Wu Q, Guo L, Wang Z. Effect of Bone Morphogenetic Protein-2 on Proliferation and Apoptosis of Gastric Cancer Cells.&nbsp;<em>Int J Med Sci</em>&nbsp;2012; 9(2):184-192. </p><br />
</div><br />
<div id="ftn3"><br />
<p><a href="#_ftnref3" name="_ftn3" title="" id="_ftn3"> </a> Kim, L., Mogk, A., &amp; Schumann, W. (1996). A xylose-inducible <i>Bacillus subtilis</i> integration vector and its application.&nbsp;<em>Gene</em>,&nbsp;<em>181</em>(1-2), 71-76. </p><br />
</div><br />
<div id="ftn4"><br />
<p><a href="#_ftnref4" name="_ftn4" title="" id="_ftn4"> </a> Pellegrini, O., Mathy, N., Gogos, A., Shapiro, L., &amp; Condon, C. (2005). The <i>Bacillus subtilis</i> ydcDE operon encodes an endoribonuclease of the MazFPemK family and its inhibitor.<em>Molecular Microbiology</em>,&nbsp;<em>56</em>(5), 1139-1148. </p><br />
</div><br />
</div><br />
</div><br />
<br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor
Team:HKUST-Hong Kong/Module/Anti tumor
2012-09-26T19:03:29Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align = "center"><font size="20">ANTI-TUMOR MOLECULE SECRETION</font></p></div><br />
<br />
<div><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module"><<< Back to Module</a></p></div><br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1></h1><br />
</div><br />
<p>As our team objective is to provide a specific and efficient drug delivery for colon cancer, ivestigating and designing the way of drug synthesis and releasing is a significant part of our whole project. Hence this module is focusing on the production and delivery of anti-tumor drug. Synthesis of the drug is achieved by engineered bacteria able to produce and secrete the anti-tumor chemicals. Releasing of the anti-tumor chemicals to extracellular environment is completed by secretion of recombinant gene product under the facilitation of signaling peptide. </p><br><br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/c4/Bmp2_1.JPG" width="60%" /></p><br />
<br><br />
<p>Among hundreds of studied anti-tumor chemokine, BMP2, bone morphogenetic protein 2 has caught our attention as the &ldquo;drug&rdquo; for our project. BMP2 is a signaling molecule in BMP pathway, which belongs to the TGF-β superfamily. One function of BMP pathway is to induce cell differentiation, especially in the development of bone and cartilage. BMP stimulates the formation of bone by inducing the cell differentiation of bone cells. On the other hand, BMP2 has also been suggested to have high apoptotic activity towards colon cancer cells (Beck <em>et al.,</em> 2005). According to Beck <em>et al.</em>, colon cancer cells which are treated with 100 ng/mL BMP-2 for 48 hours show significant decrease in cell growth. Knowing this fact, we see the potency of BMP2 as the drug to cure colon cancer. Therefore, we incorporate mature BMP2 gene in our construct and transform it into our chosen bacterial vector. </p><br><p>Furthermore, choice of chassis also has important role to ensure the secretion of BMP2. <em>B. subtilis,</em> which is a probiotic, is chosen as the chassis because of its harmless activity towards human, and high secretory activity which is important for the delivery of BMP2 to the environment. To activate the secretory activity of our synthesized BMP2 in <em>B. subtilis</em>, we add signaling peptide type I gene, which works mostly through <em>B. subtilis'</em> secretory pathway, at the upstream of <i>Bmp2</i> gene in our construct (Tjalsma <em>et al, </em>2000). In this way, signaling peptide would be translated together with BMP2 as a whole peptide, and delivered to the cell membrane. Once it reaches cell membrane, BMP2 is separated from signaling peptide by signal peptidase (Spase). BMP2 is then transferred outside the cell and fold into its native conformation, while the signal peptide is degraded by signal peptide peptidase (SPPases) (Tjalsma <em>et al, </em>2000). </p><br><br />
<br />
<p align="center"> <img src="https://static.igem.org/mediawiki/2012/c/c4/Bmp2_2.JPG" width="50%" /></p><br><br />
<p>However, among hundreds of signaling peptides, we need to choose the signaling peptide that allows the secretion of correct mature BMP2 in appropriate amounts. Therefore, we choose YbdN, which is the signaling peptide of the highest efficiency in <em>B. subtilis</em> and YdjM, the signaling peptide which supports accurate cleavage from Spase. It would be hard for us just to make the decision just based on the literature, so we chose to construct the two constructs consisting of <i>ydjM</i> or <i>ybdN</i> gene at the upstream of <i>Bmp2</i> gene and characterize both signaling peptide before making the final choice. </p><br />
<br />
<p>Although researchers have shown mature BMP2 can be produced in <em>E. coli</em> (Yuvaraj et al, 2012), no one has repoorted to make a recombinant protein BMP2 successfully in <em>B. subtilis</em>. Also, for the characterization of our work, other than checking whether we successfully produced the recombinant protein, we need to further confirm the function of BMP2 produced by our engineered bacteria.</p><br><br />
<p>&nbsp;</p><br />
<p>References <br /><br />
Beck, S. E., Jung, B. H., Fiorino, A., Gomez, J., Del Rosario, E., Cabrera, B. L., Huang, S. C., Chow, J. Y. C., &amp; Carethers J.M. (2006). Bone morphogenetic protein signaling and growth suppression in colon cancer.&nbsp;<em>The American Journal of Physiology-Gastrointestinal and Liver Physiology</em>,&nbsp;<em>291</em>(1), G135-G145.</p><br />
<p>Ernesto, C. (2000). &ldquo;Skeletal Growth Factors&rdquo;. LIPPINCOTT WILLIAMS&amp;WILKINS.</p><br />
<p>Hardwick,J.C., Van Den Brink,G.R., Bleuming,S.A., Ballester,I., Van Den<br /><br />
Brande,J.M., Keller,J.J., Offerhaus,G.J., Van Deventer,S.J., Peppelenbosch,M.P., 2004.<br /><br />
Bone morphogenetic protein 2 is expressed by, and acts upon, mature epithelial cells in<br /><br />
the colon. Gastroenterology 2004. Jan. ;126. (1):111. -21. 126, 111-121. </p><br />
<p>Saravanan Yuvaraj, Sa&rsquo;ad H. Al-Lahham, Rajesh Somasundaram, Patrick A. Figaroa, Maikel P. Peppelenbosch, and Nicolaas A. Bos, <em>E. coli</em>-Produced BMP-2 as a Chemopreventive Strategy for Colon Cancer: A Proof-of-Concept Study.&nbsp;<em>Gastroenterology Research and Practice</em>, vol. 2012, Article ID 895462, 6 pages, 2012. doi:10.1155/2012/895462</p><br />
<p>Tjalsma, H., Bolhuis, A., Jongbloed, J. D. H., Bron, S., &amp; Dijl, J. M. V. (2000). Signal peptide-dependent protein transport in <i>bacillus subtilis</i>: a genome-based survey of the secretome.&nbsp;<em>Microbiology and Molecular Biology Reviews</em>,&nbsp;<em>64</em>(3), 515-547.</p><br />
</div><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction
Team:HKUST-Hong Kong/Project Abstraction
2012-09-26T19:02:55Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<div><p align="center"><font size="20">Project Abstract</font></p></div><br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p align=center>Project name: B. hercules <br>---<i style="size:15px">The Terminator of Colon Cancer</i></p></h1><br />
</div><br />
<p>The possible adverse effects of dispersing toxic anti-tumor agents in the circulatory system during conventional cancer treatment prompt us to consider the need of an alternative cancer therapeutic method. In an effort to combat colorectal carcinoma, we aim to use genetically modified <i>Bacillus subtilis</i> to execute targeted drug delivery to cancer cells in the lower digestive tract, offering the advantage of generating minimal negative effects on normal colon epithelial cells. Targeting is achieved by anchoring a colon tumor-specific binding peptide, RPMrel, onto the cell wall of <i>Bacillus subtilis</i> using a LytC cell wall binding system. Upon successful binding, the anti-tumor cytokine bone morphogenetic protein 2 (BMP2), can be synthesized and secreted from the bacterial cells with the help of a signalling peptide fused to the protein. Minimization of the harmful effect of BMP2 overdose is made possible by introducing two regulatory systems: xylose-inducible system and <i>ydcE/ydcD</i> toxin-antitoxin system, which serve to control the timing and amount of BMP2 release. </p><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Members
Team:HKUST-Hong Kong/Members
2012-09-26T19:02:18Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align="center"><font size="20">Members</font></p></div><br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>SUN Fei (Sara)</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/e/e7/Sara_HKUST_NEW.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><p>My name is Sun Fei but many of my colleagues usually refer to me as Sara. I am currently a year 2 biology student. For me, iGEM is just like a canvas for painter. It is a place where great ideas can be sketched on and further colorized. It is the place where beauty of accident and finding come together. It is the place where I can use my hands to create my world.</p></div><br />
</div><br />
<div id="paragraph2" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>Sean CARIM</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/0/09/Sean.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><p>Life fascinates me. So as an opportunity to do work related to controlling and engineering life, iGEM was too strong a temptation to resist. I feel fortunate to be working alongside a group of dedicated students who share my interests. As a year 2 Biology major I consider the technical aspects of iGEM a refreshing chance to observe science and engineering operating in parallel. I also appreciate it as a rigorous team activity allowing us to improve our understanding both on what it is to be human as well as the dynamics of the bacteria we manipulate. Over the past months I have joined my sub-group members in building our cell wall expression construct and have conducted interviews in accordance with our human practices plans.</p></div><br />
</div><br />
<div id="paragraph3" class="bodyParagraphs"><br />
<div align="right"><br />
<h1>CHAN Yak Nok (Cola)</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/e/ea/Cola.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><p>My name is Chan Yat Nok Cola, a year 2 student who is majoring in biochemistry. For me, synthetic biology is an amazing field full of possibilities, mysteries and creativity. It always gives us lots of surprises and inspirations and not to mention the sense of achievement. Thanks to iGEM for providing a chance to work along with group of people who have one goal, and as a platform to learn with pain and fun. iGEM is really “beautiful” in nature.</p></div><br />
</div><br />
<div id="paragraph4" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>Ka Chun MOK</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/8/8a/Mokka.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><p>I am Ka Chun Mok, a year 2 student studying Molecular Biomedical Sciences in HKUST along with my iGEM teammates. In retrospect, I am attracted by the fancy world of biology when I was a high school student. During that time, GM food research was standing in the front line of the scientific field. I was inspired by the magic of synthetic biology that can make many new strains of organisms, which is beneficial for the whole community. After I joined HKUST, I finally have the chance to taste the beauty of synthetic biology by joining then iGEM competition. Frankly speaking, doing iGEM is not just being a part of a competition but enjoying the process of doing synthetic biology. Thanks to that, I am glad to be involved in such a meaningful activity.</p></div><br />
</div><br />
<div id="paragraph5" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>SHI Tianxing</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/b/b9/Shi_tianxin.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><br />
<p>I am Shi Tianxing, a year 2 biology student in HKUST. I have always been looking forward to understand more about life science, especially with a group of biology lovers. That’s why I am here in iGEM team to help carry out the whole project. Our sub-group has been working on the recognition and binding of <i> B. subtilis </i> to colon cancer cells throughout the months, and I have been deeply involved in the building of our sub-group’s constructs from the first day. I appreciate that iGEM provides us, science beginners, a great opportunity to explore the world of genetic engineering and to share our experience with our friends, family, and other members of society all over the world.</p></div><br />
</div><br />
<div id="paragraph6" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>Carson LAM</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/1/1b/Lam_Ka_Shing.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><br />
<p>Carson is currently a year 2 student studying under the Molecular Biomedical Sciences program. He participated as a member of the Cell Wall Binding System wet lab sub-group.</p></div><br />
</div><br />
<div id="paragraph7" class="bodyParagraphs"><br />
<div align="right"><br />
<h1>LAI Ka On (Sapphire)</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/f/f9/Sapphire.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><br />
<p>Sapphire is currently a year 2 student pursuing a Biochemistry major. She participated as a member of the Cell Wall Binding System wet lab sub-group.</p></div><br />
</div><br />
<div id="paragraph8" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>YU Lai Cheong (Chris)</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/d/dd/Chris.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><br />
<p>I am Yu Lai Cheong. My major is Molecular Biomedical Sciences. I am a year 2 student. Thanks to iGEM, it gave me the opportunity to organize things, do research and deal with problem.</p></div><br />
</div><br />
<div id="paragraph9" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Chelsilia TANZIL</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/8/87/Chelsi_new.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><p>My name is Chelsi, currently in my second year in HKUST studying biochemistry. Joining iGEM as a freshman has given me lots of experiences and knowledge, which I will not be able to get in any class. Throughout the summer I worked with Protein Synthesis group to work on constructs which can secrete BMP-2, helped with characterization of pTms and responsible for the completion of 2012 HKUST iGEM Poster.</p></div><br />
</div><br />
<div id="paragraph10" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>Christopher LEE</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/7/7c/Christopher_HKUST.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><br />
<p>I am Christopher Lee. I study Molecular Biomedical Sciences, and currently a year 2 student. I would like to join iGEM because it is a golden opportunity for me to decide which experiments to conduct on which particular purpose. It helps me to think carefully and to learn how to convince others with the results obtained. How to think is much more important than how to do. It is easy to know how to do since there are lots of protocols. But iGEM provides me with an opportunity to learn how to think and how to design experiments so that the results of our experiments can convince others. That is a critical skill for all scientists. Mainly I am responsible for protein characterization.</p></div><br />
</div><br />
<div id="paragraph11" class="bodyParagraphs"><br />
<div align="right"><br />
<h1>Ilona Christy UNARTA</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/5/56/Ilona.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><br />
<p>I am a future Chemist, who is currently a year 2 student. Joining iGEM team does not only teach me about what synthetic biology is, but also how powerful synthetic biology can be. Through iGEM, I learnt that synthetic biology could be used in many different ways to solve a lot of world problems, just like our project, which focuses on targeting colon cancer drug. In the HKUST iGEM team, I worked along with protein synthesis group’s members to construct the plasmid consisting of signaling peptide of <i> B. subtilis </i> and BMP-2 (anti-tumor chemokine) gene. I am also helping in the poster design team.</p></div><br />
</div><br />
<div id="paragraph12" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>LI Yiming (Eric)</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/b/b3/Eric_hkust.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><br />
<p>My name is Li Yiming. I am currently a second year biochemistry student. I wish to earn the experience in lab work and enjoy the teamwork when doing iGEM. In this project, I collaborated with my teammates to get <i> B. subtilis </i> synthesize and secrete out the protein BMP-2. Although we came across many unexpected problems, we carried on together. We felt no regret about spending all our efforts in lab, which will be the most wonderful memories in our life.</p></div><br />
</div><br />
<div id="paragraph13" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>WANG Yuqi</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/4/42/Cosmos_hkust.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><br />
<p>I am Wang Yuqi but in English speaking community like HKUST, they usually call me Cosmos. As a freshman of biochemistry in the university, I have to swallow a bunch of new information this summer. However, iGEM is about teamwork, and the whole HKUST iGEM team creates a cheerful atmosphere. It allows me along with other members to learn, grow and shine together.</p></div><br />
</div><br />
<div id="paragraph14" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>GU Bida</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/7/78/Gu_Bida.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><br />
<p>My name is Bida Gu, currently a second year student in Division of Life Science, HKUST. Starting as a freshman, I have benefited greatly from our iGEM team. What I learned was not only lab techniques but also skills of management and communication. During the past several months, I have helped to build one promoter and characterize two promoters for our team. I hope that in the future I will be able to contribute more to the HKUST iGEM team so that more students will be able to appreciate the beauty of synthetic biology.</p></div><br />
</div><br />
<div id="paragraph15" class="bodyParagraphs"><br />
<div align="right"><br />
<h1>QI Yi</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/1/17/Qi_Yi.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><br />
<p>My name is Qi Yi. I am a biochemistry majoring student, who is currently in the second year of my study. I joined iGEM to learn how to do research and biological lab work. Throughout the summer I helped my teammates to work on RBS+GFP+Terminator construct, including the characterization procedures with cell death group</p></div><br />
</div><br />
<div id="paragraph16" class="bodyParagraphs"><br />
<div align="center"><br />
<h1>YU Xiaoying (Susie)</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/b/b5/Yu.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><br />
<p>I am Yu Xiaoying, a year 1 Biochemistry student. My colleagues usually call me Susie. I was an iGEM Asia Jamboree helper last year. The two-day competition was exciting. I listened to several presentations and got the chance to communicate with other teams’ members. I was attracted by iGEM and decided to participate in it. The whole process is tough but fun. I learned a lot through the months of lab work and human practice work. It was the first time that I spent day by day in the lab, planned and carried out some experiment. As an iGEMer you may have the same experience---after weeks of failure, a construct was finally made out and confirmed work. For me that is the most fascinating part of iGEM, of science. I was working on RBS+GFP+terminator construct, promoters-- pVeg, pTms, pXyl, operon contains ydcD/ydcE and human practice part. I really enjoy working with my team and best wishes for our team in 2012 iGEM competition! </p></div><br />
</div><br />
<div id="paragraph17" class="bodyParagraphs"><br />
<div align="left"><br />
<h1>Leon LEE</h1><br />
</div><div style="float:left;background-image:url('https://static.igem.org/mediawiki/2012/6/68/Leon_Lee.jpg'); height:200px;width:200px;"></div><br />
<div style="float:right;width:720px;"><br />
<p>My name is Leon Lee, a second year Electronic Engineering student. Well, sometimes I feel like a freak in the team. After all, what is an Electronic student messing up around with a bunch of biologist? Well, the reason is that they need someone to write their Wiki page. Programming has always been one of my interests, and it is a great pleasure for me to design our Wiki page. </p></div><br />
</div><br />
<style type="text/css"><br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph2{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph3{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph4{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph5{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph6{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph7{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph8{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph9{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph10{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph11{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph12{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph13{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph14{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph15{<br />
background-color:#FFFFDD;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #FFFFA1;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph16{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
#paragraph17{<br />
background-color:#FFEDFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #FFA1FF;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Introduction
Team:HKUST-Hong Kong/Introduction
2012-09-26T19:01:19Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<div><p align="center"><font size="20">Introduction</font></p></div><br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1><p align=center>The Hong Kong University of Science and Technology <br> 2012 iGEM Team</p></h1><br />
</div><br />
<p>The HKUST iGEM 2012 team consists of 21 dedicated undergraduate students forming a large family. This year, our team aims to complete an ambitious plan comprising three key components. We divided our team into three wet lab sub-groups to build constructs for each component.</p><br />
<p> </p><br />
<p> Our <strong><u>Cell Wall Binding System</u></strong> sub-group is working toward allowing our biological system to bind with colon cancer cells. Our <strong><u>Protein Synthesis</u></strong> sub-group is focusing on the production and secretion of the anti-tumor chemokine BMP-2. Lastly, our <strong><u>Cell Growth Inhibition</u></strong> sub-group is developing constructs to control the anti-tumor activities of the biological system, specifically the timing and dosage of the chemokine's release. These three sub-groups&rsquo; work, when combined, results in formation of a microorganism targeted drug delivery system.<br />
<br />
<p> </p><br />
<br />
<p> In addition to the wet lab groups, we also have members who work specifically on our <strong><u>Wiki Page</u></strong>, <strong><u>T-shirt</u></strong>, <strong><u>Mascot</u></strong> and <strong><u>Poster</u></strong>.</p><br />
<br />
<p> </p><br />
<br />
<div align = "center"><br />
<img src="https://static.igem.org/mediawiki/2012/8/81/HKUST2012Team.jpg" width="90%" /><br />
</div><br />
</div><br />
<br />
<br />
<style type="text/css"><br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Instructor
Team:HKUST-Hong Kong/Instructor
2012-09-26T19:00:08Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align="center"><font size="20">Instructor</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="center"><br />
</div><br />
<div style="float:left;width:700px;"><p><strong>Dr. Jessica Ce Mun Tang</strong><br /><br />
Division of Life Science, Hong Kong University of Science and Technology<br /><br />
<br /><br />
This is the third year that I have been an instructor for the HKUST iGEM team. It is really great that students from different disciplines can work together as a team. I hope that they have learnt a lot and have made lots of new friends through this. Good luck to the iGEM HKUST team 2012! </p></div><img src="https://static.igem.org/mediawiki/2010/9/91/HKUST_Jessica.jpg" style="float:right;margin-right:20px;"><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor
Team:HKUST-Hong Kong/Supervisor
2012-09-26T18:55:45Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<div><p align="center"><font size="20">Supervisor</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
</div><br />
<p><strong>Dr. King L. CHOW</strong><br /><br />
Professor, Division of Life Science, Hong Kong University of Science and Technology<strong> </strong></p><br />
<div style="width:810px; float:left;"><p>King L. Chow, Professor of Life Science at the Hong Kong University of Science and Technology, earned his PhD in Cell Biology from the Baylor College of Medicine. After spending some years as a Belfer Fellow in the Molecular Genetics Department at the Albert Einstein College of Medicine, he returned to Hong Kong to assume an Assistant Professorship at HKUST. Dr. Chow now concurrently holds the positions of Professor of Life Science, Associate Director of the Bioengineering Program, Director of the Molecular Biomedical Sciences Program and Associate Dean of Students. Dr. Chow’s research work spans a broad spectrum of biological sciences including molecular genetics, genomics, neural developmental biology, the evolution of behavior and synthetic biology.</p></div><img src="http://life-sci.ust.hk/images/faculty/Kinglau_Chow_L.jpg" style="float:right;margin-right:20px;"><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home" align="center"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor
Team:HKUST-Hong Kong/Supervisor
2012-09-26T18:55:06Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<div><p align="center"><font size="20">Supervisor</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
</div><br />
<p><strong>Dr. King L. CHOW</strong><br /><br />
Professor, Division of Life Science, Hong Kong University of Science and Technology<strong> </strong></p><br />
<div style="width:810px; float:left;"><p>King L. Chow, Professor of Life Science at the Hong Kong University of Science and Technology, earned his PhD in Cell Biology from the Baylor College of Medicine. After spending some years as a Belfer Fellow in the Molecular Genetics Department at the Albert Einstein College of Medicine, he returned to Hong Kong to assume an Assistant Professorship at HKUST. Dr. Chow now concurrently holds the positions of Professor of Life Science, Associate Director of the Bioengineering Program, Director of the Molecular Biomedical Sciences Program and Associate Dean of Students. Dr. Chow’s research work spans a broad spectrum of biological sciences including molecular genetics, genomics, neural developmental biology, the evolution of behavior and synthetic biology.</p></div><img src="http://life-sci.ust.hk/images/faculty/Kinglau_Chow_L.jpg" style="float:right;margin-right:20px;"><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor
Team:HKUST-Hong Kong/Supervisor
2012-09-26T18:53:34Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<div><p align="center"><font size="20">Supervisor</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
</div><br />
<p><strong>Dr. King L. CHOW</strong><br /><br />
Professor, Division of Life Science, Hong Kong University of Science and Technology<strong> </strong></p><br />
<div style="width:810px; float:left;"><p>King L. Chow, Professor of Life Science at the Hong Kong University of Science and Technology, earned his PhD in Cell Biology from the Baylor College of Medicine. After spending some years as a Belfer Fellow in the Molecular Genetics Department at the Albert Einstein College of Medicine, he returned to Hong Kong to assume an Assistant Professorship at HKUST. Dr. Chow now concurrently holds the positions of Professor of Life Science, Associate Director of the Bioengineering Program, Director of the Molecular Biomedical Sciences Program and Associate Dean of Students. Dr. Chow’s research work spans a broad spectrum of biological sciences including molecular genetics, genomics, neural developmental biology, the evolution of behavior and synthetic biology.</p></div><img src="http://life-sci.ust.hk/images/faculty/Kinglau_Chow_L.jpg" style="float:right;margin-right:20px;"><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:173px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor
Team:HKUST-Hong Kong/Supervisor
2012-09-26T18:53:25Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<div><p align="center"><font size="20">Supervisor</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
</div><br />
<p><strong>Dr. King L. CHOW</strong><br /><br />
Professor, Division of Life Science, Hong Kong University of Science and Technology<strong> </strong></p><br />
<div style="width:810px; float:left;"><p>King L. Chow, Professor of Life Science at the Hong Kong University of Science and Technology, earned his PhD in Cell Biology from the Baylor College of Medicine. After spending some years as a Belfer Fellow in the Molecular Genetics Department at the Albert Einstein College of Medicine, he returned to Hong Kong to assume an Assistant Professorship at HKUST. Dr. Chow now concurrently holds the positions of Professor of Life Science, Associate Director of the Bioengineering Program, Director of the Molecular Biomedical Sciences Program and Associate Dean of Students. Dr. Chow’s research work spans a broad spectrum of biological sciences including molecular genetics, genomics, neural developmental biology, the evolution of behavior and synthetic biology.</p></div><img src="http://life-sci.ust.hk/images/faculty/Kinglau_Chow_L.jpg" style="float:right;margin-right:20px;"><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:172px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor
Team:HKUST-Hong Kong/Supervisor
2012-09-26T18:53:12Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<div><p align="center"><font size="20">Supervisor</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
</div><br />
<p><strong>Dr. King L. CHOW</strong><br /><br />
Professor, Division of Life Science, Hong Kong University of Science and Technology<strong> </strong></p><br />
<div style="width:810px; float:left;"><p>King L. Chow, Professor of Life Science at the Hong Kong University of Science and Technology, earned his PhD in Cell Biology from the Baylor College of Medicine. After spending some years as a Belfer Fellow in the Molecular Genetics Department at the Albert Einstein College of Medicine, he returned to Hong Kong to assume an Assistant Professorship at HKUST. Dr. Chow now concurrently holds the positions of Professor of Life Science, Associate Director of the Bioengineering Program, Director of the Molecular Biomedical Sciences Program and Associate Dean of Students. Dr. Chow’s research work spans a broad spectrum of biological sciences including molecular genetics, genomics, neural developmental biology, the evolution of behavior and synthetic biology.</p></div><img src="http://life-sci.ust.hk/images/faculty/Kinglau_Chow_L.jpg" style="float:right;margin-right:20px;"><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:170px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
#Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor
Team:HKUST-Hong Kong/Supervisor
2012-09-26T18:52:45Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<div><p align="center"><font size="20">Supervisor</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
</div><br />
<p><strong>Dr. King L. CHOW</strong><br /><br />
Professor, Division of Life Science, Hong Kong University of Science and Technology<strong> </strong></p><br />
<div style="width:810px; float:left;"><p>King L. Chow, Professor of Life Science at the Hong Kong University of Science and Technology, earned his PhD in Cell Biology from the Baylor College of Medicine. After spending some years as a Belfer Fellow in the Molecular Genetics Department at the Albert Einstein College of Medicine, he returned to Hong Kong to assume an Assistant Professorship at HKUST. Dr. Chow now concurrently holds the positions of Professor of Life Science, Associate Director of the Bioengineering Program, Director of the Molecular Biomedical Sciences Program and Associate Dean of Students. Dr. Chow’s research work spans a broad spectrum of biological sciences including molecular genetics, genomics, neural developmental biology, the evolution of behavior and synthetic biology.</p></div><img src="http://life-sci.ust.hk/images/faculty/Kinglau_Chow_L.jpg" style="float:right;margin-right:20px;"><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div id="Sitemap_Home"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:170px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Home{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:940px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor
Team:HKUST-Hong Kong/Supervisor
2012-09-26T18:49:59Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<div><p align="center"><font size="20">Supervisor</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
</div><br />
<p><strong>Dr. King L. CHOW</strong><br /><br />
Professor, Division of Life Science, Hong Kong University of Science and Technology<strong> </strong></p><br />
<div style="width:810px; float:left;"><p>King L. Chow, Professor of Life Science at the Hong Kong University of Science and Technology, earned his PhD in Cell Biology from the Baylor College of Medicine. After spending some years as a Belfer Fellow in the Molecular Genetics Department at the Albert Einstein College of Medicine, he returned to Hong Kong to assume an Assistant Professorship at HKUST. Dr. Chow now concurrently holds the positions of Professor of Life Science, Associate Director of the Bioengineering Program, Director of the Molecular Biomedical Sciences Program and Associate Dean of Students. Dr. Chow’s research work spans a broad spectrum of biological sciences including molecular genetics, genomics, neural developmental biology, the evolution of behavior and synthetic biology.</p></div><img src="http://life-sci.ust.hk/images/faculty/Kinglau_Chow_L.jpg" style="float:right;margin-right:20px;"><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div class="Sitemap_Content"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Assembly</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>-- <a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:145px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor
Team:HKUST-Hong Kong/Supervisor
2012-09-26T18:48:13Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<div><p align="center"><font size="20">Supervisor</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
</div><br />
<p><strong>Dr. King L. CHOW</strong><br /><br />
Professor, Division of Life Science, Hong Kong University of Science and Technology<strong> </strong></p><br />
<div style="width:810px; float:left;"><p>King L. Chow, Professor of Life Science at the Hong Kong University of Science and Technology, earned his PhD in Cell Biology from the Baylor College of Medicine. After spending some years as a Belfer Fellow in the Molecular Genetics Department at the Albert Einstein College of Medicine, he returned to Hong Kong to assume an Assistant Professorship at HKUST. Dr. Chow now concurrently holds the positions of Professor of Life Science, Associate Director of the Bioengineering Program, Director of the Molecular Biomedical Sciences Program and Associate Dean of Students. Dr. Chow’s research work spans a broad spectrum of biological sciences including molecular genetics, genomics, neural developmental biology, the evolution of behavior and synthetic biology.</p></div><img src="http://life-sci.ust.hk/images/faculty/Kinglau_Chow_L.jpg" style="float:right;margin-right:20px;"><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div class="Sitemap_Content"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Construction">Construction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Assembly">Overview</a></p></li></ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<p>--<a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Logbook">Logbook</a></p><br />
<p>--<a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook/Protocol">Protocol</a></p><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:145px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Advisors
Team:HKUST-Hong Kong/Advisors
2012-09-26T18:35:09Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align="center"><font size="20">Advisors</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1></h1><br />
</div><br />
<br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/9/9a/Vege_new.jpg"><p style="clear:both"> Ms. CAI Wenxuan (Vege)</p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/9/9d/Kelly_new.jpg"><p style="clear:both"> Ms. Terrenz KELLY </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/2/20/Candy_new.jpg"><p style="clear:both"> Ms. TANG Jing (Candy) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/0/09/Wu_Clare.jpg"><p style="clear:both"> Ms. WU Yunmin (Claire) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/b/ba/Xu_Jiajing.jpg"><p style="clear:both"> Ms. XU Jiajing (Shirley) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/a/aa/Xu_Wendy_new.jpg"><p style="clear:both"> Ms. XU Kaichun (Wendy) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/3/3f/Joice_Zhang.jpg"><p style="clear:both"> Ms. ZHANG Junyi (Joyce) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/2/29/Deng_Yisong.jpg"><p style="clear:both"> Mr. DENG Yisong (Steven) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/3/35/Trevor_new.jpg"><p style="clear:both"> Mr. HO Yuan Heng (Trevor) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/c/c2/Hanson_new.jpg"><p style="clear:both"> Mr. JIANG Hanlun (Hanson) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/9/9f/Nathanial.jpg"><p style="clear:both"> Mr. Nathaniel LIM </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/8/80/Ted_new.jpg"><p style="clear:both"> Mr. SHEK Chin Hong (Ted) </p></div><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div class="Sitemap_Content"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:145px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/File:Hanson_new.jpg
File:Hanson new.jpg
2012-09-26T18:34:49Z
<p>Dynastywarrior: </p>
<hr />
<div></div>
Dynastywarrior
http://2012.igem.org/Team:HKUST-Hong_Kong/Advisors
Team:HKUST-Hong Kong/Advisors
2012-09-26T18:33:40Z
<p>Dynastywarrior: </p>
<hr />
<div><html><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<br />
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script><br />
<br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('#Team').mouseover(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Team').mouseleave(function(){<br />
$('#Team').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Project').mouseover(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Project').mouseleave(function(){<br />
$('#Project').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Human_practice').mouseover(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Human_practice').mouseleave(function(){<br />
$('#Human_practice').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Wet_lab').mouseover(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Wet_lab').mouseleave(function(){<br />
$('#Wet_lab').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Extras').mouseover(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"10px 10px 10px #222222", top:"-5px", left:"-5px"},100);<br />
});<br />
$('#Extras').mouseleave(function(){<br />
$('#Extras').stop(true,false).animate({boxShadow:"0px 0px 0px #222222", top:"0px", left:"0px"},100);<br />
});<br />
$('#Team').click(function(){<br />
$('#Team_Content').slideToggle("slow");<br />
});<br />
$('#Project').click(function(){<br />
$('#Project_Content').slideToggle("slow");<br />
});<br />
$('#Wet_lab').click(function(){<br />
$('#Wet_lab_Content').slideToggle("slow");<br />
});<br />
$('#Human_practice').click(function(){<br />
$('#Human_practice_Content').slideToggle("slow");<br />
});<br />
$('#Extras').click(function(){<br />
$('#Extras_Content').slideToggle("slow");<br />
});<br />
$('#menubar').mouseover(function(){<br />
$('#menubar').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar').mouseleave(function(){<br />
$('#menubar').stop().animate({top:"-40px"},500);<br />
});<br />
$('#menubar.right-menu').mouseover(function(){<br />
$('#menubar.right-menu').stop().animate({top:"0px"},500);<br />
});<br />
$('#menubar.right-menu').mouseleave(function(){<br />
$('#menubar.right-menu').stop().animate({top:"-40px"},500);<br />
});<br />
$('#News_Click').click(function(){<br />
$('#News_Content').slideToggle("slow");<br />
});<br />
});<br />
<br />
</script><br />
<br />
<title>Team:HKUST-Hong Kong - 2012.igem.org</title><br />
<br />
<style type="text/css"><br />
<br />
.firstHeading {<br />
height:0px;<br />
visibility:hidden;<br />
}<br />
#content {<br />
border-left-width:1px;<br />
border-right-width:1px;<br />
width:965px;<br />
}<br />
#top-section { <br />
background-position: center center; <br />
background-repeat: no-repeat; <br />
background-color: #92d2ff;<br />
border-width:0px;<br />
height:0;<br />
}<br />
#siteSub {<br />
display:none;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
#search-controls {<br />
margin-top:14px;<br />
}<br />
#menubar { <br />
background-color: #000000;<br />
top: -4px;<br />
width: 488px;<br />
height:40px;<br />
position:absolute;<br />
top:-40px;<br />
border-bottom:3px solid #FF8A00;<br />
}<br />
<br />
#menubar ul li a { <br />
color: #007da6;<br />
}<br />
<br />
#menubar.right-menu{<br />
positon:relative;<br />
}<br />
<br />
.right-menu li a { <br />
color: #007da6; <br />
background-color: #000000;<br />
}<br />
<br />
#search-controls{<br />
display:none;<br />
}<br />
<br />
#Notebook_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#FFDDFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#Modeling_Content{<br />
width:200px;<br />
margin-left:10px;<br />
margin-right:10px;<br />
background-color:#DDFFFF;<br />
display:none;<br />
height:auto;<br />
}<br />
<br />
#topHeader{<br />
width:965px;<br />
height:320px;<br />
}<br />
<br />
.firstHeading{<br />
width:950px;<br />
alignment-adjust:right;<br />
visibility:hidden;<br />
display:none;<br />
}<br />
<br />
#contentSub{<br />
display:none;<br />
}<br />
<br />
#globalWrapper{<br />
background-color:#999;<br />
}<br />
<br />
#content {<br />
background-color: #FFF;<br />
border-left-color:#FFF;<br />
border-right-color:#FFF;<br />
}<br />
<br />
<br />
#Navigation_top{<br />
padding-top:20px;<br />
width:971px;<br />
height:auto;<br />
background-color: #FFBB55;<br />
float:left;<br />
border-left:3px solid #FF8A00;<br />
border-right:3px solid #FF8A00;<br />
border-bottom:3px solid #FF8A00;<br />
position:relative;<br />
background-image:url('http://www.anders.bennehag.com/wp-content/uploads/2009/02/hkust2.jpg');<br />
top:-20px;<br />
left:-6px;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons{<br />
width:168px;<br />
height:50px;<br />
margin:10px;<br />
position:relative;<br />
float:left;<br />
background-color:#333333;<br />
opacity:0.6;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Buttons#Team{<br />
clear:both;<br />
}<br />
<br />
.Navigation_Buttons h3 p{<br />
color:#FFFFFF;<br />
}<br />
<br />
div.Navigation_Content{<br />
width:950px;<br />
height:auto;<br />
margin:7px;<br />
display:none;<br />
float:left;<br />
opacity:0.6;<br />
background-color:#555555;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
.Navigation_Content#Home_Content{<br />
position:inherit;<br />
}<br />
<br />
.Content_Buttons{<br />
width:164px;<br />
height:50px;<br />
margin:10px;<br />
background-color:#000000;<br />
padding-top:20px;<br />
opacity:1.0;<br />
position:relative;<br />
text-align:center;<br />
vertical-align:middle;<br />
float:left;<br />
border:3px solid #FFFFFF;<br />
border-radius:7px;<br />
-moz-border-radius:7px;<br />
}<br />
<br />
.Content_Buttons p a{<br />
color:#33DDFF;<br />
text-decoration:none;<br />
size:10px;<br />
}<br />
<br />
.Upper_Logos#iGEM_Logo{<br />
width:100px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png');<br />
background-size:100px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
.Upper_Logos#HKUST_Logo{<br />
width:270px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/9/97/HKUST_Logo_Final.jpg');<br />
background-size:270px 80px;<br />
background-repeat:no-repeat;<br />
float:right;<br />
}<br />
<br />
.Upper_Logos#HKUST_iGEM_Logl{<br />
width:114px;<br />
height:80px;<br />
background-image:url('https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg');<br />
background-size:104px 80px;<br />
background-repeat:no-repeat;<br />
float:left;<br />
}<br />
<br />
#Side_Bar{<br />
clear:both;<br />
width:265px;<br />
height:750px;<br />
background-color:#CCFFCC;<br />
float:right;<br />
border:3px solid #99FF99;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
#News_Bar{<br />
background-color:#FFDDDD;<br />
border:3px solid #FF9999;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
width:265px;<br />
height:auto;<br />
padding-bottom:10px;<br />
margin-bottom:10px;<br />
}<br />
<br />
#News_Content{<br />
border:1px solid #FF9999;<br />
width:250px;<br />
height:200px;<br />
overflow:auto;<br />
border-radius:6px;<br />
-moz-border-radius:6px;<br />
display:none;<br />
}<br />
<br />
</style><br />
<br />
</head><br />
<body><br />
<div id="Navigation_top"><br />
<a href="https://2012.igem.org/Main_Page"><img id="iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/3/32/Igem-logo.png"></a><br />
<a href="http://www.ust.hk"><img id="HKUST_Logo" class="Upper_Logos" src=""></a><br />
<a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><img id="HKUST_iGEM_Logo" class="Upper_Logos" src="https://static.igem.org/mediawiki/2012/4/43/295197_446935765350523_472857901_n.jpg"></a><br />
<div class="Navigation_Buttons" id="Team" align="center"><h3><p>TEAM</p></h3></div><br />
<div class="Navigation_Buttons" id="Project" align="center"><h3><p>PROJECT</p></h3></div><br />
<div class="Navigation_Buttons" id="Wet_lab" align="center"><h3><p>WET LAB</p></h3></div><br />
<div class="Navigation_Buttons" id="Human_practice" align="center"><h3><p>HUMAN PRACTICE</p></h3></div><br />
<div class="Navigation_Buttons" id="Extras" align="center"><h3><p>EXTRAS</p></h3></div><br />
<br />
<div class="Navigation_Content" id="Team_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Project_Content"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Wet_lab_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Human_practice_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></div><br />
</div><br />
<div class="Navigation_Content" id="Extras_Content" align="center"><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></div><br />
<div class="Content_Buttons""><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></div><br />
<div class="Content_Buttons"><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></div><br />
</div><br />
</div><br />
<br />
<br />
<br />
<div><p align="center"><font size="20">Advisors</font></p></div><br />
<br />
<div id="paragraph1" class="bodyParagraphs"><br />
<div align="left"><br />
<h1></h1><br />
</div><br />
<br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/9/9a/Vege_new.jpg"><p style="clear:both"> Ms. CAI Wenxuan (Vege)</p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/9/9d/Kelly_new.jpg"><p style="clear:both"> Ms. Terrenz KELLY </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/2/20/Candy_new.jpg"><p style="clear:both"> Ms. TANG Jing (Candy) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/0/09/Wu_Clare.jpg"><p style="clear:both"> Ms. WU Yunmin (Claire) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/b/ba/Xu_Jiajing.jpg"><p style="clear:both"> Ms. XU Jiajing (Shirley) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/a/aa/Xu_Wendy_new.jpg"><p style="clear:both"> Ms. XU Kaichun (Wendy) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/3/3f/Joice_Zhang.jpg"><p style="clear:both"> Ms. ZHANG Junyi (Joyce) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/2/29/Deng_Yisong.jpg"><p style="clear:both"> Mr. DENG Yisong (Steven) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/3/35/Trevor_new.jpg"><p style="clear:both"> Mr. HO Yuan Heng (Trevor) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/4/41/Hanson.jpg"><p style="clear:both"> Mr. JIANG Hanlun (Hanson) </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/9/9f/Nathanial.jpg"><p style="clear:both"> Mr. Nathaniel LIM </p></div><br />
<div width=270px height=270px style="float:left;padding:10px;margin:5px"><img src="https://static.igem.org/mediawiki/2012/8/80/Ted_new.jpg"><p style="clear:both"> Mr. SHEK Chin Hong (Ted) </p></div><br />
</div><br />
<style type="text/css"><br />
<br />
#paragraph1{<br />
background-color:#EDFFFF;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
border:3px solid #A1FFFF;<br />
border-radius: 10px;<br />
-moz-border-radius:10px;<br />
}<br />
</style><br />
<div id="Sitemap"><br />
<div class="Sitemap_Content"><br />
<p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong"><b>Home</b></a></p><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Team</b><p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Introduction">Introduction</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Supervisor">Supervisor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Instructor">Instructor</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Members">Members</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Advisors">Advisors</a></p></li><br />
</ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Project</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Project_Abstraction">Abstract</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Background_and_Motive">Motive</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Overview">Design - Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Module">Design - Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Target_binding">Target Binding Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Anti_tumor">Anti-tumor Molecule Secretion Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Module/Regulation_and_control">Regulation and Control Module</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Design_Chassis">Design - Chassis</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Wet Lab</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Parts_and_Device">Parts and Devices</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Notebook">Notebook</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Characterization">Characterization</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Achievement">Achievement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Future_Work">Future Work</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Human Practice</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Overview">Overview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Interview">Interview</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Presentation">Presentation</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Calendar">Calendar</a></p></li></ol><br />
</div><br />
<div class="Sitemap_Content"><br />
<li><p><b>Extras</b></p><ol><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Medal_Requirements">Medal Requirements</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Safety">Safety</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Attribution">Attribution</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Acknowledgement">Acknowledgement</a></p></li><br />
<li><p><a href="https://2012.igem.org/Team:HKUST-Hong_Kong/Glossary">Glossary</a></p></li></ol><br />
</div><br />
</div><br />
<style type="text/css"><br />
#Sitemap{<br />
background-image:url('https://static.igem.org/mediawiki/2012/c/c0/HKUST_Campus.jpg');<br />
background-color:#ffffff;<br />
width:955px;<br />
height:auto;<br />
float:left;<br />
margin-top:5px;<br />
margin-bottom:5px;<br />
padding-bottom:5px;<br />
padding-top:5px;<br />
padding-left:4px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
.Sitemap_Content{<br />
background-color:#ffffff;<br />
opacity:0.8;<br />
width:145px;<br />
height:auto;<br />
float:left;<br />
margin:1px;<br />
padding-bottom:5px;<br />
padding-left:5px;<br />
border:3px solid #000000;<br />
border-radius:10px;<br />
-moz-border-radius:10px;<br />
}<br />
<br />
</style><br />
</body><br />
</html></div>
Dynastywarrior
http://2012.igem.org/File:Ted_new.jpg
File:Ted new.jpg
2012-09-26T18:33:24Z
<p>Dynastywarrior: </p>
<hr />
<div></div>
Dynastywarrior
http://2012.igem.org/File:Nathanial.jpg
File:Nathanial.jpg
2012-09-26T18:31:40Z
<p>Dynastywarrior: </p>
<hr />
<div></div>
Dynastywarrior
http://2012.igem.org/File:Trevor_new.jpg
File:Trevor new.jpg
2012-09-26T18:29:35Z
<p>Dynastywarrior: </p>
<hr />
<div></div>
Dynastywarrior
http://2012.igem.org/File:Deng_Yisong.jpg
File:Deng Yisong.jpg
2012-09-26T18:28:13Z
<p>Dynastywarrior: </p>
<hr />
<div></div>
Dynastywarrior
http://2012.igem.org/File:Joice_Zhang.jpg
File:Joice Zhang.jpg
2012-09-26T18:24:29Z
<p>Dynastywarrior: </p>
<hr />
<div></div>
Dynastywarrior
http://2012.igem.org/File:Xu_Wendy_new.jpg
File:Xu Wendy new.jpg
2012-09-26T18:22:23Z
<p>Dynastywarrior: </p>
<hr />
<div></div>
Dynastywarrior
http://2012.igem.org/File:Xu_Jiajing.jpg
File:Xu Jiajing.jpg
2012-09-26T18:21:03Z
<p>Dynastywarrior: </p>
<hr />
<div></div>
Dynastywarrior