http://2012.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=500&target=Gunvor2012.igem.org - User contributions [en]2024-03-29T09:08:27ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/File:Pm_XylS_BB.pngFile:Pm XylS BB.png2013-09-06T12:54:52Z<p>Gunvor: </p>
<hr />
<div></div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/TeamTeam:NTNU Trondheim/Team2012-09-26T23:44:43Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
__NOTOC__<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Meet the team <small> Team NTNU Trondheim up close and personal</small></h1><br />
</div><br />
</div><br />
<br />
<div class="container main-container"><br />
<br />
<br />
<div class="row-fluid"><br />
<br />
<div class="span10 offset1"><br />
<br />
<br />
<div id="myCarousel2" class="carousel slide"><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<img src="https://static.igem.org/mediawiki/2012/3/32/NTNU_team1.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/8/83/Ove_nina.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Rolf_gunvor.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/3/31/Eirin_jarle.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/2/22/NTNU_team2.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/0/0f/Run1.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/Run2.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/1/14/Run3.png" alt=""><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="page-header"><br />
<h1>The students</h1><br />
</div><br />
<br />
<div class="row-fluid"><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/d/d0/Gunvor.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Trondheim</dd><br />
<dt>Study program:</dt><dd>Graduated M.Sc. in Chemical engineering and biotechnology from NTNU, with specialization in biotechnology. <!--So now, I'm a graduate engineer (yay!). In my master thesis, I investigated the interaction between DNA and Uracil DNA Glycosylase, which is a repair enzyme removing uracil from DNA, using optical tweezers. I also just recieved a research stipend in medical imaging, meaning that for the next semester, I'll continue investigating single molecule interactions using optical tweezers.--></dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Gunvor Røkke</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Mainly playing the violin. I have been playing since I was five years old, and I am currently leading one of the three folk music orchestras in Trondheim. I also like to swim, or to gab with my friends.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li><i>Team leader:</i> Teaching the other team members the basic cloning techniques used for biobrick assembly.</li><br />
<li><i>Team representative:</i> In case of interested journalists, Gunvor will talk to them. Rolf will be her manager and Nina her stylist! </li><br />
<li><i>Team dietitian:</i> One of Gunvor's less serious responsibility areas is to make sure that all team members get their daily dose of carbohydrates (as we all agree that lowcarb is nonsense).</li><br />
<li><i>Vice PR chief: </i>Rolf is the actual PR chief, but in case Rolf meets some really stubborn journalists, and he gives up, Gunvor will take over.</li></dd><br />
<dt>Fun fact:</dt><dd>I'm able to whistle and hum in two part harmony with myself. And no, I'm not mutated.</dd><br />
</dl><br />
</div><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/9/97/Nina.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Eidsvåg, Møre og Romsdal</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Nina Hole</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Sports enthusiast, but especially interested in football. I also play football myself on NTNU's own football team. Other interests are reading, traveling and food.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul><li><i>Gunvor's stylist</i>:If Gunvor is representing the team, I have the main responsibility to do her make-up and so on.</li><li><i>Photo chief</i>: If something needs photographing, Nina is on the job!</li><br />
<li><i>Facebook and twitter chief: </i>Updating facebook and twitter is Nina's responsibility.</li><br />
<li><i>Travel chief: </i>Nina is travel chief, and have had the main responsibility for booking our hotel in Amsterdam. Apparently, she's good at this, because the hotell looks absolutely fabulous!</li><br />
<li><i>Megan Fox chief: </i>Internal humour. Don't ask...</li></ul><br />
</dd><br />
<dt>Fun fact:</dt><dd><br />
My favorite author/musician Jo Nesbø, has named his main character in his criminal novels Harry Hole. His inspiration for the last name comes from my family! </dd><br />
</dl><br />
</div><br />
<br />
</div><br />
<div class="row-fluid"><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/9/9b/Jarle.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Drammen</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Jarle Pahr</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Aikido and psychology.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul><li><i>Master of the notebook:</i> Trying to get the other team members to update the notebook.</li><li><i>Cake chief: </i> Baking awesome cakes.</li><br />
<li><i>Plate chief: </i>Keeping track of all the agar plates in the fridge is Jarle's job.</li><br />
<li><i>Culture chief: </i>Keeping track of cell cultures in the fridge, in the incubator, or on glycerol stock in the freezer.</ul></dd><br />
<dt>Fun fact:</dt><dd>Is resistant to norovirus, thanks to a mutation in the FUT2 gene. Being a mutant is nice!</dd><br />
</dl><br />
</div><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/9/91/Eirin.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Larvik</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Eirin Korvald</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Music (both playing and listening), snowboarding, hiking, knitting, hanging with friends.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li><i>iGEM hair dresser:</i> Making sure the entire team has fabulous hair at all times.</li><br />
<li><i>Cake chief: </i>Eirin is keeping track of the cakes the different team members owe the rest of the team.</li><br />
<li><i>Supervisor: </i>It's also Eirin's job to keep an eye on the rest of the team in Amsterdam, to make sure we don't get lost there.</li></dd><br />
<dt>Fun fact:</dt><dd>Is able to cut her own hair - nicely!.</dd><br />
</dl><br />
</div><br />
</div><br />
<br />
<br />
<div class="row-fluid"><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/6/6d/Ove.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Trondheim</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Ove Øyås</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Nature, cycling, hiking, music, programming, being enthusiastic about stuff.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li><i>Internet chief:</i> Fixing the wiki and the Matchmaker. Making spaghetti code.</li><br />
<li><i>T-shirt chief: </i>Has been in charge of ordering team t-shirts. The rest of us haven't seen them yet, but we have high expectations!</li><br />
<li><i>Vice facebook and twitter chief: </i>Is updating facebook and twitter together with Nina.</li></dd><br />
<dt>Fun fact:</dt><dd>Will easily eat raw ginger and garlic.</dd><br />
</dl><br />
</div><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/6/66/Rolf.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Trondheim</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in applied theoretical chemistry.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Rolf Heilemann Myhre</h2><br />
<dl><br />
<dt>Interests outside Academia:</dt><dd>In my spare time, I like exercising, hanging with friends, partying, movies etc. Also, I can't live without my computer.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul>Modelling the genetic circuit.<br />
<li><i>PR chief: </i>Will be talking to a (hopefully) enormous crowd of journalists.</li><br />
<li><i>Manager for Gunvor: </i>It's Rolf responsibility to make sure Gunvor says the right things to the journalists.</li><br />
<li><i>Cleaning chief: </i>Is making sure the NTNU iGEM headquarters looks tidy.</li></dd><br />
<dt>Fun fact:</dt><dd>I have not studied any biotechnology before joining the iGEM team.</dd><br />
</dl><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<div class="page-header"><br />
<h1>The advisors</h1><br />
</div><br />
<br />
<div class="row-fluid"><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/d/de/Eivind.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Stavanger, Norway</dd><br />
<dt>Position:</dt><dd>Professor</dd><br />
</div> <br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Eivind Almaas</h2><br />
<dl><br />
<dt>Area of expertise:</dt><dd>Systems biology and network analysis</dd><br />
<dt>Interests outside academia:</dt><dd>Hiking, reading, living.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li>Team organization.</li><li>Computer modelling.</li></dd><br />
<dt>Fun fact:</dt><dd>Big fan of 50's Rock'n Roll and Rockabilly.</dd><br />
<br />
<br />
<br />
</dl><br />
</div><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/4/4b/Rahmi.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Cologne, Germany</dd><br />
<dt>Position:</dt><dd>Postdoctoral fellow</dd><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Rahmi Lale</h2><br />
<dl><br />
<dt>Area of expertise:</dt><dd>Transcriptional and translational regulation of bacterial gene<br />
expression, metabolic engineering. Metagenome/biodiscovery.<br />
</dd><br />
<dt>Interests outside academia:</dt><dd> Loves playing bass, likes biking/hiking/skiing/fishing/sailing, into web/graphic design.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul><li>Herding the nerds!</li><br />
<li><i>Social chief: </i>Rahmi was chosen to be social chief at the beginning of the summer. It's his responsibility to make sure the team is also doing social stuff not related to lab work.</li></dd><br />
<dt>Fun fact:</dt><dd>He loves bugs so much that he makes his own kefir.</dd><br />
</dl><br />
</div><br />
<br />
</div><br />
<br />
<div class="row-fluid"><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/d/d8/Martin.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Mannheim, Germany</dd><br />
<dt>Position:</dt><dd>Associate professor</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Martin Hohmann-Marriott</h2><br />
<dl><br />
<dt>Area of expertise:</dt><dd>Photosynthesis, bioenergetics, molecular biology.</dd><br />
<dt>Interests outside academia:</dt><dd>My family, history, all things computer and technology</dd><br />
<dt>Areas of responsibility:</dt><dd>Instructor, molecular biology and physiology<br />
</dd><br />
<dt>Fun fact:</dt><dd>Martin designed exercise equipment for ants as an undergraduate.</dd><br />
</dl><br />
</div><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/1/19/Marius.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Kristiansand, Norway</dd><br />
<dt>Position:</dt><dd>Doctoral student. Graduated M.Sc. in Physics and mathematics from NTNU.</dd><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Marius Eidsaa</h2><br />
<dl><br />
<br />
<dt>Area of expertise:</dt><dd>Systems biology, mainly focusing on networks, both generally and in biology. I'm currently working on network methods and analysis of microarray data..</dd><br />
<dt>Interests outside academia:</dt><dd>I like to sing, and I'm currently singing tenor in two student-society based choirs. Other interests include music in general, food and drink and good company.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li>I'm a modelling instructor, so my main responsibility is to help set up and analyze our model.</li><br />
<li><i>Barbeque chief: </i>Marius is barbecue chief, and is supposed to be organizing barbeque everytime the weather in Trondheim is nice, which is, unfortunately, not that often.</dd><br />
<dt>Fun fact:</dt><dd>Has been swimming at a national level.</dd><br />
</dl><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T23:33:27Z<p>Gunvor: /* Colicin (BBa_K822002) */</p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
==Introduction==<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Parts parts page].<br />
<br />
Most of the biobricks we decided to use were already present in the registry, but we also needed biobricks with certain properties that were not present in the registry. These we had to make ourselves. The new bricks we made, and which we also characterized, are the following; <br />
<br />
* a protein coding brick for colicin E1, <br />
<br />
* a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, <br />
<br />
* the lld promotor + RBS from ''E.coli'', <br />
<br />
* the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
==Colicin (<partinfo>BBa_K822002</partinfo>)==<br />
<br />
Colicin is the protein we have chosen as toxin in our bacterial anti-cancer-kamikaze device. We amplified the brick using <partinfo>BBa_K150009</partinfo> as template. The brick contains protein coding sequences both for Colicin E1 and for colicin immunity protein. The following primers were used:<br />
<br />
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Colicin fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatggaaaccgcggtagcgta<br />
|-<br />
|Colicin rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcgatggtccctccctgaa<br />
|}<br />
<br />
To test if the our colicin brick worked, we cloned it together with a constitutive promoter + RBS <partinfo>BBa_K081005</partinfo>. Then, we grew overnight cultures with the Promoter+RBS+Colicin construct, and also with a negative control. The negative control were different in different experiments, but were always cells containing a non-expressing plasmid with ampicillin resistance, since the plasmid colicin was tested in, also had ampicillin resistance. <br />
After about 24 hours, LB was replaced with breaking buffer and the cells were sonicated. The lysed cells were centrifuged at 16000 g for 15 minutes to remove cell fragments, and the 3 ml lysate was added to a new 10 ml culture of newly inoculated ''E.coli'' cells with ampicillin resistance, but without the colicin immunity protein. Samples were taken regularly, and OD was measured. <br />
We performed two experiments; one experiment with two parallel cell cultures, where one was containing colicin and the other buffer (1), and one experiment with two parallels of cells with colicin lysate added, and one with lysate of non-colicin-producing cells added (2). The latter experiment was performed to prove that no other proteins expressed by the cells inhibited growth in other cells. The results of the experiments are given below:<br />
<br />
[[File:Colisin2.png|thumb|center|400px||OD measured over time in cell cultures with added colicin lysate (red dots) and buffer (blue dots)]]<br />
<br />
<br />
[[File:Colisin_1.png|thumb|center|400px||OD measured over time in two parallel cell cultures with added colicin lysate (red and purple dots) and lysate of non-colicin-producing cells (blue dots)]]<br />
<br />
<br />
Both experiments show that the cells without added colicin lysate has a significantly higher growth rate than the cells where colicin lysate was added.<br />
<br />
==YFP generator (<partinfo>BBa_K822003</partinfo>)==<br />
<br />
We made the YFP generator to verify that the YFP coding sequence worked, in order to use it in experiments verifying that the Vgb promoter worked. The YFP generator was cloned together from a constitutive promoter + RBS (<partinfo>BBa_K081005</partinfo>), YFP (<partinfo>BBa_E0030</partinfo>) and a double terminator (<partinfo>BBa_B0015</partinfo>).<br />
<br />
To verify that the YFP generator worked, cells containing the YFP generator plasmid and cells containing plasmids with YFP without promoter, RBS or terminator (only BBa_E0030), and plasmids containing Vgb+RBS+YFP+terminator (<partinfo>BBa_K561001</partinfo>+<partinfo>BBa_E0030</partinfo>) was grown overnight, and fluorescence measured. The emission wavelength was 544 nm, and 514 nm was used for exitation. Four parallel measurements were carried out. The result of the measurement can be seen below:<br />
<br />
[[File:YFP_fluorescence.png|thumb|center|500px||Fluorescence measured in Constitutive promoter+RBS+YFP+terminator, YFP, and Vgb+RBS+YFP]]<br />
<br />
Even though we were not able to prove that the Vgb promoter works, we proved that the YFP generator works, as the fluorescence divided by OD is much higher for cells containing this biobrick, than for example for cells containing plasmids with only YFP.<br />
<br />
==Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)==<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, however the resulting fragments were not as expected. This is why we thought of this biobrick as a suitable candidate for improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator are present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0" style="margin: 1em auto 1em auto; width: auto;"<br />
|[[File:Testkutt_BBa_K292006.png|thumb|center|300px|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.]]<br />
|style="vertical-align: top;"|[[File:RBS+LacI+term-gel.PNG|thumb|center|450px|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp). The fragments cut with NotI makes sense on gel. In the case of cutting with XbaI+PstI, we did not expect three fragments, but the upper fragment could be uncut plasmid, since the lower fragments makes sense. ]]<br />
|}<br />
<br />
==lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)==<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate-induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
==ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)==<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ATC 13032 as template, and the primers below:<br />
<br />
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but sequencing indicated a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T23:32:38Z<p>Gunvor: /* Colicin (BBa_K822002) */</p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
==Introduction==<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Parts parts page].<br />
<br />
Most of the biobricks we decided to use were already present in the registry, but we also needed biobricks with certain properties that were not present in the registry. These we had to make ourselves. The new bricks we made, and which we also characterized, are the following; <br />
<br />
* a protein coding brick for colicin E1, <br />
<br />
* a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, <br />
<br />
* the lld promotor + RBS from ''E.coli'', <br />
<br />
* the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
==Colicin (<partinfo>BBa_K822002</partinfo>)==<br />
<br />
Colicin is the protein we have chosen as toxin in our bacterial anti-cancer-kamikaze device. We amplified the brick using <partinfo>BBa_K150009</partinfo> as template. The brick contains protein coding sequences both for Colicin E1 and for colicin immunity protein. The following primers were used:<br />
<br />
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Colicin fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatggaaaccgcggtagcgta<br />
|-<br />
|Colicin rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcgatggtccctccctgaa<br />
|}<br />
<br />
To test if the our colicin brick worked, we cloned it together with a constitutive promoter + RBS <partinfo>BBa_K081005</partinfo>. Then, we grew overnight cultures with the Promoter+RBS+Colicin construct, and also with a negative control. The negative control were different in different experiments, but were always cells containing a non-expressing plasmid with ampicillin resistance, since the plasmid colicin was tested in, also had ampicillin resistance. <br />
After about 24 hours, LB was replaced with breaking buffer and the cells were sonicated. The lysed cells were centrifuged at 16000 g for 15 minutes to remove cell fragments, and the 3 ml lysate was added to a new 10 ml culture of newly inoculated ''E.coli'' cells with ampicillin resistance, but without the colicin immunity protein. Samples were taken regularly, and OD was measured. <br />
We performed two experiments; one experiment with two parallel cell cultures, where one was containing colicin and the other buffer (1), and one experiment with two parallels of cells with colicin lysate added, and one with lysate of non-colicin-producing cells added (2). The latter experiment was performed to prove that no other proteins expressed by the cells inhibited growth in other cells. The results of the experiments are given below:<br />
<br />
<br />
[[File:Colisin2.png|thumb|center|500px||OD measured over time in cell cultures with added colicin lysate (red dots) and buffer (blue dots)]]<br />
<br />
[[File:Colisin_1.png|thumb|center|500px||OD measured over time in two parallel cell cultures with added colicin lysate (red and purple dots) and lysate of non-colicin-producing cells (blue dots)]]<br />
<br />
<br />
Both experiments show that the cells without added colicin lysate has a significantly higher growth rate than the cells where colicin lysate was added.<br />
<br />
==YFP generator (<partinfo>BBa_K822003</partinfo>)==<br />
<br />
We made the YFP generator to verify that the YFP coding sequence worked, in order to use it in experiments verifying that the Vgb promoter worked. The YFP generator was cloned together from a constitutive promoter + RBS (<partinfo>BBa_K081005</partinfo>), YFP (<partinfo>BBa_E0030</partinfo>) and a double terminator (<partinfo>BBa_B0015</partinfo>).<br />
<br />
To verify that the YFP generator worked, cells containing the YFP generator plasmid and cells containing plasmids with YFP without promoter, RBS or terminator (only BBa_E0030), and plasmids containing Vgb+RBS+YFP+terminator (<partinfo>BBa_K561001</partinfo>+<partinfo>BBa_E0030</partinfo>) was grown overnight, and fluorescence measured. The emission wavelength was 544 nm, and 514 nm was used for exitation. Four parallel measurements were carried out. The result of the measurement can be seen below:<br />
<br />
[[File:YFP_fluorescence.png|thumb|center|500px||Fluorescence measured in Constitutive promoter+RBS+YFP+terminator, YFP, and Vgb+RBS+YFP]]<br />
<br />
Even though we were not able to prove that the Vgb promoter works, we proved that the YFP generator works, as the fluorescence divided by OD is much higher for cells containing this biobrick, than for example for cells containing plasmids with only YFP.<br />
<br />
==Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)==<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, however the resulting fragments were not as expected. This is why we thought of this biobrick as a suitable candidate for improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator are present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0" style="margin: 1em auto 1em auto; width: auto;"<br />
|[[File:Testkutt_BBa_K292006.png|thumb|center|300px|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.]]<br />
|style="vertical-align: top;"|[[File:RBS+LacI+term-gel.PNG|thumb|center|450px|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp). The fragments cut with NotI makes sense on gel. In the case of cutting with XbaI+PstI, we did not expect three fragments, but the upper fragment could be uncut plasmid, since the lower fragments makes sense. ]]<br />
|}<br />
<br />
==lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)==<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate-induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
==ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)==<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ATC 13032 as template, and the primers below:<br />
<br />
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but sequencing indicated a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T23:31:06Z<p>Gunvor: /* Colicin (BBa_K822002) */</p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
==Introduction==<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Parts parts page].<br />
<br />
Most of the biobricks we decided to use were already present in the registry, but we also needed biobricks with certain properties that were not present in the registry. These we had to make ourselves. The new bricks we made, and which we also characterized, are the following; <br />
<br />
* a protein coding brick for colicin E1, <br />
<br />
* a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, <br />
<br />
* the lld promotor + RBS from ''E.coli'', <br />
<br />
* the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
==Colicin (<partinfo>BBa_K822002</partinfo>)==<br />
<br />
Colicin is the protein we have chosen as toxin in our bacterial anti-cancer-kamikaze device. We amplified the brick using <partinfo>BBa_K150009</partinfo> as template. The brick contains protein coding sequences both for Colicin E1 and for colicin immunity protein. The following primers were used:<br />
<br />
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Colicin fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatggaaaccgcggtagcgta<br />
|-<br />
|Colicin rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcgatggtccctccctgaa<br />
|}<br />
<br />
To test if the our colicin brick worked, we cloned it together with a constitutive promoter + RBS <partinfo>BBa_K081005</partinfo>. Then, we grew overnight cultures with the Promoter+RBS+Colicin construct, and also with a negative control. The negative control were different in different experiments, but were always cells containing a non-expressing plasmid with ampicillin resistance, since the plasmid colicin was tested in, also had ampicillin resistance. <br />
After about 24 hours, LB was replaced with breaking buffer and the cells were sonicated. The lysed cells were centrifuged at 16000 g for 15 minutes to remove cell fragments, and the 3 ml lysate was added to a new 10 ml culture of newly inoculated ''E.coli'' cells with ampicillin resistance, but without the colicin immunity protein. Samples were taken regularly, and OD was measured. <br />
We performed two experiments; one experiment with two parallel cell cultures, where one was containing colicin and the other buffer (1), and one experiment with two parallels of cells with colicin lysate added, and one with lysate of non-colicin-producing cells added (2). The latter experiment was performed to prove that no other proteins expressed by the cells inhibited growth in other cells. The results of the experiments are given below:<br />
<br />
{|<br />
|[[File:Colisin2.png|thumb|center|500px||OD measured over time in cell cultures with added colicin lysate (red dots) and buffer (blue dots)]]<br />
|}<br />
<br />
{|<br />
|[[File:Colisin_1.png|thumb|center|500px||OD measured over time in two parallel cell cultures with added colicin lysate (red and purple dots) and lysate of non-colicin-producing cells (blue dots)]]<br />
|}<br />
<br />
Both experiments show that the cells without added colicin lysate has a significantly higher growth rate than the cells where colicin lysate was added.<br />
<br />
==YFP generator (<partinfo>BBa_K822003</partinfo>)==<br />
<br />
We made the YFP generator to verify that the YFP coding sequence worked, in order to use it in experiments verifying that the Vgb promoter worked. The YFP generator was cloned together from a constitutive promoter + RBS (<partinfo>BBa_K081005</partinfo>), YFP (<partinfo>BBa_E0030</partinfo>) and a double terminator (<partinfo>BBa_B0015</partinfo>).<br />
<br />
To verify that the YFP generator worked, cells containing the YFP generator plasmid and cells containing plasmids with YFP without promoter, RBS or terminator (only BBa_E0030), and plasmids containing Vgb+RBS+YFP+terminator (<partinfo>BBa_K561001</partinfo>+<partinfo>BBa_E0030</partinfo>) was grown overnight, and fluorescence measured. The emission wavelength was 544 nm, and 514 nm was used for exitation. Four parallel measurements were carried out. The result of the measurement can be seen below:<br />
<br />
[[File:YFP_fluorescence.png|thumb|center|500px||Fluorescence measured in Constitutive promoter+RBS+YFP+terminator, YFP, and Vgb+RBS+YFP]]<br />
<br />
Even though we were not able to prove that the Vgb promoter works, we proved that the YFP generator works, as the fluorescence divided by OD is much higher for cells containing this biobrick, than for example for cells containing plasmids with only YFP.<br />
<br />
==Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)==<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, however the resulting fragments were not as expected. This is why we thought of this biobrick as a suitable candidate for improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator are present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0" style="margin: 1em auto 1em auto; width: auto;"<br />
|[[File:Testkutt_BBa_K292006.png|thumb|center|300px|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.]]<br />
|style="vertical-align: top;"|[[File:RBS+LacI+term-gel.PNG|thumb|center|450px|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp). The fragments cut with NotI makes sense on gel. In the case of cutting with XbaI+PstI, we did not expect three fragments, but the upper fragment could be uncut plasmid, since the lower fragments makes sense. ]]<br />
|}<br />
<br />
==lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)==<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate-induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
==ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)==<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ATC 13032 as template, and the primers below:<br />
<br />
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but sequencing indicated a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T23:28:55Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
==Introduction==<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Parts parts page].<br />
<br />
Most of the biobricks we decided to use were already present in the registry, but we also needed biobricks with certain properties that were not present in the registry. These we had to make ourselves. The new bricks we made, and which we also characterized, are the following; <br />
<br />
* a protein coding brick for colicin E1, <br />
<br />
* a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, <br />
<br />
* the lld promotor + RBS from ''E.coli'', <br />
<br />
* the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
==Colicin (<partinfo>BBa_K822002</partinfo>)==<br />
<br />
Colicin is the protein we have chosen as toxin in our bacterial anti-cancer-kamikaze device. We amplified the brick using <partinfo>BBa_K150009</partinfo> as template. The brick contains protein coding sequences both for Colicin E1 and for colicin immunity protein. The following primers were used:<br />
<br />
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Colicin fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatggaaaccgcggtagcgta<br />
|-<br />
|Colicin rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcgatggtccctccctgaa<br />
|}<br />
<br />
To test if the our colicin brick worked, we cloned it together with a constitutive promoter + RBS <partinfo>BBa_K081005</partinfo>. Then, we grew overnight cultures with the Promoter+RBS+Colicin construct, and also with a negative control. The negative control were different in different experiments, but were always cells containing a non-expressing plasmid with ampicillin resistance, since the plasmid colicin was tested in, also had ampicillin resistance. <br />
After about 24 hours, LB was replaced with breaking buffer and the cells were sonicated. The lysed cells were centrifuged at 16000 g for 15 minutes to remove cell fragments, and the 3 ml lysate was added to a new 10 ml culture of newly inoculated ''E.coli'' cells with ampicillin resistance, but without the colicin immunity protein. Samples were taken regularly, and OD was measured. <br />
We performed two experiments; one experiment with two parallel cell cultures, where one was containing colicin and the other buffer (1), and one experiment with two parallels of cells with colicin lysate added, and one with lysate of non-colicin-producing cells added (2). The latter experiment was performed to prove that no other proteins expressed by the cells inhibited growth in other cells. The results of the experiments are given below:<br />
<br />
{|<br />
|[[File:Colisin2.png|500px]]<br />
|-<br />
|OD measured over time in cell cultures with added colicin lysate (red dots) and buffer (blue dots)<br />
|}<br />
<br />
{|<br />
|[[File:Colisin_1.png|500px]]<br />
|-<br />
|OD measured over time in two parallel cell cultures with added colicin lysate (red and purple dots) and lysate of non-colicin-producing cells (blue dots)<br />
|}<br />
<br />
Both experiments show that the cells without added colicin lysate has a significantly higher growth rate than the cells where colicin lysate was added. <br />
<br />
==YFP generator (<partinfo>BBa_K822003</partinfo>)==<br />
<br />
We made the YFP generator to verify that the YFP coding sequence worked, in order to use it in experiments verifying that the Vgb promoter worked. The YFP generator was cloned together from a constitutive promoter + RBS (<partinfo>BBa_K081005</partinfo>), YFP (<partinfo>BBa_E0030</partinfo>) and a double terminator (<partinfo>BBa_B0015</partinfo>).<br />
<br />
To verify that the YFP generator worked, cells containing the YFP generator plasmid and cells containing plasmids with YFP without promoter, RBS or terminator (only BBa_E0030), and plasmids containing Vgb+RBS+YFP+terminator (<partinfo>BBa_K561001</partinfo>+<partinfo>BBa_E0030</partinfo>) was grown overnight, and fluorescence measured. The emission wavelength was 544 nm, and 514 nm was used for exitation. Four parallel measurements were carried out. The result of the measurement can be seen below:<br />
<br />
[[File:YFP_fluorescence.png|thumb|center|500px||Fluorescence measured in Constitutive promoter+RBS+YFP+terminator, YFP, and Vgb+RBS+YFP]]<br />
<br />
Even though we were not able to prove that the Vgb promoter works, we proved that the YFP generator works, as the fluorescence divided by OD is much higher for cells containing this biobrick, than for example for cells containing plasmids with only YFP.<br />
<br />
==Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)==<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, however the resulting fragments were not as expected. This is why we thought of this biobrick as a suitable candidate for improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator are present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0" style="margin: 1em auto 1em auto; width: auto;"<br />
|[[File:Testkutt_BBa_K292006.png|thumb|center|300px|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.]]<br />
|style="vertical-align: top;"|[[File:RBS+LacI+term-gel.PNG|thumb|center|450px|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp). The fragments cut with NotI makes sense on gel. In the case of cutting with XbaI+PstI, we did not expect three fragments, but the upper fragment could be uncut plasmid, since the lower fragments makes sense. ]]<br />
|}<br />
<br />
==lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)==<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate-induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
==ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)==<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ATC 13032 as template, and the primers below:<br />
<br />
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but sequencing indicated a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T23:27:29Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
==Introduction==<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Parts parts page].<br />
<br />
Most of the biobricks we decided to use were already present in the registry, but we also needed biobricks with certain properties that were not present in the registry. These we had to make ourselves. The new bricks we made, and which we also characterized, are the following; <br />
<br />
* a protein coding brick for colicin E1, <br />
<br />
* a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, <br />
<br />
* the lld promotor + RBS from ''E.coli'', <br />
<br />
* the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
==Colicin (<partinfo>BBa_K822002</partinfo>)==<br />
<br />
Colicin is the protein we have chosen as toxin in our bacterial anti-cancer-kamikaze device. We amplified the brick using <partinfo>BBa_K150009</partinfo> as template. The brick contains protein coding sequences both for Colicin E1 and for colicin immunity protein. The following primers were used:<br />
<br />
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Colicin fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatggaaaccgcggtagcgta<br />
|-<br />
|Colicin rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcgatggtccctccctgaa<br />
|}<br />
<br />
To test if the our colicin brick worked, we cloned it together with a constitutive promoter + RBS <partinfo>BBa_K081005</partinfo>. Then, we grew overnight cultures with the Promoter+RBS+Colicin construct, and also with a negative control. The negative control were different in different experiments, but were always cells containing a non-expressing plasmid with ampicillin resistance, since the plasmid colicin was tested in, also had ampicillin resistance. <br />
After about 24 hours, LB was replaced with breaking buffer and the cells were sonicated. The lysed cells were centrifuged at 16000 g for 15 minutes to remove cell fragments, and the 3 ml lysate was added to a new 10 ml culture of newly inoculated ''E.coli'' cells with ampicillin resistance, but without the colicin immunity protein. Samples were taken regularly, and OD was measured. <br />
We performed two experiments; one experiment with two parallel cell cultures, where one was containing colicin and the other buffer (1), and one experiment with two parallels of cells with colicin lysate added, and one with lysate of non-colicin-producing cells added (2). The latter experiment was performed to prove that no other proteins expressed by the cells inhibited growth in other cells. The results of the experiments are given below:<br />
<br />
{|<br />
|[[File:Colicin2.png|500px]]<br />
|-<br />
|OD measured over time in cell cultures with added colicin lysate (red dots) and buffer (blue dots)<br />
|}<br />
<br />
{|<br />
|[[File:Colicin_1.png|500px]]<br />
|-<br />
|OD measured over time in two parallel cell cultures with added colicin lysate (red and purple dots) and lysate of non-colicin-producing cells (blue dots)<br />
|}<br />
<br />
Both experiments show that the cells without added colicin lysate has a significantly higher growth rate than the cells where colicin lysate was added. <br />
<br />
==YFP generator (<partinfo>BBa_K822003</partinfo>)==<br />
<br />
We made the YFP generator to verify that the YFP coding sequence worked, in order to use it in experiments verifying that the Vgb promoter worked. The YFP generator was cloned together from a constitutive promoter + RBS (<partinfo>BBa_K081005</partinfo>), YFP (<partinfo>BBa_E0030</partinfo>) and a double terminator (<partinfo>BBa_B0015</partinfo>).<br />
<br />
To verify that the YFP generator worked, cells containing the YFP generator plasmid and cells containing plasmids with YFP without promoter, RBS or terminator (only BBa_E0030), and plasmids containing Vgb+RBS+YFP+terminator (<partinfo>BBa_K561001</partinfo>+<partinfo>BBa_E0030</partinfo>) was grown overnight, and fluorescence measured. The emission wavelength was 544 nm, and 514 nm was used for exitation. Four parallel measurements were carried out. The result of the measurement can be seen below:<br />
<br />
[[File:YFP_fluorescence.png|thumb|center|500px||Fluorescence measured in Constitutive promoter+RBS+YFP+terminator, YFP, and Vgb+RBS+YFP]]<br />
<br />
Even though we were not able to prove that the Vgb promoter works, we proved that the YFP generator works, as the fluorescence divided by OD is much higher for cells containing this biobrick, than for example for cells containing plasmids with only YFP.<br />
<br />
==Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)==<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, however the resulting fragments were not as expected. This is why we thought of this biobrick as a suitable candidate for improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator are present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0" style="margin: 1em auto 1em auto; width: auto;"<br />
|[[File:Testkutt_BBa_K292006.png|thumb|center|300px|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.]]<br />
|style="vertical-align: top;"|[[File:RBS+LacI+term-gel.PNG|thumb|center|450px|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp). The fragments cut with NotI makes sense on gel. In the case of cutting with XbaI+PstI, we did not expect three fragments, but the upper fragment could be uncut plasmid, since the lower fragments makes sense. ]]<br />
|}<br />
<br />
==lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)==<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate-induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
==ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)==<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ATC 13032 as template, and the primers below:<br />
<br />
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but sequencing indicated a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/File:Colisin_1.pngFile:Colisin 1.png2012-09-26T23:26:22Z<p>Gunvor: </p>
<hr />
<div></div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/TeamTeam:NTNU Trondheim/Team2012-09-26T23:18:21Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
__NOTOC__<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Meet the team <small> Team NTNU Trondheim up close and personal</small></h1><br />
</div><br />
</div><br />
<br />
<div class="container main-container"><br />
<br />
<br />
<div class="row-fluid"><br />
<br />
<div class="span10 offset1"><br />
<br />
<br />
<div id="myCarousel2" class="carousel slide"><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<img src="https://static.igem.org/mediawiki/2012/3/32/NTNU_team1.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/8/83/Ove_nina.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Rolf_gunvor.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/3/31/Eirin_jarle.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/2/22/NTNU_team2.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/0/0f/Run1.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/Run2.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/1/14/Run3.png" alt=""><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="page-header"><br />
<h1>The students</h1><br />
</div><br />
<br />
<div class="row-fluid"><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/d/d0/Gunvor.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Trondheim</dd><br />
<dt>Study program:</dt><dd>Graduated M.Sc. in Chemical engineering and biotechnology from NTNU, with specialization in biotechnology. <!--So now, I'm a graduate engineer (yay!). In my master thesis, I investigated the interaction between DNA and Uracil DNA Glycosylase, which is a repair enzyme removing uracil from DNA, using optical tweezers. I also just recieved a research stipend in medical imaging, meaning that for the next semester, I'll continue investigating single molecule interactions using optical tweezers.--></dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Gunvor Røkke</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Mainly playing the violin. I have been playing since I was five years old, and I am currently leading one of the three folk music orchestras in Trondheim. I also like to swim, or to gab with my friends.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li><i>Team leader:</i> Teaching the other team members the basic cloning techniques used for biobrick assembly.</li><br />
<li><i>Team representative:</i> In case of interested journalists, Gunvor will talk to them. Rolf will be her manager and Nina her stylist! </li><br />
<li><i>Team dietitian:</i> One of Gunvor's less serious responsibility areas is to make sure that all team members get their daily dose of carbohydrates (as we all agree that lowcarb is nonsense).</li><br />
<li><i>Vice PR chief: </i>Rolf is the actual PR chief, but in case Rolf meets some really stubborn journalists, and he gives up, Gunvor will take over.</li></dd><br />
<dt>Fun fact:</dt><dd>I'm able to whistle and hum in two part harmony with myself. And no, I'm not mutated.</dd><br />
</dl><br />
</div><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/9/97/Nina.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Eidsvåg, Møre og Romsdal</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Nina Hole</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Sports enthusiast, but especially interested in football. I also play football myself on NTNU's own football team. Other interests are reading, traveling and food.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul><li><i>Gunvor's stylist</i>:If Gunvor is representing the team, I have the main responsibility to do her make-up and so on.</li><li><i>Photo chief</i>: If something needs photographing, Nina is on the job!</li><br />
<li><i>Facebook and twitter chief: </i>Updating facebook and twitter is Nina's responsibility.</li><br />
<li><i>Travel chief: </i>Nina is travel chief, and have had the main responsibility for booking our hotel in Amsterdam. Apparently, she's good at this, because the hotell looks absolutely fabulous!</li><br />
<li><i>Megan Fox chief: </i>Internal humour. Don't ask...</li></ul><br />
</dd><br />
<dt>Fun fact:</dt><dd><br />
My favorite author/musician Jo Nesbø, has named his main character in his criminal novels Harry Hole. His inspiration for the last name comes from my family! </dd><br />
</dl><br />
</div><br />
<br />
</div><br />
<div class="row-fluid"><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/9/9b/Jarle.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Drammen</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Jarle Pahr</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Aikido and psychology.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul><li><i>Master of the notebook:</i> Trying to get the other team members to update the notebook.</li><li><i>Cake chief: </i> Baking awesome cakes.</li><br />
<li><i>Plate chief: </i>Keeping track of all the agar plates in the fridge is Jarle's job.</li><br />
<li><i>Culture chief: </i>Keeping track of cell cultures in the fridge, in the incubator, or on glycerol stock in the freezer.</ul></dd><br />
<dt>Fun fact:</dt><dd>Is resistant to norovirus, thanks to a mutation in the FUT2 gene. Being a mutant is nice!</dd><br />
</dl><br />
</div><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/9/91/Eirin.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Larvik</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Eirin Korvald</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Music (both playing and listening), snowboarding, hiking, knitting, hanging with friends.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li><i>iGEM hair dresser:</i> Making sure the entire team has fabulous hair at all times.</li><br />
<li><i>Cake chief: </i>Eirin is keeping track of the cakes the different team members owe the rest of the team.</li><br />
<li><i>Supervisor: </i>It's also Eirin's job to keep an eye on the rest of the team in Amsterdam, to make sure we don't get lost there.</li></dd><br />
</dl><br />
</div><br />
</div><br />
<br />
<br />
<div class="row-fluid"><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/6/6d/Ove.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Trondheim</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Ove Øyås</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Nature, cycling, hiking, music, programming, being enthusiastic about stuff.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li><i>Internet chief:</i> Fixing the wiki and the Matchmaker. Making spaghetti code.</li><br />
<li><i>T-shirt chief: <i>Has been in charge of ordering team t-shirts. The rest of us haven't seen them yet, but we have high expectations!</li><br />
<li><i>Vice facebook and twitter chief: </i>Is updating facebook and twitter together with Nina.</li></dd><br />
<dt>Fun fact:</dt><dd>Will easily eat raw ginger and garlic.</dd><br />
</dl><br />
</div><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/6/66/Rolf.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Trondheim</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in applied theoretical chemistry.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Rolf Heilemann Myhre</h2><br />
<dl><br />
<dt>Interests outside Academia:</dt><dd>In my spare time, I like exercising, hanging with friends, partying, movies etc. Also, I can't live without my computer.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul>Modelling the genetic circuit.<br />
<li><i>PR chief: </i>Will be talking to a (hopefully) enormous crowd of journalists.</li><br />
<li><i>Manager for Gunvor: </i>It's Rolf responsibility to make sure Gunvor says the right things to the journalists.</li><br />
<li><i>Cleaning chief: </i>Is making sure the NTNU iGEM headquarters looks tidy.</li></dd><br />
<dt>Fun fact:</dt><dd>I have not studied any biotechnology before joining the iGEM team.</dd><br />
</dl><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<div class="page-header"><br />
<h1>The advisors</h1><br />
</div><br />
<br />
<div class="row-fluid"><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/d/de/Eivind.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Stavanger, Norway</dd><br />
<dt>Position:</dt><dd>Professor</dd><br />
</div> <br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Eivind Almaas</h2><br />
<dl><br />
<dt>Area of expertise:</dt><dd>Systems biology and network analysis</dd><br />
<dt>Interests outside academia:</dt><dd>Hiking, reading, living.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li>Team organization.</li><li>Computer modelling.</li></dd><br />
<dt>Fun fact:</dt><dd>Big fan of 50's Rock'n Roll and Rockabilly.</dd><br />
<br />
<br />
<br />
</dl><br />
</div><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/4/4b/Rahmi.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Cologne, Germany</dd><br />
<dt>Position:</dt><dd>Postdoctoral fellow</dd><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Rahmi Lale</h2><br />
<dl><br />
<dt>Area of expertise:</dt><dd>Transcriptional and translational regulation of bacterial gene<br />
expression, metabolic engineering. Metagenome/biodiscovery.<br />
</dd><br />
<dt>Interests outside academia:</dt><dd> Loves playing bass, likes biking/hiking/skiing/fishing/sailing, into web/graphic design.</dd><br />
<dt>Areas of responsibility:</dt><dd>Herding the nerds!</dd><br />
<li><i>Social chief: </i>Rahmi was chosen to be social chief at the beginning of the summer. It's his responsibility to make sure the team is also doing social stuff not related to lab work.</li><br />
<dt>Fun fact:</dt><dd>He loves bugs so much that he makes his own kefir.</dd><br />
</dl><br />
</div><br />
<br />
</div><br />
<br />
<div class="row-fluid"><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/d/d8/Martin.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Mannheim, Germany</dd><br />
<dt>Position:</dt><dd>Associate professor</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Martin Hohmann-Marriott</h2><br />
<dl><br />
<dt>Area of expertise:</dt><dd>Photosynthesis, bioenergetics, molecular biology.</dd><br />
<dt>Interests outside academia:</dt><dd>My family, history, all things computer and technology</dd><br />
<dt>Areas of responsibility:</dt><dd>Instructor, molecular biology and physiology<br />
</dd><br />
<dt>Fun fact:</dt><dd>Martin designed exercise equipment for ants as an undergraduate.</dd><br />
</dl><br />
</div><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/1/19/Marius.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Kristiansand, Norway</dd><br />
<dt>Position:</dt><dd>Doctoral student. Graduated M.Sc. in Physics and mathematics from NTNU.</dd><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Marius Eidsaa</h2><br />
<dl><br />
<br />
<dt>Area of expertise:</dt><dd>Systems biology, mainly focusing on networks, both generally and in biology. I'm currently working on network methods and analysis of microarray data..</dd><br />
<dt>Interests outside academia:</dt><dd>I like to sing, and I'm currently singing tenor in two student-society based choirs. Other interests include music in general, food and drink and good company.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li>I'm a modelling instructor, so my main responsibility is to help set up and analyze our model.</li><br />
<li><i>Barbeque chief: </i>Marius is barbecue chief, and is supposed to be organizing barbeque everytime the weather in Trondheim is nice, which is, unfortunately, not that often.</dd><br />
<dt>Fun fact:</dt><dd>Has been swimming at a national level.</dd><br />
</dl><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/TeamTeam:NTNU Trondheim/Team2012-09-26T23:14:27Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
__NOTOC__<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Meet the team <small> Team NTNU Trondheim up close and personal</small></h1><br />
</div><br />
</div><br />
<br />
<div class="container main-container"><br />
<br />
<br />
<div class="row-fluid"><br />
<br />
<div class="span10 offset1"><br />
<br />
<br />
<div id="myCarousel2" class="carousel slide"><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<img src="https://static.igem.org/mediawiki/2012/3/32/NTNU_team1.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/8/83/Ove_nina.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Rolf_gunvor.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/3/31/Eirin_jarle.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/2/22/NTNU_team2.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/0/0f/Run1.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/Run2.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/1/14/Run3.png" alt=""><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="page-header"><br />
<h1>The students</h1><br />
</div><br />
<br />
<div class="row-fluid"><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/d/d0/Gunvor.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Trondheim</dd><br />
<dt>Study program:</dt><dd>Graduated M.Sc. in Chemical engineering and biotechnology from NTNU, with specialization in biotechnology. <!--So now, I'm a graduate engineer (yay!). In my master thesis, I investigated the interaction between DNA and Uracil DNA Glycosylase, which is a repair enzyme removing uracil from DNA, using optical tweezers. I also just recieved a research stipend in medical imaging, meaning that for the next semester, I'll continue investigating single molecule interactions using optical tweezers.--></dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Gunvor Røkke</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Mainly playing the violin. I have been playing since I was five years old, and I am currently leading one of the three folk music orchestras in Trondheim. I also like to swim, or to gab with my friends.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li><i>Team leader:</i> Teaching the other team members the basic cloning techniques used for biobrick assembly.</li><br />
<li><i>Team representative:</i> In case of interested journalists, Gunvor will talk to them. Rolf will be her manager and Nina her stylist! </li><br />
<li><i>Team dietitian:</i> One of Gunvor's less serious responsibility areas is to make sure that all team members get their daily dose of carbohydrates (as we all agree that lowcarb is nonsense).</li><br />
<li><i>Vice PR chief: </i>Rolf is the actual PR chief, but in case Rolf meets some really stubborn journalists, and he gives up, Gunvor will take over.</li></dd><br />
<dt>Fun fact:</dt><dd>I'm able to whistle and hum in two part harmony with myself. And no, I'm not mutated.</dd><br />
</dl><br />
</div><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/9/97/Nina.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Eidsvåg, Møre og Romsdal</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Nina Hole</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Sports enthusiast, but especially interested in football. I also play football myself on NTNU's own football team. Other interests are reading, traveling and food.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul><li><i>Gunvor's stylist</i>:If Gunvor is representing the team, I have the main responsibility to do her make-up and so on.</li><li><i>Photo chief</i>: If something needs photographing, Nina is on the job!</li><br />
<li><i>Facebook and twitter chief: </i>Updating facebook and twitter is Nina's responsibility.</li><br />
<li><i>Travel chief: </i>Nina is travel chief, and have had the main responsibility for booking our hotel in Amsterdam. Apparently, she's good at this, because the hotell looks absolutely fabulous!</li><br />
<li><i>Megan Fox chief: </i>Internal humour. Don't ask...</li></ul><br />
</dd><br />
<dt>Fun fact:</dt><dd><br />
My favorite author/musician Jo Nesbø, has named his main character in his criminal novels Harry Hole. His inspiration for the last name comes from my family! </dd><br />
</dl><br />
</div><br />
<br />
</div><br />
<div class="row-fluid"><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/9/9b/Jarle.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Drammen</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Jarle Pahr</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Aikido and psychology.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul><li><i>Master of the notebook:</i> Trying to get the other team members to update the notebook.</li><li><i>Cake chief: </i> Baking awesome cakes.</li><br />
<li><i>Plate chief: </i>Keeping track of all the agar plates in the fridge is Jarle's job.</li><br />
<li><i>Culture chief: </i>Keeping track of cell cultures in the fridge, in the incubator, or on glycerol stock in the freezer.</ul></dd><br />
<dt>Fun fact:</dt><dd>Is resistant to norovirus, thanks to a mutation in the FUT2 gene. Being a mutant is nice!</dd><br />
</dl><br />
</div><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/9/91/Eirin.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Larvik</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Eirin Korvald</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Music (both playing and listening), snowboarding, hiking, knitting, hanging with friends.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li><i>iGEM hair dresser:</i> Making sure the entire team has fabulous hair at all times.</li><br />
<li><i>Cake chief: </i>Eirin is keeping track of the cakes the different team members owe the rest of the team.</li><br />
<li><i>Supervisor: </i>It's also Eirin's job to keep an eye on the rest of the team in Amsterdam, to make sure we don't get lost there.</li></dd><br />
</dl><br />
</div><br />
</div><br />
<br />
<br />
<div class="row-fluid"><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/6/6d/Ove.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Trondheim</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Ove Øyås</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Nature, cycling, hiking, music, programming, being enthusiastic about stuff.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li><i>Internet chief:</i> Fixing the wiki and the Matchmaker. Making spaghetti code.</li><br />
<li><i>T-shirt chief: <i>Has been in charge of ordering team t-shirts. The rest of us haven't seen them yet, but we have high expectations!</li><br />
<li><i>Vice facebook and twitter chief: </i>Is updating facebook and twitter together with Nina.</li></dd><br />
<dt>Fun fact:</dt><dd>Will easily eat raw ginger and garlic.</dd><br />
</dl><br />
</div><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/6/66/Rolf.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Trondheim</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in applied theoretical chemistry.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Rolf Heilemann Myhre</h2><br />
<dl><br />
<dt>Interests outside Academia:</dt><dd>In my spare time, I like exercising, hanging with friends, partying, movies etc. Also, I can't live without my computer.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul>Modelling the genetic circuit.<br />
<li><i>PR chief: </i>Will be talking to a (hopefully) enormous crowd of journalists.</li><br />
<li><i>Manager for Gunvor: </i>It's Rolf responsibility to make sure Gunvor says the right things to the journalists.</li><br />
<li><i>Cleaning chief: </i>Is making sure the NTNU iGEM headquarters looks tidy.</li></dd><br />
<dt>Fun fact:</dt><dd>I have not studied any biotechnology before joining the iGEM team.</dd><br />
</dl><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<div class="page-header"><br />
<h1>The advisors</h1><br />
</div><br />
<br />
<div class="row-fluid"><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/d/de/Eivind.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Stavanger, Norway</dd><br />
<dt>Position:</dt><dd>Professor</dd><br />
</div> <br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Eivind Almaas</h2><br />
<dl><br />
<dt>Area of expertise:</dt><dd>Systems biology and network analysis</dd><br />
<dt>Interests outside academia:</dt><dd>Hiking, reading, living.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li>Team organization.</li><li>Computer modelling.</li></dd><br />
<dt>Fun fact:</dt><dd>Big fan of 50's Rock'n Roll and Rockabilly.</dd><br />
<br />
<br />
<br />
</dl><br />
</div><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/4/4b/Rahmi.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Cologne, Germany</dd><br />
<dt>Position:</dt><dd>Postdoctoral fellow</dd><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Rahmi Lale</h2><br />
<dl><br />
<dt>Area of expertise:</dt><dd>Transcriptional and translational regulation of bacterial gene<br />
expression, metabolic engineering. Metagenome/biodiscovery.<br />
<li><i>Social chief: </i>Rahmi was chosen to be social chief at the beginning of the summer. It's his responsibility to make sure the team is also doing social stuff not related to lab work.</li></dd><br />
<dt>Interests outside academia:</dt><dd> Loves playing bass, likes biking/hiking/skiing/fishing/sailing, into web/graphic design.</dd><br />
<dt>Areas of responsibility:</dt><dd>Herding the nerds!</dd><br />
<dt>Fun fact:</dt><dd>He loves bugs so much that he makes his own kefir.</dd><br />
</dl><br />
</div><br />
<br />
</div><br />
<br />
<div class="row-fluid"><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/d/d8/Martin.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Mannheim, Germany</dd><br />
<dt>Position:</dt><dd>Associate professor</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Martin Hohmann-Marriott</h2><br />
<dl><br />
<dt>Area of expertise:</dt><dd>Photosynthesis, bioenergetics, molecular biology.</dd><br />
<dt>Interests outside academia:</dt><dd>My family, history, all things computer and technology</dd><br />
<dt>Areas of responsibility:</dt><dd>Instructor, molecular biology and physiology<br />
</dd><br />
<dt>Fun fact:</dt><dd>Martin designed exercise equipment for ants as an undergraduate.</dd><br />
</dl><br />
</div><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/1/19/Marius.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Kristiansand, Norway</dd><br />
<dt>Position:</dt><dd>Doctoral student. Graduated M.Sc. in Physics and mathematics from NTNU.</dd><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Marius Eidsaa</h2><br />
<dl><br />
<br />
<dt>Area of expertise:</dt><dd>Systems biology, mainly focusing on networks, both generally and in biology. I'm currently working on network methods and analysis of microarray data..</dd><br />
<dt>Interests outside academia:</dt><dd>I like to sing, and I'm currently singing tenor in two student-society based choirs. Other interests include music in general, food and drink and good company.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li>I'm a modelling instructor, so my main responsibility is to help set up and analyze our model.</li><br />
<li><i>Barbeque chief: </i>Marius is barbecue chief, and is supposed to be organizing barbeque everytime the weather in Trondheim is nice, which is, unfortunately, not that often.</dd><br />
<dt>Fun fact:</dt><dd>Has been swimming at a national level.</dd><br />
</dl><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/TeamTeam:NTNU Trondheim/Team2012-09-26T22:59:17Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
__NOTOC__<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Meet the team <small> Team NTNU Trondheim up close and personal</small></h1><br />
</div><br />
</div><br />
<br />
<div class="container main-container"><br />
<br />
<br />
<div class="row-fluid"><br />
<br />
<div class="span10 offset1"><br />
<br />
<br />
<div id="myCarousel2" class="carousel slide"><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<img src="https://static.igem.org/mediawiki/2012/3/32/NTNU_team1.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/8/83/Ove_nina.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Rolf_gunvor.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/3/31/Eirin_jarle.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/2/22/NTNU_team2.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/0/0f/Run1.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/Run2.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/1/14/Run3.png" alt=""><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="page-header"><br />
<h1>The students</h1><br />
</div><br />
<br />
<div class="row-fluid"><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/d/d0/Gunvor.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Trondheim</dd><br />
<dt>Study program:</dt><dd>Graduated M.Sc. in Chemical engineering and biotechnology from NTNU, with specialization in biotechnology. <!--So now, I'm a graduate engineer (yay!). In my master thesis, I investigated the interaction between DNA and Uracil DNA Glycosylase, which is a repair enzyme removing uracil from DNA, using optical tweezers. I also just recieved a research stipend in medical imaging, meaning that for the next semester, I'll continue investigating single molecule interactions using optical tweezers.--></dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Gunvor Røkke</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Mainly playing the violin. I have been playing since I was five years old, and I am currently leading one of the three folk music orchestras in Trondheim. I also like to swim, or to gab with my friends.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li><i>Team leader:</i> Teaching the other team members the basic cloning techniques used for biobrick assembly.</li><br />
<li><i>Team representative:</i> In case of interested journalists, Gunvor will talk to them. Rolf will be her manager and Nina her stylist! </li><br />
<li><i>Team dietitian:</i> One of Gunvor's less serious responsibility areas is to make sure that all team members get their daily dose of carbohydrates (as we all agree that lowcarb is nonsense).</li><br />
<li><i>Vice PR chief: </i>Rolf is the actual PR chief, but in case Rolf meets some really stubborn journalists, and he gives up, Gunvor will take over.</li></dd><br />
<dt>Fun fact:</dt><dd>I'm able to whistle and hum in two part harmony with myself. And no, I'm not mutated.</dd><br />
</dl><br />
</div><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/9/97/Nina.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Eidsvåg, Møre og Romsdal</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Nina Hole</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Sports enthusiast, but especially interested in football. I also play football myself on NTNU's own football team. Other interests are reading, traveling and food.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul><li><i>Gunvor's stylist</i>:If Gunvor is representing the team, I have the main responsibility to do her make-up and so on.</li><li><i>Photo chief</i>: If something needs photographing, Nina is on the job!</li><br />
<li><i>Facebook and twitter chief: </i>Updating facebook and twitter is Nina's responsibility.</li><br />
<li><i>Travel chief: </i>Nina is travel chief, and have had the main responsibility for booking our hotel in Amsterdam. Apparently, she's good at this, because the hotell looks absolutely fabulous!</li><br />
<li><i>Megan Fox chief: </i>Internal humour. Don't ask...</li></ul><br />
</dd><br />
<dt>Fun fact:</dt><dd><br />
My favorite author/musician Jo Nesbø, has named his main character in his criminal novels Harry Hole. His inspiration for the last name comes from my family! </dd><br />
</dl><br />
</div><br />
<br />
</div><br />
<div class="row-fluid"><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/9/9b/Jarle.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Drammen</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Jarle Pahr</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Aikido and psychology.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul><li><i>Master of the notebook:</i> Trying to get the other team members to update the notebook.</li><li><i>Cake chief: </i> Baking awesome cakes.</li></ul></dd><br />
<dt>Fun fact:</dt><dd>Is resistant to norovirus, thanks to a mutation in the FUT2 gene. Being a mutant is nice!</dd><br />
</dl><br />
</div><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/9/91/Eirin.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Larvik</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Eirin Korvald</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Music (both playing and listening), snowboarding, hiking, knitting, hanging with friends.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li><i>iGEM hair dresser:</i> Making sure the entire team has fabulous hair at all times.</li></dd><br />
</dl><br />
</div><br />
</div><br />
<br />
<br />
<div class="row-fluid"><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/6/6d/Ove.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Trondheim</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Ove Øyås</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Nature, cycling, hiking, music, programming, being enthusiastic about stuff.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li><i>Internet chief:</i> Fixing the wiki and the Matchmaker. Making spaghetti code.</li></dd><br />
<dt>Fun fact:</dt><dd>Will easily eat raw ginger and garlic.</dd><br />
</dl><br />
</div><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/6/66/Rolf.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Trondheim</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in applied theoretical chemistry.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Rolf Heilemann Myhre</h2><br />
<dl><br />
<dt>Interests outside Academia:</dt><dd>In my spare time, I like exercising, hanging with friends, partying, movies etc. Also, I can't live without my computer.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul>Modelling the genetic circuit.</dd><br />
<dt>Fun fact:</dt><dd>I have not studied any biotechnology before joining the iGEM team.</dd><br />
</dl><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<div class="page-header"><br />
<h1>The advisors</h1><br />
</div><br />
<br />
<div class="row-fluid"><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/d/de/Eivind.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Stavanger, Norway</dd><br />
<dt>Position:</dt><dd>Professor</dd><br />
</div> <br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Eivind Almaas</h2><br />
<dl><br />
<dt>Area of expertise:</dt><dd>Systems biology and network analysis</dd><br />
<dt>Interests outside academia:</dt><dd>Hiking, reading, living.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li>Team organization.</li><li>Computer modelling.</li></dd><br />
<dt>Fun fact:</dt><dd>Big fan of 50's Rock'n Roll and Rockabilly.</dd><br />
<br />
<br />
<br />
</dl><br />
</div><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/4/4b/Rahmi.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Cologne, Germany</dd><br />
<dt>Position:</dt><dd>Postdoctoral fellow</dd><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Rahmi Lale</h2><br />
<dl><br />
<dt>Area of expertise:</dt><dd>Transcriptional and translational regulation of bacterial gene<br />
expression, metabolic engineering. Metagenome/biodiscovery.</dd><br />
<dt>Interests outside academia:</dt><dd> Loves playing bass, likes biking/hiking/skiing/fishing/sailing, into web/graphic design.</dd><br />
<dt>Areas of responsibility:</dt><dd>Herding the nerds!</dd><br />
<dt>Fun fact:</dt><dd>He loves bugs so much that he makes his own kefir.</dd><br />
</dl><br />
</div><br />
<br />
</div><br />
<br />
<div class="row-fluid"><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/d/d8/Martin.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Mannheim, Germany</dd><br />
<dt>Position:</dt><dd>Associate professor</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Martin Hohmann-Marriott</h2><br />
<dl><br />
<dt>Area of expertise:</dt><dd>Photosynthesis, bioenergetics, molecular biology.</dd><br />
<dt>Interests outside academia:</dt><dd>My family, history, all things computer and technology</dd><br />
<dt>Areas of responsibility:</dt><dd>Instructor, molecular biology and physiology<br />
</dd><br />
<dt>Fun fact:</dt><dd>Martin designed exercise equipment for ants as an undergraduate.</dd><br />
</dl><br />
</div><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/1/19/Marius.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Kristiansand, Norway</dd><br />
<dt>Position:</dt><dd>Doctoral student. Graduated M.Sc. in Physics and mathematics from NTNU.</dd><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Marius Eidsaa</h2><br />
<dl><br />
<br />
<dt>Area of expertise:</dt><dd>Systems biology, mainly focusing on networks, both generally and in biology. I'm currently working on network methods and analysis of microarray data..</dd><br />
<dt>Interests outside academia:</dt><dd>I like to sing, and I'm currently singing tenor in two student-society based choirs. Other interests include music in general, food and drink and good company.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li>I'm a modelling instructor, so my main responsibility is to help set up and analyze our model.</li></dd><br />
<dt>Fun fact:</dt><dd>Has been swimming at a national level.</dd><br />
</dl><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/TeamTeam:NTNU Trondheim/Team2012-09-26T22:50:54Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
__NOTOC__<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Meet the team <small> Team NTNU Trondheim up close and personal</small></h1><br />
</div><br />
</div><br />
<br />
<div class="container main-container"><br />
<br />
<br />
<div class="row-fluid"><br />
<br />
<div class="span10 offset1"><br />
<br />
<br />
<div id="myCarousel2" class="carousel slide"><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<img src="https://static.igem.org/mediawiki/2012/3/32/NTNU_team1.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/8/83/Ove_nina.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Rolf_gunvor.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/3/31/Eirin_jarle.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/2/22/NTNU_team2.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/0/0f/Run1.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/5/55/Run2.png" alt=""><br />
</div><br />
<div class="item"><br />
<img src="https://static.igem.org/mediawiki/2012/1/14/Run3.png" alt=""><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="page-header"><br />
<h1>The students</h1><br />
</div><br />
<br />
<div class="row-fluid"><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/d/d0/Gunvor.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Trondheim</dd><br />
<dt>Study program:</dt><dd>Graduated M.Sc. in Chemical engineering and biotechnology from NTNU, with specialization in biotechnology. <!--So now, I'm a graduate engineer (yay!). In my master thesis, I investigated the interaction between DNA and Uracil DNA Glycosylase, which is a repair enzyme removing uracil from DNA, using optical tweezers. I also just recieved a research stipend in medical imaging, meaning that for the next semester, I'll continue investigating single molecule interactions using optical tweezers.--></dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Gunvor Røkke</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Mainly playing the violin. I have been playing since I was five years old, and I am currently leading one of the three folk music orchestras in Trondheim. I also like to swim, or to gab with my friends.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li><i>Team leader:</i> Teaching the other team members the basic cloning techniques used for biobrick assembly.</li><br />
<li><i>Team representative:</i> In case of interested journalists, I will talk to them. Rolf will be my manager and Nina my stylist! </li><br />
<li><i>Team dietitian:</i> One of my less serious responsibility areas is to make sure that all team members get their daily dose of carbohydrates (as we all agree that lowcarb is nonsense).</li><br />
<li><i>Vice PR chief</i>Rolf is the actual PR chief, but in case Rolf meets some really stubborn journalists, and he gives up, I'll take over</li></dd><br />
<dt>Fun fact:</dt><dd>I'm able to whistle and hum in two part harmony with myself. And no, I'm not mutated.</dd><br />
</dl><br />
</div><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/9/97/Nina.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Eidsvåg, Møre og Romsdal</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Nina Hole</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Sports enthusiast, but especially interested in football. I also play football myself on NTNU's own football team. Other interests are reading, traveling and food.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul><li><i>Gunvor's stylist</i>:If Gunvor is representing the team, I have the main responsibility to do her make-up and so on.</li><li><i>Photo chief</i>: If something needs photographing, Nina is on the job!</li></ul><br />
</dd><br />
<dt>Fun fact:</dt><dd><br />
My favorite author/musician Jo Nesbø, has named his main character in his criminal novels Harry Hole. His inspiration for the last name comes from my family! </dd><br />
</dl><br />
</div><br />
<br />
</div><br />
<div class="row-fluid"><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/9/9b/Jarle.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Drammen</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Jarle Pahr</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Aikido and psychology.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul><li><i>Master of the notebook:</i> Trying to get the other team members to update the notebook.</li><li><i>Cake chief: </i> Baking awesome cakes.</li></ul></dd><br />
<dt>Fun fact:</dt><dd>Is resistant to norovirus, thanks to a mutation in the FUT2 gene. Being a mutant is nice!</dd><br />
</dl><br />
</div><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/9/91/Eirin.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Larvik</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Eirin Korvald</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Music (both playing and listening), snowboarding, hiking, knitting, hanging with friends.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li><i>iGEM hair dresser:</i> Making sure the entire team has fabulous hair at all times.</li></dd><br />
</dl><br />
</div><br />
</div><br />
<br />
<br />
<div class="row-fluid"><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/6/6d/Ove.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Trondheim</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in biotechnology.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Ove Øyås</h2><br />
<dl><br />
<dt>Interests outside academia:</dt><dd>Nature, cycling, hiking, music, programming, being enthusiastic about stuff.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li><i>Internet chief:</i> Fixing the wiki and the Matchmaker. Making spaghetti code.</li></dd><br />
<dt>Fun fact:</dt><dd>Will easily eat raw ginger and garlic.</dd><br />
</dl><br />
</div><br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/6/66/Rolf.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Trondheim</dd><br />
<dt>Study program:</dt><dd>M.Sc. in Chemical engineering and biotechnology at NTNU, with specialization in applied theoretical chemistry.</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Rolf Heilemann Myhre</h2><br />
<dl><br />
<dt>Interests outside Academia:</dt><dd>In my spare time, I like exercising, hanging with friends, partying, movies etc. Also, I can't live without my computer.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul>Modelling the genetic circuit.</dd><br />
<dt>Fun fact:</dt><dd>I have not studied any biotechnology before joining the iGEM team.</dd><br />
</dl><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<div class="page-header"><br />
<h1>The advisors</h1><br />
</div><br />
<br />
<div class="row-fluid"><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/d/de/Eivind.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Stavanger, Norway</dd><br />
<dt>Position:</dt><dd>Professor</dd><br />
</div> <br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Eivind Almaas</h2><br />
<dl><br />
<dt>Area of expertise:</dt><dd>Systems biology and network analysis</dd><br />
<dt>Interests outside academia:</dt><dd>Hiking, reading, living.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li>Team organization.</li><li>Computer modelling.</li></dd><br />
<dt>Fun fact:</dt><dd>Big fan of 50's Rock'n Roll and Rockabilly.</dd><br />
<br />
<br />
<br />
</dl><br />
</div><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/4/4b/Rahmi.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Cologne, Germany</dd><br />
<dt>Position:</dt><dd>Postdoctoral fellow</dd><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Rahmi Lale</h2><br />
<dl><br />
<dt>Area of expertise:</dt><dd>Transcriptional and translational regulation of bacterial gene<br />
expression, metabolic engineering. Metagenome/biodiscovery.</dd><br />
<dt>Interests outside academia:</dt><dd> Loves playing bass, likes biking/hiking/skiing/fishing/sailing, into web/graphic design.</dd><br />
<dt>Areas of responsibility:</dt><dd>Herding the nerds!</dd><br />
<dt>Fun fact:</dt><dd>He loves bugs so much that he makes his own kefir.</dd><br />
</dl><br />
</div><br />
<br />
</div><br />
<br />
<div class="row-fluid"><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/d/d8/Martin.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Mannheim, Germany</dd><br />
<dt>Position:</dt><dd>Associate professor</dd></div><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Martin Hohmann-Marriott</h2><br />
<dl><br />
<dt>Area of expertise:</dt><dd>Photosynthesis, bioenergetics, molecular biology.</dd><br />
<dt>Interests outside academia:</dt><dd>My family, history, all things computer and technology</dd><br />
<dt>Areas of responsibility:</dt><dd>Instructor, molecular biology and physiology<br />
</dd><br />
<dt>Fun fact:</dt><dd>Martin designed exercise equipment for ants as an undergraduate.</dd><br />
</dl><br />
</div><br />
<br />
<br />
<div class="span2"><br />
<br />
<a href="#"><img alt="" src="https://static.igem.org/mediawiki/2012/1/19/Marius.png" class="img-circle"></a><br />
<dl><div class="well well-small"><br />
<dt>Origin of replication:</dt><dd>Kristiansand, Norway</dd><br />
<dt>Position:</dt><dd>Doctoral student. Graduated M.Sc. in Physics and mathematics from NTNU.</dd><br />
</dl><br />
</div><br />
<div class="span4"><br />
<h2>Marius Eidsaa</h2><br />
<dl><br />
<br />
<dt>Area of expertise:</dt><dd>Systems biology, mainly focusing on networks, both generally and in biology. I'm currently working on network methods and analysis of microarray data..</dd><br />
<dt>Interests outside academia:</dt><dd>I like to sing, and I'm currently singing tenor in two student-society based choirs. Other interests include music in general, food and drink and good company.</dd><br />
<dt>Areas of responsibility:</dt><dd><ul> <li>I'm a modelling instructor, so my main responsibility is to help set up and analyze our model.</li></dd><br />
<dt>Fun fact:</dt><dd>Has been swimming at a national level.</dd><br />
</dl><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
</html><br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T22:41:12Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
<br />
==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Parts parts page].<br />
<br />
Most of the biobricks we decided to use were already present in the registry, but we also needed biobricks with certain properties that were not present in the registry. These we had to make ourselves. The new bricks we made, and which we also characterized, are the following; <br />
<br />
* a protein coding brick for colicin E1, <br />
<br />
* a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, <br />
<br />
* the lld promotor + RBS from ''E.coli'', <br />
<br />
* the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===Colicin (<partinfo>BBa_K822002</partinfo>)===<br />
<br />
Colicin is the protein we have chosen as toxin in our bacterial anti-cancer-kamikaze device. We amplified the brick using <partinfo>BBa_K150009</partinfo> as template. The brick contains protein coding sequences both for Colicin E1 and for colicin immunity protein. The following primers were used:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Colicin fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatggaaaccgcggtagcgta<br />
|-<br />
|Colicin rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcgatggtccctccctgaa<br />
|}<br />
<br />
<br />
To test if the our colicin brick worked, we cloned it together with a constitutive promoter + RBS <partinfo>BBa_K081005</partinfo>. Then, we grew overnight cultures with the Promoter+RBS+Colicin construct, and also with a negative control. The negative control were different in different experiments, but were always cells containing a non-expressing plasmid with ampicillin resistance, since the plasmid colicin was tested in, also had ampicillin resistance. <br />
After about 24 hours, LB was replaced with breaking buffer and the cells were sonicated. The lysed cells were centrifuged at 16000 g for 15 minutes to remove cell fragments, and the 3 ml lysate was added to a new 10 ml culture of newly inoculated ''E.coli'' cells with ampicillin resistance, but without the colicin immunity protein. Samples were taken regularly, and OD was measured. <br />
We performed two experiments; one experiment with two parallel cell cultures, where one was containing colicin and the other buffer (1), and one experiment with two parallels of cells with colicin lysate added, and one with lysate of non-colicin-producing cells added (2). The latter experiment was performed to prove that no other proteins expressed by the cells inhibited growth in other cells. The results of the experiments are given below:<br />
<br />
{|<br />
|[[File:Colicin2.png|500px]]<br />
|-<br />
|OD measured over time in cell cultures with added colicin lysate (red dots) and buffer (blue dots)<br />
|}<br />
<br />
{|<br />
|[[File:Colicin1.png|500px]]<br />
|-<br />
|OD measured over time in two parallel cell cultures with added colicin lysate (red and purple dots) and lysate of non-colicin-producing cells (blue dots)<br />
|}<br />
<br />
Both experiments show that the cells without added colicin lysate has a significantly higher growth rate than the cells where colicin lysate was added. <br />
<br />
<br />
===YFP generator (<partinfo>BBa_K822003</partinfo>)===<br />
<br />
We made the YFP generator to verify that the YFP coding sequence worked, in order to use it in experiments verifying that the Vgb promoter worked. The YFP generator was cloned together from a constitutive promoter + RBS (<partinfo>BBa_K081005</partinfo>), YFP (<partinfo>BBa_E0030</partinfo>) and a double terminator (<partinfo>BBa_B0015</partinfo>).<br />
<br />
To verify that the YFP generator worked, cells containing the YFP generator plasmid and cells containing plasmids with YFP without promoter, RBS or terminator (only BBa_E0030), and plasmids containing Vgb+RBS+YFP+terminator (<partinfo>BBa_K561001</partinfo>+<partinfo>BBa_E0030</partinfo>) was grown overnight, and fluorescence measured. The emission wavelength was 544 nm, and 514 nm was used for exitation. Four parallel measurements were carried out. The result of the measurement can be seen below:<br />
<br />
{|border="0"<br />
|[[File:YFP_fluorescence.png|500px]]<br />
|-<br />
|Fluorescence measured in Constitutive promoter+RBS+YFP+terminator, YFP, and Vgb+RBS+YFP<br />
|}<br />
<br />
Even though we were not able to prove that the Vgb promoter works, we proved that the YFP generator works, as the fluorescence divided by OD is much higher for cells containing this biobrick, than for example for cells containing plasmids with only YFP.<br />
<br />
===Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)===<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, however the resulting fragments were not as expected. This is why we thought of this biobrick as a suitable candidate for improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator are present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0"<br />
|[[File:Testkutt_BBa_K292006.png|x300px]]<br />
|[[File:RBS+LacI+term-gel.PNG|x300px]]<br />
|-<br />
|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.<br />
|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp). The fragments cut with NotI makes sense on gel. In the case of cutting with XbaI+PstI, we did not expect three fragments, but the upper fragment could be uncut plasmid, since the lower fragments makes sense. <br />
|}<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate-induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ATC 13032 as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but sequencing indicated a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T22:37:50Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
<br />
==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Parts parts page].<br />
<br />
Most of the biobricks we decided to use were already present in the registry, but we also needed biobricks with certain properties that were not present in the registry. These we had to make ourselves. The new bricks we made, and which we also characterized, are the following; <br />
<br />
* a protein coding brick for colicin E1, <br />
<br />
* a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, <br />
<br />
* the lld promotor + RBS from ''E.coli'', <br />
<br />
* the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===Colicin (<partinfo>BBa_K822002</partinfo>)===<br />
<br />
Colicin is the protein we have chosen as toxin in our bacterial anti-cancer-kamikaze device. We amplified the brick using <partinfo>BBa_K150009</partinfo> as template. The brick contains protein coding sequences both for Colicin E1 and for colicin immunity protein. The following primers were used:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Colicin fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatggaaaccgcggtagcgta<br />
|-<br />
|Colicin rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcgatggtccctccctgaa<br />
|}<br />
<br />
<br />
To test if the our colicin brick worked, we cloned it together with a constitutive promoter + RBS <partinfo>BBa_K081005</partinfo>. Then, we grew overnight cultures with the Promoter+RBS+Colicin construct, and also with a negative control. The negative control were different in different experiments, but were always cells containing a non-expressing plasmid with ampicillin resistance, since the plasmid colicin was tested in, also had ampicillin resistance. <br />
After about 24 hours, LB was replaced with breaking buffer and the cells were sonicated. The lysed cells were centrifuged at 16000 g for 15 minutes to remove cell fragments, and the 3 ml lysate was added to a new 10 ml culture of newly inoculated ''E.coli'' cells with ampicillin resistance, but without the colicin immunity protein. Samples were taken regularly, and OD was measured. <br />
We performed two experiments; one experiment with two parallel cell cultures, where one was containing colicin and the other buffer (1), and one experiment with two parallels of cells with colicin lysate added, and one with lysate of non-colicin-producing cells added (2). The latter experiment was performed to prove that no other proteins expressed by the cells inhibited growth in other cells. The results of the experiments are given below:<br />
<br />
{|<br />
|[[File:Colicin2.png|500px]]<br />
|-<br />
|OD measured over time in cell cultures with added colicin lysate (red dots) and buffer (blue dots)<br />
|}<br />
<br />
{|<br />
|[[File:Colicin1.png|500px]]<br />
|-<br />
|OD measured over time in two parallel cell cultures with added colicin lysate (red and purple dots) and lysate of non-colicin-producing cells (blue dots)<br />
|}<br />
<br />
Both experiments show that the cells without added colicin lysate has a significantly higher growth rate than the cells where colicin lysate was added. <br />
<br />
<br />
===YFP generator (<partinfo>BBa_K822003</partinfo>)<br />
<br />
We made the YFP generator to verify that the YFP coding sequence worked, in order to use it in experiments verifying that the Vgb promoter worked. The YFP generator was cloned together from a constitutive promoter + RBS (<partinfo>BBa_K081005</partinfo>), YFP (<partinfo>BBa_E0030</partinfo>) and a double terminator (<partinfo>BBa_B0015</partinfo>).<br />
<br />
To verify that the YFP generator worked, cells containing the YFP generator plasmid and cells containing plasmids with YFP without promoter, RBS or terminator (only BBa_E0030), and plasmids containing Vgb+RBS+YFP+terminator (<partinfo>BBa_K561001</partinfo>+<partinfo>BBa_E0030</partinfo>) was grown overnight, and fluorescence measured. The emission wavelength was 544 nm, and 514 nm was used for exitation. Four parallel measurements were carried out. The result of the measurement can be seen below:<br />
<br />
{|border="0"<br />
|[[File:YFP_fluorescence.png|500px]]<br />
|-<br />
|Fluorescence measured in Constitutive promoter+RBS+YFP+terminator, YFP, and Vgb+RBS+YFP<br />
|}<br />
<br />
Even though we were not able to prove that the Vgb promoter works, we proved that the YFP generator works, as the fluorescence divided by OD is much higher for cells containing this biobrick, than for example for cells containing plasmids with only YFP.<br />
<br />
===Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)===<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, however the resulting fragments were not as expected. This is why we thought of this biobrick as a suitable candidate for improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator are present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0"<br />
|[[File:Testkutt_BBa_K292006.png|x300px]]<br />
|[[File:RBS+LacI+term-gel.PNG|x300px]]<br />
|-<br />
|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.<br />
|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp). The fragments cut with NotI makes sense on gel. In the case of cutting with XbaI+PstI, we did not expect three fragments, but the upper fragment could be uncut plasmid, since the lower fragments makes sense. <br />
|}<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate-induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ATC 13032 as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but sequencing indicated a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T22:37:08Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
<br />
==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Parts parts page].<br />
<br />
Most of the biobricks we decided to use were already present in the registry, but we also needed biobricks with certain properties that were not present in the registry. These we had to make ourselves. The new bricks we made, and which we also characterized, are the following; <br />
<br />
* a protein coding brick for colicin E1, <br />
<br />
* a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, <br />
<br />
* the lld promotor + RBS from ''E.coli'', <br />
<br />
* the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===Colicin (<partinfo>BBa_K822002</partinfo>)===<br />
<br />
Colicin is the protein we have chosen as toxin in our bacterial anti-cancer-kamikaze device. We amplified the brick using <partinfo>BBa_K150009</partinfo> as template. The brick contains protein coding sequences both for Colicin E1 and for colicin immunity protein. The following primers were used:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Colicin fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatggaaaccgcggtagcgta<br />
|-<br />
|Colicin rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcgatggtccctccctgaa<br />
|}<br />
<br />
<br />
To test if the our colicin brick worked, we cloned it together with a constitutive promoter + RBS <partinfo>BBa_K081005</partinfo>. Then, we grew overnight cultures with the Promoter+RBS+Colicin construct, and also with a negative control. The negative control were different in different experiments, but were always cells containing a non-expressing plasmid with ampicillin resistance, since the plasmid colicin was tested in, also had ampicillin resistance. <br />
After about 24 hours, LB was replaced with breaking buffer and the cells were sonicated. The lysed cells were centrifuged at 16000 g for 15 minutes to remove cell fragments, and the 3 ml lysate was added to a new 10 ml culture of newly inoculated ''E.coli'' cells with ampicillin resistance, but without the colicin immunity protein. Samples were taken regularly, and OD was measured. <br />
We performed two experiments; one experiment with two parallel cell cultures, where one was containing colicin and the other buffer (1), and one experiment with two parallels of cells with colicin lysate added, and one with lysate of non-colicin-producing cells added (2). The latter experiment was performed to prove that no other proteins expressed by the cells inhibited growth in other cells. The results of the experiments are given below:<br />
<br />
{|<br />
|[[File:Colicin2.png|300px]]<br />
|-<br />
|OD measured over time in cell cultures with added colicin lysate (red dots) and buffer (blue dots)<br />
|}<br />
<br />
{|<br />
|[[File:Colicin1.png|300px]]<br />
|-<br />
|OD measured over time in two parallel cell cultures with added colicin lysate (red and purple dots) and lysate of non-colicin-producing cells (blue dots)<br />
|}<br />
<br />
Both experiments show that the cells without added colicin lysate has a significantly higher growth rate than the cells where colicin lysate was added. <br />
<br />
<br />
===YFP generator (<partinfo>BBa_K822003</partinfo>)<br />
<br />
We made the YFP generator to verify that the YFP coding sequence worked, in order to use it in experiments verifying that the Vgb promoter worked. The YFP generator was cloned together from a constitutive promoter + RBS (<partinfo>BBa_K081005</partinfo>), YFP (<partinfo>BBa_E0030</partinfo>) and a double terminator (<partinfo>BBa_B0015</partinfo>).<br />
<br />
To verify that the YFP generator worked, cells containing the YFP generator plasmid and cells containing plasmids with YFP without promoter, RBS or terminator (only BBa_E0030), and plasmids containing Vgb+RBS+YFP+terminator (<partinfo>BBa_K561001</partinfo>+<partinfo>BBa_E0030</partinfo>) was grown overnight, and fluorescence measured. The emission wavelength was 544 nm, and 514 nm was used for exitation. Four parallel measurements were carried out. The result of the measurement can be seen below:<br />
<br />
{|border="0"<br />
|[[File:YFP_fluorescence.png|300px]]<br />
|-<br />
|Fluorescence measured in Constitutive promoter+RBS+YFP+terminator, YFP, and Vgb+RBS+YFP<br />
|}<br />
<br />
Even though we were not able to prove that the Vgb promoter works, we proved that the YFP generator works, as the fluorescence divided by OD is much higher for cells containing this biobrick, than for example for cells containing plasmids with only YFP.<br />
<br />
===Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)===<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, however the resulting fragments were not as expected. This is why we thought of this biobrick as a suitable candidate for improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator are present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0"<br />
|[[File:Testkutt_BBa_K292006.png|x300px]]<br />
|[[File:RBS+LacI+term-gel.PNG|x300px]]<br />
|-<br />
|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.<br />
|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp). The fragments cut with NotI makes sense on gel. In the case of cutting with XbaI+PstI, we did not expect three fragments, but the upper fragment could be uncut plasmid, since the lower fragments makes sense. <br />
|}<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate-induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ATC 13032 as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but sequencing indicated a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/File:YFP_fluorescence.pngFile:YFP fluorescence.png2012-09-26T22:16:33Z<p>Gunvor: </p>
<hr />
<div></div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T22:13:15Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
<br />
==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Parts parts page].<br />
<br />
Most of the biobricks we decided to use were already present in the registry, but we also needed biobricks with certain properties that were not present in the registry. These we had to make ourselves. The new bricks we made, and which we also characterized, are the following; <br />
<br />
* a protein coding brick for colicin E1, <br />
<br />
* a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, <br />
<br />
* the lld promotor + RBS from ''E.coli'', <br />
<br />
* the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===Colicin (<partinfo>BBa_K822002</partinfo>)===<br />
<br />
Colicin is the protein we have chosen as toxin in our bacterial anti-cancer-kamikaze device. We amplified the brick using <partinfo>BBa_K150009</partinfo> as template. The brick contains protein coding sequences both for Colicin E1 and for colicin immunity protein. The following primers were used:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Colicin fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatggaaaccgcggtagcgta<br />
|-<br />
|Colicin rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcgatggtccctccctgaa<br />
|}<br />
<br />
<br />
To test if the our colicin brick worked, we cloned it together with a constitutive promoter + RBS <partinfo>BBa_K081005</partinfo>. Then, we grew overnight cultures with the Promoter+RBS+Colicin construct, and also with a negative control. The negative control were different in different experiments, but were always cells containing a non-expressing plasmid with ampicillin resistance, since the plasmid colicin was tested in, also had ampicillin resistance. <br />
After about 24 hours, LB was replaced with breaking buffer and the cells were sonicated. The lysed cells were centrifuged at 16000 g for 15 minutes to remove cell fragments, and the 3 ml lysate was added to a new 10 ml culture of newly inoculated ''E.coli'' cells with ampicillin resistance, but without the colicin immunity protein. Samples were taken regularly, and OD was measured. <br />
We performed two experiments; one experiment with two parallel cell cultures, where one was containing colicin and the other buffer (1), and one experiment with two parallels of cells with colicin lysate added, and one with lysate of non-colicin-producing cells added (2). The latter experiment was performed to prove that no other proteins expressed by the cells inhibited growth in other cells. The results of the experiments are given below:<br />
<br />
{|<br />
|[[File:Colicin2.png|300px]]<br />
|-<br />
|OD measured over time in cell cultures with added colicin lysate (red dots) and buffer (blue dots)<br />
|}<br />
<br />
{|<br />
|[[File:Colicin1.png|300px]]<br />
|-<br />
|OD measured over time in two parallel cell cultures with added colicin lysate (red and purple dots) and lysate of non-colicin-producing cells (blue dots)<br />
|}<br />
<br />
Both experiments show that the cells without added colicin lysate has a significantly higher growth rate than the cells where colicin lysate was added. <br />
<br />
<br />
===Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)===<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, however the resulting fragments were not as expected. This is why we thought of this biobrick as a suitable candidate for improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator are present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0"<br />
|[[File:Testkutt_BBa_K292006.png|x300px]]<br />
|[[File:RBS+LacI+term-gel.PNG|x300px]]<br />
|-<br />
|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.<br />
|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp). The fragments cut with NotI makes sense on gel. In the case of cutting with XbaI+PstI, we did not expect three fragments, but the upper fragment could be uncut plasmid, since the lower fragments makes sense. <br />
|}<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate-induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ATC 13032 as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but sequencing indicated a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T22:01:31Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
<br />
==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Parts parts page].<br />
<br />
Most of the biobricks we decided to use were already present in the registry, but we also needed biobricks with certain properties that were not present in the registry. These we had to make ourselves. The new bricks we made, and which we also characterized, are the following; <br />
<br />
* a protein coding brick for colicin E1, <br />
<br />
* a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, <br />
<br />
* the lld promotor + RBS from ''E.coli'', <br />
<br />
* the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===Colicin (<partinfo>BBa_K822002</partinfo>)===<br />
<br />
Colicin is the protein we have chosen as toxin in our bacterial anti-cancer-kamikaze device. We amplified the brick using <partinfo>BBa_K150009</partinfo> as template. The brick contains protein coding sequences both for Colicin E1 and for colicin immunity protein. The following primers were used:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Colicin fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatggaaaccgcggtagcgta<br />
|-<br />
|Colicin rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcgatggtccctccctgaa<br />
|}<br />
<br />
To test if the our colicin brick worked, we cloned it together with a constitutive promoter + RBS <partinfo>BBa_K081005</partinfo>. Then, we grew overnight cultures with the Promoter+RBS+Colicin construct, and also with a negative control. The negative control were different in different experiments, but were always cells containing a non-expressing plasmid with ampicillin resistance, since the plasmid colicin was tested in, also had ampicillin resistance. <br />
<br />
<br />
===Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)===<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, however the resulting fragments were not as expected. This is why we thought of this biobrick as a suitable candidate for improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator are present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0"<br />
|[[File:Testkutt_BBa_K292006.png|x300px]]<br />
|[[File:RBS+LacI+term-gel.PNG|x300px]]<br />
|-<br />
|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.<br />
|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp). The fragments cut with NotI makes sense on gel. In the case of cutting with XbaI+PstI, we did not expect three fragments, but the upper fragment could be uncut plasmid, since the lower fragments makes sense. <br />
|}<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate-induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ATC 13032 as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but sequencing indicated a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/File:Colisin2.pngFile:Colisin2.png2012-09-26T21:43:19Z<p>Gunvor: </p>
<hr />
<div></div>Gunvorhttp://2012.igem.org/File:Colisin1.pngFile:Colisin1.png2012-09-26T21:43:00Z<p>Gunvor: </p>
<hr />
<div></div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T21:24:38Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
<br />
==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Parts parts page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use were already present in the registry, but we also needed biobricks with certain properties that were not present in the registry. These we had to make ourselves. The new bricks we made, and which we also characterized, are the following; <br />
<br />
. a protein coding brick for colicin E1, <br />
<br />
. a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, <br />
<br />
. the lld promotor + RBS from ''E.coli'', <br />
<br />
. and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===Colicin (<partinfo>BBa_K822002</partinfo>)===<br />
<br />
Colicin is the protein we have chosen as toxin in our bacterial anti-cancer-kamikaze device. <br />
<br />
<br />
===Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)===<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, however the resulting fragments were not as expected. This is why we thought of this biobrick as a suitable candidate for improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator are present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0"<br />
|[[File:Testkutt_BBa_K292006.png|x300px]]<br />
|[[File:RBS+LacI+term-gel.PNG|x300px]]<br />
|-<br />
|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.<br />
|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp). The fragments cut with NotI makes sense on gel. In the case of cutting with XbaI+PstI, we did not expect three fragments, but the upper fragment could be uncut plasmid, since the lower fragments makes sense. <br />
|}<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate-induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ATC 13032 as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but sequencing indicated a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T20:15:37Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
<br />
==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===Colicin (<partinfo>BBa_K822002</partinfo>)===<br />
<br />
Colicin is the protein we have chosen as toxin in our bacterial anti-cancer-kamikaze device. <br />
<br />
<br />
===Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)===<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, but the fragments were either not as expected. This is why we thought this biobrick was a good candidate for an improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator is present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0"<br />
|[[File:Testkutt_BBa_K292006.png|x300px]]<br />
|[[File:RBS+LacI+term-gel.PNG|x300px]]<br />
|-<br />
|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.<br />
|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp). The fragments cut with NotI makes sense on gel. In the case of cutting with XbaI+PstI, we did not expect three fragments, but the upper fragment could be uncut plasmid, since the lower fragments makes sense. <br />
|}<br />
<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to possibly being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ATC 13032 as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but also this was sent to sequencing, and had a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T19:52:29Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
<br />
==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)===<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, but the fragments were either not as expected. This is why we thought this biobrick was a good candidate for an improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator is present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0"<br />
|[[File:Testkutt_BBa_K292006.png|x300px]]<br />
|[[File:RBS+LacI+term-gel.PNG|x300px]]<br />
|-<br />
|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.<br />
|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp). The fragments cut with NotI makes sense on gel. In the case of cutting with XbaI+PstI, we did not expect three fragments, but the upper fragment could be uncut plasmid, since the lower fragments makes sense. <br />
|}<br />
<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to possibly being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ATC 13032 as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but also this was sent to sequencing, and had a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T19:44:09Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
<br />
==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)===<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, but the fragments were either not as expected. This is why we thought this biobrick was a good candidate for an improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator is present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0"<br />
|[[File:Testkutt_BBa_K292006.png|x300px]]<br />
|[[File:RBS+LacI+term-gel.PNG|x300px]]<br />
|-<br />
|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.<br />
|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp). The fragments cut with NotI makes sense on gel. In the case of cutting with XbaI+PstI, we did not expect three fragments, but the upper fragment could be uncut plasmid, since the lower fragments makes sense. <br />
|}<br />
<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to possibly being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ER#### as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but also this was sent to sequencing, and had a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T19:41:47Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
<br />
==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)===<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, but the fragments were either not as expected. This is why we thought this biobrick was a good candidate for an improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator is present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0"<br />
|[[File:Testkutt_BBa_K292006.png|x300px]]<br />
|[[File:RBS+LacI+term-gel.PNG|x300px]]<br />
|-<br />
|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.<br />
|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp).<br />
|}<br />
<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to possibly being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ER#### as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but also this was sent to sequencing, and had a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T19:38:24Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
<br />
==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)===<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, but the fragments were either not as expected. This is why we thought this biobrick was a good candidate for an improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator is present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0"<br />
|[[File:Testkutt_BBa_K292006.png|300px]]<br />
|[[File:RBS+LacI+term-gel.PNG|300px]]<br />
|-<br />
|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), BglI+EcoRV (expected fragments: 1596 bp + 1760 bp) and BglI+BanII (expected fragments: 1521 bp + 1835 bp). The test cut shows that none of the expected fragments are present.<br />
|Test cut of our improved part performed with NotI (first red box, expected fragments: 1276 bp + 2055 bp) and XbaI+PstI (second red box, expected fragments: 1278 bp + 2053 bp).<br />
<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to possibly being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ER#### as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but also this was sent to sequencing, and had a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T19:21:39Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
<br />
==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)===<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, but the fragments were either not as expected. This is why we thought this biobrick was a good candidate for an improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [https://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_Construct here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator is present.<br />
<br />
Both <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo> was also investigated using gel electrophoresis. The gel pictures are given below:<br />
<br />
{|border="0"<br />
|[[File:Testkutt_BBa_K292006.png|300px]]<br />
|[[File:RBS+LacI+term-gel.PNG|300px]]<br />
|-<br />
|This is the test cut of BBa_K292006 that the NTNU iGEM team 2011 performed. The testcut was performed with EcoRI+PstI (expected fragments: 1303 bp + 2053 bp), BglI+BclI (expected fragments: 1324 bp + 2032 bp), <br />
<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to possibly being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ER#### as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but also this was sent to sequencing, and had a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/File:Testkutt_BBa_K292006.pngFile:Testkutt BBa K292006.png2012-09-26T19:01:40Z<p>Gunvor: </p>
<hr />
<div></div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_ConstructTeam:NTNU Trondheim/Sequencing Improved Construct2012-09-26T18:58:38Z<p>Gunvor: </p>
<hr />
<div>===Theoretical sequence of BBa_K822004, and sequencing results of <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo>===<br />
<br />
Theoretical sequence of BBa_K822004:<br />
<br />
ATTAAAGAGGAGAAATACTAGATGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCA<br />
GAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTT<br />
TCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAAC<br />
CGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGT<br />
CTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTG<br />
GGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCG<br />
GTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGAC<br />
CAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTC<br />
TCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGC<br />
GTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGT<br />
TCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATT<br />
CAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATG<br />
CAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCG<br />
CTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTA<br />
GTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAA<br />
CAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGC<br />
CAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTG<br />
GCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCA<br />
CGACAGGTTTCCCGACTGGAAAGCGGGCAGGCTGCAAACGACGAAAACTACGCTTTAGTA<br />
GCTTAATAATACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATA<br />
CTAGAGAGAGAATATAAAAAGCCAGATTATTAATCCGGCTTTTTTATTATTTTACTAGTA<br />
GCGGCCGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCG<br />
AGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGC<br />
AGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTT<br />
GCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAG<br />
TCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTC<br />
CCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCC<br />
TTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGT<br />
CGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTT<br />
ATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGC<br />
AGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAA<br />
GTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAA<br />
GCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGG<br />
TAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGA<br />
AGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGG<br />
GATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATG<br />
AAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTT<br />
AATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACT<br />
CCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAAT<br />
GATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGG<br />
AAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTG<br />
TTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCAT<br />
TGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTC<br />
CCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTT<br />
CGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGC<br />
AGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGA<br />
GTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGC<br />
GTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAA<br />
ACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTA<br />
ACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTG<br />
AGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTG<br />
AATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCAT<br />
GAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATT<br />
TCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAA<br />
AAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGA<br />
TGATTTCTGGAATTCGCGGCCGCTTCTAGAG<br />
<br />
The features of this biobrick are as follows:<br />
{|border="0"<br />
|RBS<br />
|1-15<br />
|-<br />
|LacI<br />
|22-1149<br />
|-<br />
|Double terminator<br />
|1158-1252<br />
|}<br />
<br />
Sequencing results of <partinfo>BBa_K822004</partinfo>:<br />
<br />
TAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATTAAAGAGGAGAAATACTAGATG<br />
GTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAG<br />
ACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTG<br />
GAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGC<br />
AAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA<br />
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATG<br />
GTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGC<br />
GTCAGTGGGCTGATCATTAACTATCCGCTGGATGACAGGATGCCATTGCTGTGGAAGCTG<br />
CCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTA<br />
TTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTC<br />
ACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGG<br />
CTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCG<br />
ACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTC<br />
CCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCG<br />
AGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACA<br />
GCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAA<br />
CCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGT<br />
TGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTC<br />
CCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCG<br />
GGCAGGCTGCAAACGACGAAAACTACGCTTTAGTAGCTTAATAACTCTGATAGTGCTAGT<br />
GTAGATCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATA<br />
CTAGAGAGAGAATATAAAAAGCCAGATATA<br />
<br />
Sequencing results of <partinfo>BBa_K292006</partinfo> sequenced from the beginning of the brick:<br />
<br />
TCCTTTAGCTTTCGCTAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTCACACTGG<br />
CTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGAGAGAGAATATAAAAAGCCAGA<br />
TTATTAATCCGGCTTTTTTATTATTTTACTAGATGTCCAGATTAGATAAAAGTAAAGTGA<br />
TTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAAC<br />
TCGCCCAGAAGCTAGGTGTAGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGG<br />
CTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTT<br />
TAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTT<br />
TACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGT<br />
ATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATG<br />
CATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAG<br />
AGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTAT<br />
TACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCC<br />
TTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCCGCTGCAA<br />
ACGACGAAAACTACGCTTTAGTAGCTTAATAACACTGATAGTGCTAGTGTAGATCACTAC<br />
TAGTAGCGGCCGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG<br />
CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGATA<br />
ACGCAGA<br />
<br />
Sequencing results of <partinfo>BBa_K292006</partinfo> sequenced from the end of the brick:<br />
<br />
GGGTTATGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGG<br />
GTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATG<br />
ACATTAACCTATAAAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTA<br />
GCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTCACACTGGCTCACC<br />
TTCGGGTGGGCCTTTCTGCGTTTATATACTAGAGAGAGAATATAAAAAGCCAGATTATTA<br />
ATCCGGCTTTTTTATTATTTTACTAGATGTCCAGATTAGATAAAAGTAAAGTGATTAACA<br />
GCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCC<br />
AGAAGCTAGGTGTAGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCTTTGC<br />
TCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAG<br />
GGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAA<br />
GTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAA<br />
CTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTAT<br />
ATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATC<br />
AAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGAC<br />
AAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAAT<br />
TGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCCGCTGCAAACGACG<br />
AAAACTACGCTTTAGTAGCTTAATAACAC<br />
<br />
<partinfo>BBa_K822004</partinfo> was also sequenced both from the beginning and from the end of the biobrick. But in this case, the two sequencing results had an overlapping sequence of 665 bp, so the two sequencing results were merged to one before comparing with the theoretical sequence. <br />
<br />
In the case of <partinfo>BBa_K292006</partinfo>, aligning the sequencing results did not make any sense, so the two sequencing results are given separately. But neither of the two sequencing results confirmed the existense of RBS and LacI in <partinfo>BBa_K292006</partinfo>, only the terminator.</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Sequencing_Improved_ConstructTeam:NTNU Trondheim/Sequencing Improved Construct2012-09-26T18:55:05Z<p>Gunvor: Created page with "===Theoretical sequence of BBa_K822004, and sequencing results of <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo>=== Theoretical sequence of BBa_K822004: ..."</p>
<hr />
<div>===Theoretical sequence of BBa_K822004, and sequencing results of <partinfo>BBa_K822004</partinfo> and <partinfo>BBa_K292006</partinfo>===<br />
<br />
Theoretical sequence of BBa_K822004:<br />
<br />
ATTAAAGAGGAGAAATACTAGATGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCA<br />
GAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTT<br />
TCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAAC<br />
CGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGT<br />
CTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTG<br />
GGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCG<br />
GTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGAC<br />
CAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTC<br />
TCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGC<br />
GTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGT<br />
TCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATT<br />
CAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATG<br />
CAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCG<br />
CTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTA<br />
GTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAA<br />
CAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGC<br />
CAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTG<br />
GCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCA<br />
CGACAGGTTTCCCGACTGGAAAGCGGGCAGGCTGCAAACGACGAAAACTACGCTTTAGTA<br />
GCTTAATAATACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATA<br />
CTAGAGAGAGAATATAAAAAGCCAGATTATTAATCCGGCTTTTTTATTATTTTACTAGTA<br />
GCGGCCGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCG<br />
AGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGC<br />
AGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTT<br />
GCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAG<br />
TCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTC<br />
CCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCC<br />
TTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGT<br />
CGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTT<br />
ATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGC<br />
AGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAA<br />
GTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAA<br />
GCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGG<br />
TAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGA<br />
AGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGG<br />
GATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATG<br />
AAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTT<br />
AATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACT<br />
CCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAAT<br />
GATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGG<br />
AAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTG<br />
TTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCAT<br />
TGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTC<br />
CCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTT<br />
CGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGC<br />
AGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGA<br />
GTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGC<br />
GTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAA<br />
ACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTA<br />
ACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTG<br />
AGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTG<br />
AATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCAT<br />
GAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATT<br />
TCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAA<br />
AAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGA<br />
TGATTTCTGGAATTCGCGGCCGCTTCTAGAG<br />
<br />
The features of this biobrick are as follows:<br />
{|border="0"<br />
|RBS<br />
|1-15<br />
|-<br />
|LacI<br />
|22-1149<br />
|-<br />
|Double terminator<br />
|1158-1252<br />
|}<br />
<br />
Sequencing results of <partinfo>BBa_822004</partinfo>:<br />
<br />
TAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATTAAAGAGGAGAAATACTAGATG<br />
GTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAG<br />
ACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTG<br />
GAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGC<br />
AAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA<br />
ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATG<br />
GTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGC<br />
GTCAGTGGGCTGATCATTAACTATCCGCTGGATGACAGGATGCCATTGCTGTGGAAGCTG<br />
CCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTA<br />
TTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTC<br />
ACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGG<br />
CTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCG<br />
ACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTC<br />
CCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCG<br />
AGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACA<br />
GCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAA<br />
CCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGT<br />
TGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTC<br />
CCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCG<br />
GGCAGGCTGCAAACGACGAAAACTACGCTTTAGTAGCTTAATAACTCTGATAGTGCTAGT<br />
GTAGATCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATA<br />
CTAGAGAGAGAATATAAAAAGCCAGATATA<br />
<br />
Sequencing results of <partinfo>BBa_K292006</partinfo> sequenced from the beginning of the brick:<br />
<br />
TCCTTTAGCTTTCGCTAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTCACACTGG<br />
CTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGAGAGAGAATATAAAAAGCCAGA<br />
TTATTAATCCGGCTTTTTTATTATTTTACTAGATGTCCAGATTAGATAAAAGTAAAGTGA<br />
TTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAAC<br />
TCGCCCAGAAGCTAGGTGTAGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGG<br />
CTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTT<br />
TAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTT<br />
TACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGT<br />
ATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATG<br />
CATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAG<br />
AGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTAT<br />
TACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCC<br />
TTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCCGCTGCAA<br />
ACGACGAAAACTACGCTTTAGTAGCTTAATAACACTGATAGTGCTAGTGTAGATCACTAC<br />
TAGTAGCGGCCGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG<br />
CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGATA<br />
ACGCAGA<br />
<br />
Sequencing results of <partinfo>BBa_K292006</partinfo> sequenced from the end of the brick:<br />
<br />
GGGTTATGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGG<br />
GTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATG<br />
ACATTAACCTATAAAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTA<br />
GCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTCACACTGGCTCACC<br />
TTCGGGTGGGCCTTTCTGCGTTTATATACTAGAGAGAGAATATAAAAAGCCAGATTATTA<br />
ATCCGGCTTTTTTATTATTTTACTAGATGTCCAGATTAGATAAAAGTAAAGTGATTAACA<br />
GCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCC<br />
AGAAGCTAGGTGTAGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCTTTGC<br />
TCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAG<br />
GGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAA<br />
GTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAA<br />
CTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTAT<br />
ATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATC<br />
AAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGAC<br />
AAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAAT<br />
TGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCCGCTGCAAACGACG<br />
AAAACTACGCTTTAGTAGCTTAATAACAC<br />
<br />
<partinfo>BBa_822004</partinfo> was also sequenced both from the beginning and from the end of the biobrick. But in this case, the two sequencing results had an overlapping sequence of 665 bp, so the two sequencing results were merged to one before comparing with the theoretical sequence. <br />
<br />
In the case of <partinfo>BBa_K292006</partinfo>, aligning the sequencing results did not make any sense, so the two sequencing results are given separately. But neither of the two sequencing results confirmed the existense of RBS and LacI in <partinfo>BBa_K292006</partinfo>, only the terminator.</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T18:35:16Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
<br />
==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)===<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, but the fragments were either not as expected. This is why we thought this biobrick was a good candidate for an improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006</partinfo>) to sequencing. The sequencing results can be found [ here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator is present.<br />
RBS+LacI+term-gel.PNG<br />
<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to possibly being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ER#### as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but also this was sent to sequencing, and had a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T18:31:58Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Experiments and results <small>How we tested our components and what we found out</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
<br />
==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===Regulative LacI generator (<partinfo>BBa_K822004</partinfo>)===<br />
<br />
We made this brick in an effort to improve an already existing biobrick. The brick we wanted to improve was <partinfo>BBa_K292006</partinfo>. The NTNU iGEM team 2011 tried to use this brick in their stress sensor, but did not get it to work. They also tried to test-cut it and investigate the fragments using gel electrophoresis, but the fragments were either not as expected. This is why we thought this biobrick was a good candidate for an improvement. <br />
Since it is a composite part, we cloned it together again from scratch, using RBS (<partinfo>BBa_B0030</partinfo>), LacI (<partinfo>BBa_C0012</partinfo>) and a double terminator (<partinfo>BBa_B0014</partinfo>).<br />
<br />
When the cloning work was done, we sent both our new biobrick and the old one (<partinfo>BBa_K292006>) to sequencing. The sequencing results can be found [ here]. The sequencing result shows that in the old biobrick, only the terminator is present, and no LacI or RBS. In our improved biobrick, both RBS, LacI and terminator is present.<br />
RBS+LacI+term-gel.PNG<br />
<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to possibly being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ER#### as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but also this was sent to sequencing, and had a 100 % match with the theoretical sequence.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/File:RBS%2BLacI%2Bterm-gel.PNGFile:RBS+LacI+term-gel.PNG2012-09-26T17:55:01Z<p>Gunvor: </p>
<hr />
<div></div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T17:35:29Z<p>Gunvor: </p>
<hr />
<div>==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to possibly being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ER#### as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGctctgttgcttaaat<br />
|-<br />
|Plld CgR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAggtgacctcttctctgaaacgg<br />
|}<br />
<br />
The promoter has not been properly characterized, but also this was sent to sequencing, and had a 100 % match with the theoretical sequence.</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T17:22:11Z<p>Gunvor: </p>
<hr />
<div>==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===lld promoter + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.<br />
<br />
<br />
===ldhA promoter + RBS from ''C.glutamicum'' (<partinfo>BBa_K822001</partinfo>)===<br />
<br />
We also amplified the ldhA promoter from ''Corynebacterium glutamicum''. This has similar properties as the lld promoter from ''E.coli'', so this promoter was also a candidate to possibly being used as the lactate inducable promoter in our project.<br />
The ldhA promoter was amplified using the genome of ''C.glutamicum'' ER#### as template, and the primers below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld CgR fwd<br />
|<br />
|-<br />
|Plld CgR rev<br />
|<br />
|}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T17:07:52Z<p>Gunvor: </p>
<hr />
<div>==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===lld promotor + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by the NCBI nucleotide database [[http://www.ncbi.nlm.nih.gov/nuccore/U00096.2 2]]. These primers in combination with the genome from ''E.coli'' K12 MG1655, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T15:02:08Z<p>Gunvor: </p>
<hr />
<div>==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===lld promotor + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>)===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by ##### [[ 2]]. These primers in combination with the genome from ''E.coli'' K12 ER####, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing in the official shipping plasmid, pSB1C3, and the sequencing result had a 100 % match with the theoretical sequence of the amplified Plld + RBS sequence in pSB1C3.</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T14:58:47Z<p>Gunvor: </p>
<hr />
<div>==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===lld promotor + RBS from ''E.coli'' (<partinfo>BBa_K822000</partinfo>===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].<br />
<br />
The primers used to amplify the sequence are given below:<br />
<br />
{|border="1"<br />
!Primer<br />
!Sequence<br />
|-<br />
|Plld EcR fwd<br />
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt<br />
|-<br />
|Plld EcR rev<br />
|GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc<br />
|}<br />
<br />
The capitalized letters of the primer sequences corresponds to the biobrick prefix and suffix. As template, we used the ''E.coli K12'' genome sequence provided by ##### [[ 2]]. These primers in combination with the genome from ''E.coli'' K12 ER####, yielded a biobrick consisting of the lld promoter including RBS (We called this brick Plld EcR, Ec because it is amplified from ''E.coli'', R because it contains RBS).<br />
<br />
We did not have sufficient time to test the Plld EcR biobrick, but it was sent to sequencing, and had a 100 % match with the theoretical promoter sequence taken from ####.</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T14:08:24Z<p>Gunvor: </p>
<hr />
<div>==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===lld promotor + RBS from ''E.coli''===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [[http://www.ncbi.nlm.nih.gov/pubmed/18263722 1]].</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T14:08:00Z<p>Gunvor: </p>
<hr />
<div>==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===lld promotor + RBS from ''E.coli''===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [http://www.ncbi.nlm.nih.gov/pubmed/18263722 [1]].</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/Experiments_and_ResultsTeam:NTNU Trondheim/Experiments and Results2012-09-26T14:07:19Z<p>Gunvor: Created page with "==Experiments and results== To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed..."</p>
<hr />
<div>==Experiments and results==<br />
<br />
To make a genetic circuit releasing colicin as a response to a low oxygen level and a high lactate level, we needed several biobricks. For a detailed list of all biobricks present in our construct, see the [https://2012.igem.org/Team:NTNU_Trondheim/Biobricks biobricks page]. A sketch showing our final construct built from all the necessary biobricks is also given below:<br />
<br />
* Bilde<br />
<br />
Most of the biobricks we decided to use was already present in the registry, but we also needed biobricks with certain properties that was not present in the registry. These we had to make ourselves. The new bricks we made, that we also characterized, are the following; a protein coding brick for colicin E1, a YFP-generator, a regulative LacI-generator, which is also an improvement of an already existing biobrick, the lld promotor + RBS from ''E.coli'', and the lld promotor + RBS from ''C.glutamicum''.<br />
<br />
This page will focus on the biobricks we have made, how we made them, and how we have characterized them to show that they work.<br />
<br />
<br />
===lld promotor + RBS from ''E.coli''===<br />
<br />
The two criteria we wanted fulfilled to initiate lysis and subsequent release of colicin were a low oxygen level and a high lactate level. A promoter activated by low oxygen level was already present in the registry (microaerobic Vgb promoter, <partinfo>BBa_K561001</partinfo>), but we found no suitable lactate induced promoter. Therefore, we decided to convert the promotor regulating the lldPRD operon in ''E.coli'' into a biobrick, and to use this biobrick in our project [http://www.ncbi.nlm.nih.gov/pubmed/18263722 1].</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/ProjectTeam:NTNU Trondheim/Project2012-09-26T10:25:19Z<p>Gunvor: /* Overview */</p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Project description <small>Bacterial Anti-Cancer Kamikaze explained</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
==Background==<br />
<br />
Cancer is the leading cause of death worldwide. In 2008 alone, 13% of all deaths (7,6 million people) were caused by cancer, and it is not likely that the number will decrease. Lifestyle diseases, for instance, are huge risk factors for developing cancer, and diseases like type 2 diabetes are increasing rapidly on a worldwide basis. [http://www.who.int/gho/publications/world_health_statistics/2012/en/index.html], [http://www.who.int/mediacentre/factsheets/fs312/en/].<br />
<br />
One of the most challenging aspects of cancer medicine is the difficulty of drug delivery directly at the tumor area. We therefore wanted to develop a system for specific drug delivery, to show that one of the most challenging medical problems can be solved by using synthetic biology. So we decided to make a system responding to factors specific for cancer cells, but without being too complicated [http://mct.aacrjournals.org/content/4/10/1636.full].<br />
In our system we want two different trigger factors, in order to lower the risk of releasing toxins in the healthy parts of the body. Our system is triggered by a low oxygen concentration and a high lactate concentration. <br />
<br />
When the ''E. coli'' detects these conditions, our system will activate the lysis genes, and the toxin will be released. <br />
Differentiated cells (“normal” cells) can produce high amount of lactate in an anaerobic environment, but this is not a normal environment for the cells in our body. Under normal circumstances, the differentiated cells will primarily metabolize glucose to carbon dioxide in the citric acid cycle (TCA), and have a very low production of lactate. Cancer cells behave differently. They produce large amounts of lactate regardless of the oxygen concentration in their surroundings [http://www.ncbi.nlm.nih.gov/pubmed/19460998], [http://cancerres.aacrjournals.org/content/58/7/1408.full.pdf+html]. The reason that we want to use oxygen as a trigger factor is that tumors exists in an environment deprived of oxygen [http://www.springerlink.com/content/a60537w7085574v4/].<br />
<br />
==Overview==<br />
<br />
Our goal for this years competition is to create a genetic circuit which enables ''E. coli'' cells to detect and attack cancer cells. To do this, the cells should produce a tumor inhibitor or toxin effective at killing cancer cells, and respond to environmental cues indicating the presence of cancer cells by undergoing [http://en.wikipedia.org/wiki/Lysis lysis], releasing the anti-cancer agent into the surrounding environment. In principle, bacteria could be used in "search and destroy" missions against cancer inside the human body. We wish to develop our genetic circuit as a proof-of-concept of one such strategy.<br />
<br />
A sketch of our current planned design for the circuit is shown below.<br />
<br />
[[File:Grønn_krets.png|thumb|center|600px|A sketch of our planned genetic circuit]]<br />
<br />
Ideally, the toxin should only be released if cancer cells are actually encountered, and never otherwise. To achieve this, the lysis-inducing part of the circuit should be regulated such that it is highly unlikely to activated in other situations. One possible way is to use a signal molecule that is solely associated with cancer cells to activate the lysis device. Another possibility is to use a combination of environmental cues that together indicate a high likelihood of cancer presence. We have chosen the latter strategy, and the environmental cues we aim to use are low O<sub>2</sub> and high lactate concentrations. <br />
<br />
Each of the two cues activates a separate gene, which encode different proteins. Together, these two proteins should activate the unit responsible for lysis. Therefore, if only one of the cues are present, the cell does not lyse, and toxin is not released in high levels. (Some leakage of toxin must be expected even under normal conditions with no activation of the circuit). Selective activation in the presence of cancer cells would be crucial for the concept to be effective in a medical situation. <br />
<br />
As shown in the sketch, we plan to express the toxin-producing gene with a constitutive promoter. This means that the toxin production always be on. Ideally, the toxin should be maximally effective against cancer cells and minimally toxic to the toxin-producing cell. We have evaluated several candidate molecules. At the moment, we are leaning towards using the protein [http://proteopedia.org/wiki/index.php/Colicin_E1 Colicin E1].<br />
<br />
==Details==<br />
<br />
Below is a more detailed sketch of the circuit design ([https://2012.igem.org/File:NTNU_sketchlegend.jpg legend]). The environmental cues oxygen and lactate regulate the production of two regulatory proteins, LuxR and LuxI. Oxygen inhibits the production of LuxR, while lactate activates the production of LuxI. LuxI in turn catalyzes the formation of a homo-serine lactone (HSL) compound from S-Adenosyl Methionine (SAM) and Hexanoyl-ACP (Hex). When both LuxR and HSL is produced, they combine irreversibly to form a complex which activates the promoter in front of the lysis device (BioBrick part <partinfo>BBa_K112808</partinfo>, designed by the [https://2008.igem.org/Team:UC_Berkeley University of California Berkeley iGEM 2008] team).<br />
<br />
[[File:NTNU_sketch1b.jpg|thumb|600px|center| Detailed overview of our genetic circuit.]] <br />
<br />
In order to have the presence of lactate activate the production of LuxI, we need a lactate-sensitive [http://en.wikipedia.org/wiki/Promoter_%28genetics%29 promoter]. We will attempt to isolate the lactate-sensitive promoter found in the [http://ecocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=TU164 lldPRD] operon of ''E. coli'' by PCR. However, the available literature indicates that this promoter [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC205257/ is repressed under low-oxygen conditions] due to the action of the ArcA regulatory protein. A possible solution is using site-directed mutagenesis to change the nucleotide sequence at the probable binding site of ArcA on the promoter to reduce its binding affinity and abolish its regulatory effect.<br />
<br />
==Challenges==<br />
The goal of making bacterial cells detect and attack cancer cells present several challenges.<br />
First, how can cancer cells be reliably and effectively detected? Early in the process after deciding on the goal, we considered using several human signalling molecules such as HGF and VEGF as cancer indicators, as these are known to be over-produced by tumors. However, we were unable to determine quickly if these would be able to enter and affect ''E. coli'' cells, due to their large size. In contrast, O<sub>2</sub> and lactate are small molecules which are easily taken up by the cells, and are known to directly regulate the expression of various genes.<br />
<br />
==Parts==<br />
===Promoters=== <br />
To allow our system to work correctly, we need several different promoters. Of these, the most simple is a constitutive (always on) promoter in front of the toxin-producing gene. For this purpose, we have extracted the BioBrick part <partinfo>BBa_J23119</partinfo> from the iGEM DNA distribution kit. Second, a promoter having higher activity at low oxygen levels, similar to those found in tumors. As a candidate for this function, we will test the vgb promoter BioBrick part <partinfo>BBa_K561001</partinfo>. Thirdly, a promoter that is activated by lactate, a possible indicator of tumor cells in the vicinity (or strenous exercise!). We want to clone the lldPp promoter of the ''E. coli'' [http://ecocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=TU164 lldPRD] operon for this. Lastly, a promoter that is activated by a compound resulting from the activation of the previous two units. In our sketch, this compound is a LuxR-HSL complex, which can activate the promoters of several BioBrick parts, such as <partinfo>BBa_K145150</partinfo> or <partinfo>BBa_R0062</partinfo>.<br />
<br />
===Genes===<br />
LuxI is a acyl homoserine lactone syntase, an enzyme catalyzing the production of a homoserine lactone (HSL) from the precursors S-adenosyl methionine (Sam) and hexanoyl-ACP (Hex). The normal function of LuxI is as part of the bacterial lux system, a [http://en.wikipedia.org/wiki/Quorum_sensing quorom-sensing] system allowing cells in proximity to sense each others presence, estimate the local cell population and regulate [https://www.bio.cmu.edu/courses/03441/TermPapers/97TermPapers/lux/bioluminescence.html bioluminescence]. LuxI is available as the BioBrick part <partinfo>BBa_K092400</partinfo>.<br />
<br />
[[File:NTNU_3OHSL.gif|thumb|center|400px|[http://partsregistry.org/3OC6HSL 3-oxohexanoyl-homoserine lactone] is synthesized by LuxI]]<br />
<br />
LuxR is another protein in the lux system, and acts by binding to 3OC6HSL, the product formed by the catalytic activity of LuxI. LuxR-HSL then acts on gene promoters to regulate genetic expression. We will use the simultaneous expression of LuxR and LuxI leading to the the formation of LuxR-HSL to activate the lysis device which causes the cell to dissolve and release its produced toxin.<br />
<br />
The lysis device was made by the [https://2008.igem.org/Team:UC_Berkeley UC Berkeley iGEM 2008] team. The genes are from the [http://en.wikipedia.org/wiki/Enterobacteria_phage_T4 bacteriophage T4] (a virus that infects bacteria). We will use it as-is, placing a self-chosen promoter in front of the part to control the initiation of cell lysis.<br />
<br />
[[File:S-Adenosyl methionine.png|thumb|center|300px|S-Adenoysyl-methionine (SAM)]]<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<html></div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}<br />
<!--The structure of Hexanoyl-ACP:<br />
[[file:HexanoylACP_structure.jpg|center|300px]] (from the RCSB Protein Databank, entry [http://www.rcsb.org/pdb/explore.do?structureId=2FAC 2FAC])--><br />
<br />
<!--==References==<br />
<br />
Lactate sensitive promoter:<br />
<br />
[http://www.ncbi.nlm.nih.gov/pubmed/18263722 Dual role of LldR in regulation of the lldPRD operon, involved in L-lactate metabolism in Escherichia coli.]<br />
<br />
LuxI:<br />
<br />
[http://www.pnas.org/content/93/18/9505.full.pdf Generation of cell-to-cell signals in quorum sensing: Acyl homoserine lactone synthase activity of a purified Vibrio fischeri LuxI protein]<br />
<br />
[http://www.genome.jp/dbget-bin/www_bget?ec:2.3.1.184 KEGG entry]<br />
<br />
LuxR:<br />
<br />
''Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators.''[http://www.ncbi.nlm.nih.gov/pmc/articles/PMC205046/ J Bacteriol. 1994 January; 176(2): 269–275.]<br />
<br />
[http://www.uniprot.org/uniprot/P12746 Uniprot entry]<br />
<br />
[http://www.ncbi.nlm.nih.gov/protein/ADX97333.1 PubMed entry]<br />
<br />
Lysis device:<br />
<br />
[https://2008.igem.org/Team:UC_Berkeley/LysisDevice UC Berkeley iGEM 2008: Lysis Device]--></div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/ProjectTeam:NTNU Trondheim/Project2012-09-26T10:22:45Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Project description <small>Bacterial Anti-Cancer Kamikaze explained</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
==Background==<br />
<br />
Cancer is the leading cause of death worldwide. In 2008 alone, 13% of all deaths (7,6 million people) were caused by cancer, and it is not likely that the number will decrease. Lifestyle diseases, for instance, are huge risk factors for developing cancer, and diseases like type 2 diabetes are increasing rapidly on a worldwide basis. [http://www.who.int/gho/publications/world_health_statistics/2012/en/index.html], [http://www.who.int/mediacentre/factsheets/fs312/en/].<br />
<br />
One of the most challenging aspects of cancer medicine is the difficulty of drug delivery directly at the tumor area. We therefore wanted to develop a system for specific drug delivery, to show that one of the most challenging medical problems can be solved by using synthetic biology. So we decided to make a system responding to factors specific for cancer cells, but without being too complicated [http://mct.aacrjournals.org/content/4/10/1636.full].<br />
In our system we want two different trigger factors, in order to lower the risk of releasing toxins in the healthy parts of the body. Our system is triggered by a low oxygen concentration and a high lactate concentration. <br />
<br />
When the ''E. coli'' detects these conditions, our system will activate the lysis genes, and the toxin will be released. <br />
Differentiated cells (“normal” cells) can produce high amount of lactate in an anaerobic environment, but this is not a normal environment for the cells in our body. Under normal circumstances, the differentiated cells will primarily metabolize glucose to carbon dioxide in the citric acid cycle (TCA), and have a very low production of lactate. Cancer cells behave differently. They produce large amounts of lactate regardless of the oxygen concentration in their surroundings [http://www.ncbi.nlm.nih.gov/pubmed/19460998], [http://cancerres.aacrjournals.org/content/58/7/1408.full.pdf+html]. The reason that we want to use oxygen as a trigger factor is that tumors exists in an environment deprived of oxygen [http://www.springerlink.com/content/a60537w7085574v4/].<br />
<br />
==Overview==<br />
<br />
Our goal for this years competition is to create a genetic circuit which enables ''E. coli'' cells to detect and attack cancer cells. To do this, the cells should produce a tumor inhibitor or toxin effective at killing cancer cells, and respond to environmental cues indicating the presence of cancer cells by undergoing [http://en.wikipedia.org/wiki/Lysis lysis], releasing the anti-cancer agent into the surrounding environment. In principle, bacteria could be used in "search and destroy" missions against cancer inside the human body. We wish to develop our genetic circuit as a proof-of-concept of one such strategy.<br />
<br />
A sketch of our current planned design for the circuit is shown below.<br />
<br />
[[File:Grønn_krets.png|thumb|center|600px|A sketch of our planned genetic circuit]]<br />
<br />
Ideally, the toxin should only be released if cancer cells are actually encountered, and never otherwise. To achieve this, the lysis-inducing part of the circuit should be regulated such that it is highly unlikely to activated in other situations. One possible way is to use a signal molecule that is solely associated with cancer cells to activate the lysis device. Another possibility is to use a combination of environmental cues that together indicate a high likelihood of cancer presence. We have chosen the latter strategy, and the environmental cues we aim to use are low O2 and high lactate concentrations. <br />
<br />
Each of the two cues activates a separate gene, which encode different proteins. Together, these two proteins should activate the unit responsible for lysis. Therefore, if only one of the cues are present, the cell does not lyse, and toxin is not released in high levels. (Some leakage of toxin must be expected even under normal conditions with no activation of the circuit). Selective activation in the presence of cancer cells would be crucial for the concept to be effective in a medical situation. <br />
<br />
As shown in the sketch, we plan to express the toxin-producing gene with a constitutive promoter. This means that the toxin production always be on. Ideally, the toxin should be maximally effective against cancer cells and minimally toxic to the toxin-producing cell. We have evaluated several candidate molecules. At the moment, we are leaning towards using the protein [http://proteopedia.org/wiki/index.php/Colicin_E1 Colicin E1].<br />
<br />
==Details==<br />
<br />
Below is a more detailed sketch of the circuit design ([https://2012.igem.org/File:NTNU_sketchlegend.jpg legend]). The environmental cues oxygen and lactate regulate the production of two regulatory proteins, LuxR and LuxI. Oxygen inhibits the production of LuxR, while lactate activates the production of LuxI. LuxI in turn catalyzes the formation of a homo-serine lactone (HSL) compound from S-Adenosyl Methionine (SAM) and Hexanoyl-ACP (Hex). When both LuxR and HSL is produced, they combine irreversibly to form a complex which activates the promoter in front of the lysis device (BioBrick part <partinfo>BBa_K112808</partinfo>, designed by the [https://2008.igem.org/Team:UC_Berkeley University of California Berkeley iGEM 2008] team).<br />
<br />
[[File:NTNU_sketch1b.jpg|thumb|600px|center| Detailed overview of our genetic circuit.]] <br />
<br />
In order to have the presence of lactate activate the production of LuxI, we need a lactate-sensitive [http://en.wikipedia.org/wiki/Promoter_%28genetics%29 promoter]. We will attempt to isolate the lactate-sensitive promoter found in the [http://ecocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=TU164 lldPRD] operon of ''E. coli'' by PCR. However, the available literature indicates that this promoter [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC205257/ is repressed under low-oxygen conditions] due to the action of the ArcA regulatory protein. A possible solution is using site-directed mutagenesis to change the nucleotide sequence at the probable binding site of ArcA on the promoter to reduce its binding affinity and abolish its regulatory effect.<br />
<br />
==Challenges==<br />
The goal of making bacterial cells detect and attack cancer cells present several challenges.<br />
First, how can cancer cells be reliably and effectively detected? Early in the process after deciding on the goal, we considered using several human signalling molecules such as HGF and VEGF as cancer indicators, as these are known to be over-produced by tumors. However, we were unable to determine quickly if these would be able to enter and affect ''E. coli'' cells, due to their large size. In contrast, O<sub>2</sub> and lactate are small molecules which are easily taken up by the cells, and are known to directly regulate the expression of various genes.<br />
<br />
==Parts==<br />
===Promoters=== <br />
To allow our system to work correctly, we need several different promoters. Of these, the most simple is a constitutive (always on) promoter in front of the toxin-producing gene. For this purpose, we have extracted the BioBrick part <partinfo>BBa_J23119</partinfo> from the iGEM DNA distribution kit. Second, a promoter having higher activity at low oxygen levels, similar to those found in tumors. As a candidate for this function, we will test the vgb promoter BioBrick part <partinfo>BBa_K561001</partinfo>. Thirdly, a promoter that is activated by lactate, a possible indicator of tumor cells in the vicinity (or strenous exercise!). We want to clone the lldPp promoter of the ''E. coli'' [http://ecocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=TU164 lldPRD] operon for this. Lastly, a promoter that is activated by a compound resulting from the activation of the previous two units. In our sketch, this compound is a LuxR-HSL complex, which can activate the promoters of several BioBrick parts, such as <partinfo>BBa_K145150</partinfo> or <partinfo>BBa_R0062</partinfo>.<br />
<br />
===Genes===<br />
LuxI is a acyl homoserine lactone syntase, an enzyme catalyzing the production of a homoserine lactone (HSL) from the precursors S-adenosyl methionine (Sam) and hexanoyl-ACP (Hex). The normal function of LuxI is as part of the bacterial lux system, a [http://en.wikipedia.org/wiki/Quorum_sensing quorom-sensing] system allowing cells in proximity to sense each others presence, estimate the local cell population and regulate [https://www.bio.cmu.edu/courses/03441/TermPapers/97TermPapers/lux/bioluminescence.html bioluminescence]. LuxI is available as the BioBrick part <partinfo>BBa_K092400</partinfo>.<br />
<br />
[[File:NTNU_3OHSL.gif|thumb|center|400px|[http://partsregistry.org/3OC6HSL 3-oxohexanoyl-homoserine lactone] is synthesized by LuxI]]<br />
<br />
LuxR is another protein in the lux system, and acts by binding to 3OC6HSL, the product formed by the catalytic activity of LuxI. LuxR-HSL then acts on gene promoters to regulate genetic expression. We will use the simultaneous expression of LuxR and LuxI leading to the the formation of LuxR-HSL to activate the lysis device which causes the cell to dissolve and release its produced toxin.<br />
<br />
The lysis device was made by the [https://2008.igem.org/Team:UC_Berkeley UC Berkeley iGEM 2008] team. The genes are from the [http://en.wikipedia.org/wiki/Enterobacteria_phage_T4 bacteriophage T4] (a virus that infects bacteria). We will use it as-is, placing a self-chosen promoter in front of the part to control the initiation of cell lysis.<br />
<br />
[[File:S-Adenosyl methionine.png|thumb|center|300px|S-Adenoysyl-methionine (SAM)]]<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<html></div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}<br />
<!--The structure of Hexanoyl-ACP:<br />
[[file:HexanoylACP_structure.jpg|center|300px]] (from the RCSB Protein Databank, entry [http://www.rcsb.org/pdb/explore.do?structureId=2FAC 2FAC])--><br />
<br />
<!--==References==<br />
<br />
Lactate sensitive promoter:<br />
<br />
[http://www.ncbi.nlm.nih.gov/pubmed/18263722 Dual role of LldR in regulation of the lldPRD operon, involved in L-lactate metabolism in Escherichia coli.]<br />
<br />
LuxI:<br />
<br />
[http://www.pnas.org/content/93/18/9505.full.pdf Generation of cell-to-cell signals in quorum sensing: Acyl homoserine lactone synthase activity of a purified Vibrio fischeri LuxI protein]<br />
<br />
[http://www.genome.jp/dbget-bin/www_bget?ec:2.3.1.184 KEGG entry]<br />
<br />
LuxR:<br />
<br />
''Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators.''[http://www.ncbi.nlm.nih.gov/pmc/articles/PMC205046/ J Bacteriol. 1994 January; 176(2): 269–275.]<br />
<br />
[http://www.uniprot.org/uniprot/P12746 Uniprot entry]<br />
<br />
[http://www.ncbi.nlm.nih.gov/protein/ADX97333.1 PubMed entry]<br />
<br />
Lysis device:<br />
<br />
[https://2008.igem.org/Team:UC_Berkeley/LysisDevice UC Berkeley iGEM 2008: Lysis Device]--></div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/ProjectTeam:NTNU Trondheim/Project2012-09-26T08:07:53Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Project description <small>Bacterial Anti-Cancer Kamikaze explained</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
__TOC__<br />
==Background==<br />
<br />
Cancer is the leading cause of death worldwide. In 2008 alone, 13% of all deaths (7,6 million people) were caused by cancer, and it is not likely that the number will decrease. Lifestyle diseases, for instance, are huge risk factors for developing cancer, and diseases like type 2 diabetes are increasing rapidly on a worldwide basis. [http://www.who.int/gho/publications/world_health_statistics/2012/en/index.html], [http://www.who.int/mediacentre/factsheets/fs312/en/].<br />
<br />
One of the challenging aspects of cancer medicine is the difficulty of drug delivery directly at the tumor area. We therefore wanted our system to be as specific as possible, but without being too complicated [http://mct.aacrjournals.org/content/4/10/1636.full].<br />
In our system we want two different trigger factors. (That is because we wanted to make it more specific to the environment the cancer cells live in to lower the risk of sending out toxins nearby the healthy parts of the body.) Our system is triggered by a low oxygen concentration and a high lactate concentration. <br />
<br />
When the ''E. coli'' detects these conditions, our system will activate the lysis genes, and the toxin will be released. <br />
Differentiated cells (“normal” cells) can produce high amount of lactate in an anaerobic environment, but this is not a normal environment for the cells in our body. Under normal circumstances, the differentiated cells will primarily metabolize glucose to carbon dioxide in the citric acid cycle (TCA), and have a very low production of lactate. Cancer cells behave differently. They produce large amounts of lactate regardless of the oxygen concentration in their surroundings [http://www.ncbi.nlm.nih.gov/pubmed/19460998], [http://cancerres.aacrjournals.org/content/58/7/1408.full.pdf+html]. The reason that we want to use oxygen as a trigger factor is that tumors exists in an environment deprived of oxygen [http://www.springerlink.com/content/a60537w7085574v4/].<br />
<br />
==Overview==<br />
<br />
Our goal for this years competition is to create a genetic circuit which enables ''E. coli'' cells to detect and attack cancer cells. To do this, the cells should produce a tumor inhibitor or toxin effective at killing cancer cells, and respond to environmental cues indicating the presence of cancer cells by undergoing [http://en.wikipedia.org/wiki/Lysis lysis], releasing the anti-cancer agent into the surrounding environment. In principle, bacteria could be used in "search and destroy" missions against cancer inside the human body. We wish to develop our genetic circuit as a proof-of-concept of one such strategy.<br />
<br />
A sketch of our current planned design for the circuit is shown below.<br />
<br />
[[File:Grønn_krets.png|thumb|center|600px|A sketch of our planned genetic circuit]]<br />
<br />
Ideally, the toxin should only be released if cancer cells are actually encountered, and never otherwise. To achieve this, the lysis-inducing part of the circuit should be regulated such that it is highly unlikely to activated in other situations. One possible way is to use a signal molecule that is solely associated with cancer cells to activate the lysis device. Another possibility is to use a combination of environmental cues that together indicate a high likelihood of cancer presence. We have chosen the latter strategy, and the environmental cues we aim to use are low O2 and high lactate concentrations. <br />
<br />
Each of the two cues activates a separate gene, which encode different proteins. Together, these two proteins should activate the unit responsible for lysis. Therefore, if only one of the cues are present, the cell does not lyse, and toxin is not released in high levels. (Some leakage of toxin must be expected even under normal conditions with no activation of the circuit). Selective activation in the presence of cancer cells would be crucial for the concept to be effective in a medical situation. <br />
<br />
As shown in the sketch, we plan to express the toxin-producing gene with a constitutive promoter. This means that the toxin production always be on. Ideally, the toxin should be maximally effective against cancer cells and minimally toxic to the toxin-producing cell. We have evaluated several candidate molecules. At the moment, we are leaning towards using the protein [http://proteopedia.org/wiki/index.php/Colicin_E1 Colicin E1].<br />
<br />
==Details==<br />
<br />
Below is a more detailed sketch of the circuit design ([https://2012.igem.org/File:NTNU_sketchlegend.jpg legend]). The environmental cues oxygen and lactate regulate the production of two regulatory proteins, LuxR and LuxI. Oxygen inhibits the production of LuxR, while lactate activates the production of LuxI. LuxI in turn catalyzes the formation of a homo-serine lactone (HSL) compound from S-Adenosyl Methionine (SAM) and Hexanoyl-ACP (Hex). When both LuxR and HSL is produced, they combine irreversibly to form a complex which activates the promoter in front of the lysis device (BioBrick part <partinfo>BBa_K112808</partinfo>, designed by the [https://2008.igem.org/Team:UC_Berkeley University of California Berkeley iGEM 2008] team).<br />
<br />
[[File:NTNU_sketch1b.jpg|thumb|600px|center| Detailed overview of our genetic circuit.]] <br />
<br />
In order to have the presence of lactate activate the production of LuxI, we need a lactate-sensitive [http://en.wikipedia.org/wiki/Promoter_%28genetics%29 promoter]. We will attempt to isolate the lactate-sensitive promoter found in the [http://ecocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=TU164 lldPRD] operon of ''E. coli'' by PCR. However, the available literature indicates that this promoter [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC205257/ is repressed under low-oxygen conditions] due to the action of the ArcA regulatory protein. A possible solution is using site-directed mutagenesis to change the nucleotide sequence at the probable binding site of ArcA on the promoter to reduce its binding affinity and abolish its regulatory effect.<br />
<br />
==Challenges==<br />
The goal of making bacterial cells detect and attack cancer cells present several challenges.<br />
First, how can cancer cells be reliably and effectively detected? Early in the process after deciding on the goal, we considered using several human signalling molecules such as HGF and VEGF as cancer indicators, as these are known to be over-produced by tumors. However, we were unable to determine quickly if these would be able to enter and affect ''E. coli'' cells, due to their large size. In contrast, O<sub>2</sub> and lactate are small molecules which are easily taken up by the cells, and are known to directly regulate the expression of various genes.<br />
<br />
==Parts==<br />
===Promoters=== <br />
To allow our system to work correctly, we need several different promoters. Of these, the most simple is a constitutive (always on) promoter in front of the toxin-producing gene. For this purpose, we have extracted the BioBrick part <partinfo>BBa_J23119</partinfo> from the iGEM DNA distribution kit. Second, a promoter having higher activity at low oxygen levels, similar to those found in tumors. As a candidate for this function, we will test the vgb promoter BioBrick part <partinfo>BBa_K561001</partinfo>. Thirdly, a promoter that is activated by lactate, a possible indicator of tumor cells in the vicinity (or strenous exercise!). We want to clone the lldPp promoter of the ''E. coli'' [http://ecocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=TU164 lldPRD] operon for this. Lastly, a promoter that is activated by a compound resulting from the activation of the previous two units. In our sketch, this compound is a LuxR-HSL complex, which can activate the promoters of several BioBrick parts, such as <partinfo>BBa_K145150</partinfo> or <partinfo>BBa_R0062</partinfo>.<br />
<br />
===Genes===<br />
LuxI is a acyl homoserine lactone syntase, an enzyme catalyzing the production of a homoserine lactone (HSL) from the precursors S-adenosyl methionine (Sam) and hexanoyl-ACP (Hex). The normal function of LuxI is as part of the bacterial lux system, a [http://en.wikipedia.org/wiki/Quorum_sensing quorom-sensing] system allowing cells in proximity to sense each others presence, estimate the local cell population and regulate [https://www.bio.cmu.edu/courses/03441/TermPapers/97TermPapers/lux/bioluminescence.html bioluminescence]. LuxI is available as the BioBrick part <partinfo>BBa_K092400</partinfo>.<br />
<br />
[[File:NTNU_3OHSL.gif|thumb|center|400px|[http://partsregistry.org/3OC6HSL 3-oxohexanoyl-homoserine lactone] is synthesized by LuxI]]<br />
<br />
LuxR is another protein in the lux system, and acts by binding to 3OC6HSL, the product formed by the catalytic activity of LuxI. LuxR-HSL then acts on gene promoters to regulate genetic expression. We will use the simultaneous expression of LuxR and LuxI leading to the the formation of LuxR-HSL to activate the lysis device which causes the cell to dissolve and release its produced toxin.<br />
<br />
The lysis device was made by the [https://2008.igem.org/Team:UC_Berkeley UC Berkeley iGEM 2008] team. The genes are from the [http://en.wikipedia.org/wiki/Enterobacteria_phage_T4 bacteriophage T4] (a virus that infects bacteria). We will use it as-is, placing a self-chosen promoter in front of the part to control the initiation of cell lysis.<br />
<br />
[[File:S-Adenosyl methionine.png|thumb|center|300px|S-Adenoysyl-methionine (SAM)]]<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<html></div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}<br />
<!--The structure of Hexanoyl-ACP:<br />
[[file:HexanoylACP_structure.jpg|center|300px]] (from the RCSB Protein Databank, entry [http://www.rcsb.org/pdb/explore.do?structureId=2FAC 2FAC])--><br />
<br />
<!--==References==<br />
<br />
Lactate sensitive promoter:<br />
<br />
[http://www.ncbi.nlm.nih.gov/pubmed/18263722 Dual role of LldR in regulation of the lldPRD operon, involved in L-lactate metabolism in Escherichia coli.]<br />
<br />
LuxI:<br />
<br />
[http://www.pnas.org/content/93/18/9505.full.pdf Generation of cell-to-cell signals in quorum sensing: Acyl homoserine lactone synthase activity of a purified Vibrio fischeri LuxI protein]<br />
<br />
[http://www.genome.jp/dbget-bin/www_bget?ec:2.3.1.184 KEGG entry]<br />
<br />
LuxR:<br />
<br />
''Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators.''[http://www.ncbi.nlm.nih.gov/pmc/articles/PMC205046/ J Bacteriol. 1994 January; 176(2): 269–275.]<br />
<br />
[http://www.uniprot.org/uniprot/P12746 Uniprot entry]<br />
<br />
[http://www.ncbi.nlm.nih.gov/protein/ADX97333.1 PubMed entry]<br />
<br />
Lysis device:<br />
<br />
[https://2008.igem.org/Team:UC_Berkeley/LysisDevice UC Berkeley iGEM 2008: Lysis Device]--></div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/OutreachTeam:NTNU Trondheim/Outreach2012-09-26T08:04:51Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Outreach <small>Bringing iGEM teams together and synthetic biology to the masses</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
<br />
==Outreach in summary==<br />
<br />
Our project also has an outreach part. Our main outreach project will be to participate in Researchers' Night, which is an event for high school students and students from non-degree granting colleges. The goal of researchers' night is to show the students that research is fun, to inspire them, and to motivate them to take higher education.<br />
As a second outreach project, the team will be writing a chapter on different biobrick assembly methods in a textbook. <br />
We also concider our matchmaker an important part of our outreach effort. <br />
More info about Researchers' night, our textbook chapter, and the matchmaker is given below.<br />
<br />
<br />
==Researchers' Night==<br />
<br />
This year, the NTNU iGEM team is participating in Researchers' Night, which is an arrangement for high school students. This is the eighth year Researchers' night is being arranged, and it has traditionally been very popular at NTNU. Last year, over 1200 students visited the arrangement. This year, Researchers' night will be arranged the 28th of september, and we have been inveted to participate. We are really looking forward to it, since this is a unique opportunity to tell students about the possibilities of synthetic biology, and motivate them for a career in biotechnology. It seems that the students are looking forward to it as well, since this year's arrangement was fully booked in 4 minutes! Some photos from last year's event (taken by Kristina Jones, NTNU) can be seen in the carousel below.<br />
<br />
<br />
<html><br />
<div class="row"><br />
<div class="span8 offset2"><br />
<div id="myCarousel2" class="carousel slide"><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN1.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN2.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN3.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN4.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN5.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN6.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN7.PNG" alt=""><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#myCarousel2" data-slide="prev">&lsaquo;</a><br />
<a class="right carousel-control" href="#myCarousel2" data-slide="next">&rsaquo;</a><br />
<br />
</div><br />
</div><br />
</div><br />
</html><br />
<br />
This year, the 1100 participating students can visit 31 different stands, one of them being ours. To get the students to understand the concept of giving organisms new characteristic properties by putting together biobricks, we have made a biobrick construction kit, including both DNA and restriction enzymes (a picture of the DNA from the construction kit is given below). We hope that this construction kit will make it easier both to understand why we are able to put together biobricks using certain combinations of restriction enzymes, and we also hope we can teach them what the different sequences that makes a gene are used for.<br />
<br />
[[File:BiobrikkeByggesett.png|400px|thumb|center|Our BioBrick construction kit]]<br />
<br />
<br />
==The iGEM Matchmaker==<br />
<br />
In the middle of the summer, we got the idea of the [https://2012.igem.org/Team:NTNU_Trondheim/Matchmaker Matchmaker]. What brought us to this idea was the fact that if you haven't already arranged a cooperation with another iGEM team, it is hard to find someone to cooperate with. We also knew that the NTNU iGEM team 2011 made many attempts to cooperate with other teams by sending out several emails, but they never recieved any answers.<br />
So we decided to make the Matchmaker, and so far, we think it has been very useful. Hopefully, you think so too! Even if it came quite late in the summer, it was used by several teams, and we hope it can be used by future iGEM teams as well.<br />
<br />
<br />
==Text book chapter on biobrick assembly methods==<br />
<br />
Early in the semester, we was asked by our advisor, Rahmi Lale, to write a chapter on biobrick assembly method for a text book he and Svein Valla, Professor at Dept. of Biotechnology, NTNU, are editing. The text book in question is called 'DNA cloning methods', and is part of the book series '[http://www.springer.com/series/7651 Methods in Molecular Biology]' published by Humana Press.<br />
<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/OutreachTeam:NTNU Trondheim/Outreach2012-09-26T08:03:09Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Outreach <small>Bringing iGEM teams together and synthetic biology to the masses</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
<br />
==Outreach in summary==<br />
<br />
Our project also has an outreach part. Our main outreach project will be to participate in Researchers' Night, which is an event for high school students and students from non-degree granting colleges. The goal of researchers' night is to show the students that research is fun, to inspire them, and to motivate them to take higher education.<br />
As a second outreach project, the team will be writing a chapter on different biobrick assembly methods in a textbook. <br />
We also concider our matchmaker an important part of our outreach effort. <br />
More info about Researchers' night, our textbook chapter, and the matchmaker is given below.<br />
<br />
<br />
==Researchers' Night==<br />
<br />
This year, the NTNU iGEM team is participating in Researchers' Night, which is an arrangement for high school students. This is the eighth year Researchers' night is being arranged, and it has traditionally been very popular at NTNU. Last year, over 1200 students visited the arrangement. This year, Researchers' night will be arranged the 28th of september, and we have been inveted to participate. We are really looking forward to it, since this is a unique opportunity to tell students about the possibilities of synthetic biology, and motivate them for a career in biotechnology. It seems that the students are looking forward to it as well, since this year's arrangement was fully booked in 4 minutes! Some photos from last year's event (taken by Kristina Jones, NTNU) can be seen in the carousel below.<br />
<br />
<br />
<html><br />
<div class="row"><br />
<div class="span8 offset2"><br />
<div id="myCarousel2" class="carousel slide"><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN1.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN2.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN3.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN4.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN5.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN6.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN7.PNG" alt=""><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#myCarousel2" data-slide="prev">&lsaquo;</a><br />
<a class="right carousel-control" href="#myCarousel2" data-slide="next">&rsaquo;</a><br />
<br />
</div><br />
</div><br />
</div><br />
</html><br />
<br />
This year, the 1100 participating students can visit 31 different stands, one of them being ours. To get the students to understand the concept of giving organisms new characteristic properties by putting together biobricks, we have made a biobrick construction kit, including both DNA and restriction enzymes (a picture of the DNA from the construction kit is given below). We hope that this construction kit will make it easier both to understand why we are able to put together biobricks using certain combinations of restriction enzymes, and we also hope we can teach them what the different sequences that makes a gene are used for.<br />
<br />
[[File:BiobrikkeByggesett.png|400px|thumb|center|Our BioBrick construction kit]]<br />
<br />
<br />
==The iGEM Matchmaker==<br />
<br />
In the middle of the summer, we got the idea of the [https://2012.igem.org/Team:NTNU_Trondheim/Matchmaker Matchmaker]. What brought us to this idea was the fact that if you haven't already arranged a cooperation with another iGEM team, it is hard to find someone to cooperate with. We also knew that the NTNU iGEM team 2011 made many attempts to cooperate with other teams by sending out several emails, but they never recieved any answers.<br />
So we decided to make the Matchmaker, and so far, we think it has been very useful. Hopefully, you think so too! Even if it came quite late in the summer, it was used by several teams, and we hope it can be used by future iGEM teams as well.<br />
<br />
<br />
==Text book chapter on biobrick assembly methods==<br />
<br />
Early in the semester, we was asked by our advisor, Rahmi Lale, to write a chapter on biobrick assembly method for a text book he and Svein Valla, Professor at Dept. of Biotechnology, NTNU, are editing. The text book in question is called 'DNA cloning methods', and is part of the book series '[http://www.springer.com/series/7651 Methods in Molecular Biology]' published by Humana Press.<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/OutreachTeam:NTNU Trondheim/Outreach2012-09-26T08:02:02Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Outreach <small>Bringing iGEM teams together and synthetic biology to the masses</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
<br />
==Outreach in summary==<br />
<br />
Our project also has an outreach part. Our main outreach project will be to participate in Researchers' Night, which is an event for high school students and students from non-degree granting colleges. The goal of researchers' night is to show the students that research is fun, to inspire them, and to motivate them to take higher education.<br />
As a second outreach project, the team will be writing a chapter on different biobrick assembly methods in a textbook. <br />
We also concider our matchmaker an important part of our outreach effort. <br />
More info about Researchers' night, our textbook chapter, and the matchmaker is given below.<br />
<br />
<br />
==Researchers' Night==<br />
<br />
This year, the NTNU iGEM team is participating in Researchers' Night, which is an arrangement for high school students. This is the eighth year Researchers' night is being arranged, and it has traditionally been very popular at NTNU. Last year, over 1200 students visited the arrangement. This year, Researchers' night will be arranged the 28th of september, and we have been inveted to participate. We are really looking forward to it, since this is a unique opportunity to tell students about the possibilities of synthetic biology, and motivate them for a career in biotechnology. It seems that the students are looking forward to it as well, since this year's arrangement was fully booked in 4 minutes! Some photos from last year's event (taken by Kristina Jones, NTNU) can be seen in the carousel below.<br />
<br />
<br />
<html><br />
<div class="row"><br />
<div class="span8 offset2"><br />
<div id="myCarousel2" class="carousel slide"><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN1.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN2.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN3.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN4.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN5.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN6.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN7.PNG" alt=""><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#myCarousel2" data-slide="prev">&lsaquo;</a><br />
<a class="right carousel-control" href="#myCarousel2" data-slide="next">&rsaquo;</a><br />
<br />
</div><br />
</div><br />
</div><br />
</html><br />
<br />
This year, the 1100 participating students can visit 31 different stands, one of them being ours. To get the students to understand the concept of giving organisms new characteristic properties by putting together biobricks, we have made a biobrick construction kit, including both DNA and restriction enzymes (a picture of the DNA from the construction kit is given below). We hope that this construction kit will make it easier both to understand why we are able to put together biobricks using certain combinations of restriction enzymes, and we also hope we can teach them what the different sequences that makes a gene are used for.<br />
<br />
[[File:BiobrikkeByggesett.png|400px|thumb|center|Our BioBrick construction kit]]<br />
<br />
==The iGEM Matchmaker==<br />
<br />
In the middle of the summer, we got the idea of the [https://2012.igem.org/Team:NTNU_Trondheim/Matchmaker Matchmaker]. What brought us to this idea was the fact that if you haven't already arranged a cooperation with another iGEM team, it is hard to find someone to cooperate with. We also knew that the NTNU iGEM team 2011 made many attempts to cooperate with other teams by sending out several emails, but they never recieved any answers.<br />
So we decided to make the Matchmaker, and so far, we think it has been very useful. Hopefully, you think so too! Even if it came quite late in the summer, it was used by several teams, and we hope it can be used by future iGEM teams as well.<br />
<br />
==Text book chapter on biobrick assembly methods==<br />
<br />
Early in the semester, we was asked by our advisor, Rahmi Lale, to write a chapter on biobrick assembly method for a text book he and Svein Valla, Professor at Dept. of Biotechnology, NTNU, are editing. The text book in question is called 'DNA cloning methods', and is part of the book series '[http://www.springer.com/series/7651 Methods in Molecular Biology]' published by Humana Press.<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/OutreachTeam:NTNU Trondheim/Outreach2012-09-26T08:00:44Z<p>Gunvor: </p>
<hr />
<div>{{:Team:NTNU_Trondheim/Templates/Header}}<br />
<html><br />
<div class="container"><br />
<div class="page-header-top"><br />
<h1>Outreach <small>Bringing iGEM teams together and synthetic biology to the masses</small></h1><br />
</div><br />
</div><br />
<br />
<br />
<div class="container main-container"><br />
</html><br />
<br />
==Outreach in summary==<br />
<br />
Our project also has an outreach part. Our main outreach project will be to participate in Researchers' Night, which is an event for high school students and students from non-degree granting colleges. The goal of researchers' night is to show the students that research is fun, to inspire them, and to motivate them to take higher education.<br />
As a second outreach project, the team will be writing a chapter on different biobrick assembly methods in a textbook. <br />
We also concider our matchmaker an important part of our outreach effort. <br />
More info about Researchers' night, our textbook chapter, and the matchmaker is given below.<br />
<br />
==Researchers' Night==<br />
<br />
This year, the NTNU iGEM team is participating in Researchers' Night, which is an arrangement for high school students. This is the eighth year Researchers' night is being arranged, and it has traditionally been very popular at NTNU. Last year, over 1200 students visited the arrangement. This year, Researchers' night will be arranged the 28th of september, and we have been inveted to participate. We are really looking forward to it, since this is a unique opportunity to tell students about the possibilities of synthetic biology, and motivate them for a career in biotechnology. It seems that the students are looking forward to it as well, since this year's arrangement was fully booked in 4 minutes! Some photos from last year's event (taken by Kristina Jones, NTNU) can be seen in the carousel below.<br />
<br />
<html><br />
<div class="row"><br />
<div class="span8 offset2"><br />
<div id="myCarousel2" class="carousel slide"><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN1.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN2.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN3.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN4.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN5.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN6.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN7.PNG" alt=""><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#myCarousel2" data-slide="prev">&lsaquo;</a><br />
<a class="right carousel-control" href="#myCarousel2" data-slide="next">&rsaquo;</a><br />
<br />
</div><br />
</div><br />
</div><br />
</html><br />
This year, the 1100 participating students can visit 31 different stands, one of them being ours. To get the students to understand the concept of giving organisms new characteristic properties by putting together biobricks, we have made a biobrick construction kit, including both DNA and restriction enzymes (a picture of the DNA from the construction kit is given below). We hope that this construction kit will make it easier both to understand why we are able to put together biobricks using certain combinations of restriction enzymes, and we also hope we can teach them what the different sequences that makes a gene are used for.<br />
<br />
[[File:BiobrikkeByggesett.png|400px|thumb|center|Our BioBrick construction kit]]<br />
<br />
==The iGEM Matchmaker==<br />
<br />
In the middle of the summer, we got the idea of the [https://2012.igem.org/Team:NTNU_Trondheim/Matchmaker Matchmaker]. What brought us to this idea was the fact that if you haven't already arranged a cooperation with another iGEM team, it is hard to find someone to cooperate with. We also knew that the NTNU iGEM team 2011 made many attempts to cooperate with other teams by sending out several emails, but they never recieved any answers.<br />
So we decided to make the Matchmaker, and so far, we think it has been very useful. Hopefully, you think so too! Even if it came quite late in the summer, it was used by several teams, and we hope it can be used by future iGEM teams as well.<br />
<br />
==Text book chapter on biobrick assembly methods==<br />
<br />
Early in the semester, we was asked by our advisor, Rahmi Lale, to write a chapter on biobrick assembly method for a text book he and Svein Valla, Professor at Dept. of Biotechnology, NTNU, are editing. The text book in question is called 'DNA cloning methods', and is part of the book series '[http://www.springer.com/series/7651 Methods in Molecular Biology]' published by Humana Press.<br />
<br />
{{:Team:NTNU_Trondheim/Templates/Sponsors}}<br />
<html><br />
</div></div></html><br />
{{:Team:NTNU_Trondheim/Templates/Footer}}</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/OutreachTeam:NTNU Trondheim/Outreach2012-09-25T14:19:03Z<p>Gunvor: /* Outreach */</p>
<hr />
<div>==Outreach==<br />
<br />
Our project also has an outreach part. Our main outreach project will be to participate in researchers' night, which is an event for high school students and students from non-degree granting colleges. The goal of researchers' night is to show the students that research is fun, to inspire them, and to motivate them to take higher education.<br />
As a second outreach project, the team will be writing a chapter on different biobrick assembly methods in a textbook. <br />
We also concider our matchmaker an important part of our outreach effort. <br />
More info about Researchers' night, our textbook chapter, and the matchmaker is given below.<br />
<br />
===Researcher's Night===<br />
<br />
<div id="myCarousel2" class="carousel slide"><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN1.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN2.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN3.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN4.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN5.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN6.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN7.PNG" alt=""><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
This year, the NTNU iGEM team is participating in Researchers' Night, which is an arrangement for high school students. This is the eighth year Researchers' night is being arranged, and it has traditionally been very popular at NTNU. The pictures above are all taken during Researchers' night 2011 (by Kristina Jones, NTNU). Last year, over 1200 students visited the arrangement. This year, Researchers' night will be arranged the 28th of september, and we have been inveted to participate. We are really looking forward to it, since this is a unique opportunity to tell students about the possibilities of synthetic biology, and motivate them for a career in biotechnology. It seems that the students are looking forward to it as well, since this year's arrangement was fully booked in 4 minutes!<br />
This year, the 1100 participating students can visit 31 different stands, one of them being ours. To get the students to understand the concept of giving organisms new characteristic properties by putting together biobricks, we have made a biobrick construction kit, including both DNA and restriction enzymes (a picture of the DNA from the construction kit is given below). We hope that this construction kit will make it easier both to understand why we are able to put together biobricks using certain combinations of restriction enzymes, and we also hope we can teach them what the different sequences that makes a gene are used for. <br />
<br />
<br />
{|border="0"<br />
|[[File:BiobrikkeByggesett.png|left|400px]]<br />
|}<br />
<br />
<br />
===Text book chapter on biobrick assembly methods===<br />
<br />
Early in the semester, we was asked by our advisor, Rahmi Lale, to write a chapter on biobrick assembly method for a text book he and Svein Valla, Professor at Dept. of Biotechnology, NTNU, are editing. The text book in question is called 'DNA cloning methods', and is part of the book series '[http://www.springer.com/series/7651 Methods in Molecular Biology]' published by Humana Press.<br />
<br />
<br />
===The iGEM Matchmaker===<br />
<br />
In the middle of the summer, we got the idea of the [https://2012.igem.org/Team:NTNU_Trondheim/Matchmaker Matchmaker]. What brought us to this idea was the fact that if you haven't already arranged a cooperation with another iGEM team, it is hard to find someone to cooperate with. We also knew that the NTNU iGEM team 2011 made many attempts to cooperate with other teams by sending out several emails, but they never recieved any answers.<br />
So we decided to make the Matchmaker, and so far, we think it has been very useful. Hopefully, you think so too! Even if it came quite late in the summer, it was used by several teams, and we hope it can be used by future iGEM teams as well.</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/OutreachTeam:NTNU Trondheim/Outreach2012-09-25T14:18:08Z<p>Gunvor: </p>
<hr />
<div>==Outreach==<br />
<br />
Our project also has an outreach part. Our main outreach project will be to participate in researchers' night, which is an event for high school students and students from non-degree granting colleges. The goal of researchers' night is to show the students that research is fun, to inspire them, and to motivate them to take higher education.<br />
As a second outreach project, the team will be writing a chapter on different assembly techniques in a textbook. <br />
We also concider our matchmaker part of our outreach effort. More info about Researchers' night, our textbook chapter, and the matchmaker is given below.<br />
<br />
===Researcher's Night===<br />
<br />
<div id="myCarousel2" class="carousel slide"><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN1.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN2.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN3.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN4.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN5.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN6.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN7.PNG" alt=""><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
This year, the NTNU iGEM team is participating in Researchers' Night, which is an arrangement for high school students. This is the eighth year Researchers' night is being arranged, and it has traditionally been very popular at NTNU. The pictures above are all taken during Researchers' night 2011 (by Kristina Jones, NTNU). Last year, over 1200 students visited the arrangement. This year, Researchers' night will be arranged the 28th of september, and we have been inveted to participate. We are really looking forward to it, since this is a unique opportunity to tell students about the possibilities of synthetic biology, and motivate them for a career in biotechnology. It seems that the students are looking forward to it as well, since this year's arrangement was fully booked in 4 minutes!<br />
This year, the 1100 participating students can visit 31 different stands, one of them being ours. To get the students to understand the concept of giving organisms new characteristic properties by putting together biobricks, we have made a biobrick construction kit, including both DNA and restriction enzymes (a picture of the DNA from the construction kit is given below). We hope that this construction kit will make it easier both to understand why we are able to put together biobricks using certain combinations of restriction enzymes, and we also hope we can teach them what the different sequences that makes a gene are used for. <br />
<br />
<br />
{|border="0"<br />
|[[File:BiobrikkeByggesett.png|left|400px]]<br />
|}<br />
<br />
<br />
===Text book chapter on biobrick assembly methods===<br />
<br />
Early in the semester, we was asked by our advisor, Rahmi Lale, to write a chapter on biobrick assembly method for a text book he and Svein Valla, Professor at Dept. of Biotechnology, NTNU, are editing. The text book in question is called 'DNA cloning methods', and is part of the book series '[http://www.springer.com/series/7651 Methods in Molecular Biology]' published by Humana Press.<br />
<br />
<br />
===The iGEM Matchmaker===<br />
<br />
In the middle of the summer, we got the idea of the [https://2012.igem.org/Team:NTNU_Trondheim/Matchmaker Matchmaker]. What brought us to this idea was the fact that if you haven't already arranged a cooperation with another iGEM team, it is hard to find someone to cooperate with. We also knew that the NTNU iGEM team 2011 made many attempts to cooperate with other teams by sending out several emails, but they never recieved any answers.<br />
So we decided to make the Matchmaker, and so far, we think it has been very useful. Hopefully, you think so too! Even if it came quite late in the summer, it was used by several teams, and we hope it can be used by future iGEM teams as well.</div>Gunvorhttp://2012.igem.org/Team:NTNU_Trondheim/OutreachTeam:NTNU Trondheim/Outreach2012-09-25T14:17:21Z<p>Gunvor: </p>
<hr />
<div>==Outreach==<br />
<br />
Our project also has an outreach part. Our main outreach project will be to participate in researchers' night, which is an event for high school students and students from non-degree granting colleges. The goal of researchers' night is to show the students that research is fun, to inspire them, and to motivate them to take higher education.<br />
As a second outreach project, the team will be writing a chapter on different assembly techniques in a textbook. <br />
We also concider our matchmaker part of our outreach effort. More info about Researchers' night, our textbook chapter, and the matchmaker is given below.<br />
<br />
==Researcher's Night==<br />
<br />
<div id="myCarousel2" class="carousel slide"><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN1.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN2.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN3.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN4.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN5.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN6.PNG" alt=""><br />
</div><br />
<div class="item"><br />
<img src="http://folk.ntnu.no/gunvor/iGEM/RN7.PNG" alt=""><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
This year, the NTNU iGEM team is participating in Researchers' Night, which is an arrangement for high school students. This is the eighth year Researchers' night is being arranged, and it has traditionally been very popular at NTNU. The pictures above are all taken during Researchers' night 2011 (by Kristina Jones, NTNU). Last year, over 1200 students visited the arrangement. This year, Researchers' night will be arranged the 28th of september, and we have been inveted to participate. We are really looking forward to it, since this is a unique opportunity to tell students about the possibilities of synthetic biology, and motivate them for a career in biotechnology. It seems that the students are looking forward to it as well, since this year's arrangement was fully booked in 4 minutes!<br />
This year, the 1100 participating students can visit 31 different stands, one of them being ours. To get the students to understand the concept of giving organisms new characteristic properties by putting together biobricks, we have made a biobrick construction kit, including both DNA and restriction enzymes (a picture of the DNA from the construction kit is given below). We hope that this construction kit will make it easier both to understand why we are able to put together biobricks using certain combinations of restriction enzymes, and we also hope we can teach them what the different sequences that makes a gene are used for. <br />
<br />
<br />
{|border="0"<br />
|[[File:BiobrikkeByggesett.png|left|400px]]<br />
|}<br />
<br />
<br />
===Text book chapter on biobrick assembly methods===<br />
<br />
Early in the semester, we was asked by our advisor, Rahmi Lale, to write a chapter on biobrick assembly method for a text book he and Svein Valla, Professor at Dept. of Biotechnology, NTNU, are editing. The text book in question is called 'DNA cloning methods', and is part of the book series '[http://www.springer.com/series/7651 Methods in Molecular Biology]' published by Humana Press.<br />
<br />
<br />
===The iGEM Matchmaker===<br />
<br />
In the middle of the summer, we got the idea of the [https://2012.igem.org/Team:NTNU_Trondheim/Matchmaker Matchmaker]. What brought us to this idea was the fact that if you haven't already arranged a cooperation with another iGEM team, it is hard to find someone to cooperate with. We also knew that the NTNU iGEM team 2011 made many attempts to cooperate with other teams by sending out several emails, but they never recieved any answers.<br />
So we decided to make the Matchmaker, and so far, we think it has been very useful. Hopefully, you think so too! Even if it came quite late in the summer, it was used by several teams, and we hope it can be used by future iGEM teams as well.</div>Gunvor