"
Team:Caltech/Notebook/Proteorhodopsin
From 2012.igem.org
Proteorhodopsin Notebook
6/22/12
Julia - transformed K572005 (proteorhodopsin gene from the Parts Registry)
Daisy - ordered primers for Polymerase Cycling Assembly (PCA) reaction to create a proteorhodopsin optimized for E. coli
Back to the top
6/25/12
Chenxi - Transformed pKD46 into wild type MG1655 E.coli strain using electroporation; designed primers to PCR pKD4 Kan resistance gene for lambda red knockout of nuo and ndh genes (NADH dehydrogenases)
Julia - miniprepped K572005 and sent it in for sequencing
Daisy - made 50 uL aliquots of electrocompetent E. coli cells
Edward -Ran PCR on AMP resistant back bone with annealing temperatures from 61-65 degrees Celcius
Back to the top
6/26/12
Chenxi - PCR pKD4 kan for nuo and ndh; ran gel
Julia - K572005 sequence is completely different from the one listed in the Parts Registry, but the sequence matches with a different part (contamination)
Edward- Ran low melting temp gel with the AMP resistant backbone
Samples should be 2.2kb long
BB should be shorter than insert (if they are not they need to be relabled) ---- was correct
Sample (25 microL DNA + 6 microL Dye)
5 microL ladder
Purified (2 microL DNA + .5 microL Dye)
61C 62C 63C 64C 65C Ladder BB insert
1% low melting temp gel
followed by a gel extraction
Resulted in 2ng/microL and two 5ng/microL samples ---- not good enough to do the Gibson reaction
Next will order new primers to try and have more efficient copying of backbone with AMP resistance
Gibson-bb-f Gibson suffix region 5' - TACTAGTAAACAGGGTTCTCGAGC - 3' Melting temp 55.7
Gibson-bb-r RC from Gibson prefix region 5' - CTCTAGAAAGATCTCCGCAGCA - 3' Melting temp 54.8
Back to the top
6/27/12
Daisy - began PCA protocol: ran PCR to make the preassembly mix, IPIPE, and VPIPE constructs; ran gel electrophoresis on the PCR products to check that the PCRs worked
Edward - Ran PCR with new primers to make backbone
Back to the top
6/28/12
Daisy - continued PCA protocol: ran PCR to make the CPEC and IPIPE (from existing IPIPE, not preassembly mix) constructs; transformed electrocompetent cells with CPEC+VPIPE (positive control; no change the protocol), CPEC-VPIPE (negative control; replaced VPIPE with sterile water), IPIPE+VPIPE (alternate positive control), and VPIPE (alternate negative control) and plated them
Back to the top
6/29/12
Daisy - plate results: VPIPE and CPEC-VPIPE negative controls had no colonies, IPIPE+VPIPE had only one colony, CPEC+VPIPE had many colonies; started overnight cultures of IPIPE+VPIPE and CPEC+VPIPE constructs of proteorhodopsin
Back to the top
6/30/12
Daisy - miniprepped the overnight cultures and measured their concentrations
Back to the top
7/1/12
Back to the top
7/2/12
Edward- Gel extraction for the bb on both Products from extraction mixed
Daisy - sent miniprep samples in for sequencing
Back to the top
7/3/12
Edward - transformation with product from 7/2 ligated to pSB1A3
Daisy - sequencing results returned: IPIPE+VPIPE construct is incorrect; accidentally mixed the CPEC+VPIPE sequences (will redo)
Back to the top
7/4/12
Edward-PCR with Phusion on colonies
Daisy - regrew 3 CPEC+VPIPE overnight cultures and made glycerol stocks
Back to the top
7/5/12
Daisy - miniprepped the CPEC+VPIPE cultures, measured their concentrations, and sent them in for sequencing
Back to the top
7/6/12
Edward - sequencing unsuccessful, ordered new primers
Back to the top
7/10/12
Edward - ran pcr with new primers 53C annealing temp (unsuccessful)
Back to the top
7/15/12
Edward - reran pcr with primers at 60C - successful
Back to the top
7/20/12
Edward - ligated and transformed using proteorhodopsin without retinal pathway
Back to the top
7/21/12
Edward - colony pcr on cells
Back to the top
7/25/12
Edward - received successful results from sequencing
Back to the top
