Submitted Parts

We have submitted three T7Lac promoter parts to the registry. The followings show the sequences of these constructs.
( BBa_K613007 ) Wildtype: TAATACGACTCACTATAGGGAGAGGAATTGTGAGCGGATAACAA
( BBa_K921000 ) Mutant I: TAATGCGACTCACTATAGGACAATTGTGGGCGGACAACAATTCCAA
( BBa_K921001 ) Mutant II: TAATACGACTCACTACAGGGCGGAATTGTGAGCGGATAACAATTCCAA
( BBa_K921002 ) Mutant III: CAATCCGACTCACTAAAGAGAGAATTGTGAGCGGATAACAATTCCAA

Predicted strength of the hybrid T7Lac promoters

Expected promoter strength of the mutants (relative to BBa_K613007):
Mutant I: <100%
Mutant II: ~100%
Mutant III: ~50%

Expected LacI leaky expression of different mutants:
Mutant I: More than average
Mutant II: Average
Mutant III: Average

Click here to see our results discussion.

Measured strength of the hybrid T7Lac promoters

We have measured both RNA and protein expression levels of the designed T7Lac promoters using fluorogen-activated biosensors (see details in Methods & Results ). These experimental results were analyzed using a mathematical model that we developed in MATLAB (see details in Model ). Based on the analysis, we obtained the following properties of the new T7Lac promoters with respect to the wild-type T7Lac promoter.

Promoter	Mutant I	Mutant II	Mutant III
Transcription Strength	97%	72%	127%
Translational Efficiency	169%	90%	160%
RNA degradation constant	.01204	.01204	.01204
Protein degradation constant	1.61	1.61	1.61

Discussion

BBa_K921000

The design of Mutant I (BBa_K921000) was based on random mutations throughout the promoter region including the recognition site, initiation site, and the lac operator. This promoter was expected to have a lower affinity to the T7 RNAP and therefore have a lower amount of protein expression. However, mutant I (BBa_K921000) of this set of T7/Lac promoters produces more protein than the wild type promoter (Bba_K613007). We hypothesize that the difference between prediction and experimental results is due to the lower affinity between T7 promoter and T7 RNAP, which allows the polymerase to initiate transcription more frequently.


BBa_K921001
The design of this mutant T7Lac promoter (BBa_K921001) was based on random mutations throughout the promoter including the recognition site, melting box, initiation site, and the lac operator. This promoter is expected to have a significantly lower initiation frequency due to the T->C mutation in the melting box. RNA polymerase denatures DNA at the melting box to initiate transcription. The melting box TATA presents in all T7 promoters. Thymine and adenine have lower melting temperatures and are easily melted. Guanine and cytosine form an extra hydrogen bond and cause base stacking, which increases their melting temperature, making it more difficult for RNAP to initiate transcription. This mutation was rationally made to decrease an initiation frequency, resulting in a weaker T7Lac promoter. Indeed, mutant II (BBa_K921001) of this set of T7/Lac promoters produces less protein than the wildtype T7Lac promoter (BBa_K613007).


BBa_K921002
The design of this mutant T7Lac promoter (BBa_K921002) was based on a different class of T7 promoters, which are weaker than the wildtype T7Lac promoter (BBa_K613007). Therefore, this promoter is expected to produce less protein than the wildtype promoter. However, this mutant promoter produces more protein than the wildtype promoter in our experiments. We hypothesize that this promoter does not burden cells as much as the wildtype T7 promoters, hence giving rise to higher translation rate of mRNA.

We note that multiple dips were recorded in the readings of all three mutated promoters. This could be due to a strong metabolic burden and multiphasic growth of bacteria.