Introduction

LovTAP-VP16 is the name of the protein our light switch is based on. But it has never been expresed before and, therefore, there is no literature telling us under what conditions it works or whether it works at all. It's a fusion protein between LovTAP, which is itself a fusion protein, and a part of VP16, a viral transcription activator.

In this case we don't want any kind of steric interaction between LovTAP and VP16, since that might alter the functionality of one or both parts and we just want VP16 to be transported by LovTAP. To ensure this, a linker might be needed to physically separate the domains. Since LovTAP-VP16 has to be in the nucleus of the cell to work, the minimal linker would be a 7 residues long Nuclear Localazation Signal (NLS) from the virus SV40, with the amino aced sequece PKKKRKV.

In order to visually verify if a longer linker would be needed, we put together the existing crystal structures of the domains LovTAP-VP16 consists of: LOV2, TrpR, NLS and VP16.

How LovTAP is thought to work

Allosteric regulation

In a protein, generally an enzyme, an allosteric site is any part of the protein other than the active site.

Allosteric regulation of a protein consists in modifying its properties by interacting with an allosteric site. One example would be the regulation in the tryptophan (trp) operon, a group of genes studied in E. coli that are required for the synthesis of the amino acid tryptophan. The expression of these genes can be blocked by the homodimeric protein tryptophan repressor (TrpR), by binding the operator of the operon. TrpR repressing function is only active when tryptophan is bound to its allosteric sites, i.e. it blocks the production of tryptophan when the concentration of tryptophan is high.

LovTAP

In a paper published in 2008 [http://www.pnas.org/content/105/31/10709.abstract], Strickland et al. propose to modify the protein TrpR such that its activity can be controlled by light. This is done by fusing it to a light sensitive protein, the plant phototropin LOV2 (Light-Oxygen-Voltage), whose sensitivity to blue light is conferred by the ligand chromophore flavin mononucleotide (FMN). The fusion is done in a way that both domains share a common α-helix, which would create a sort of lever that could transfer the conformational changes in LOV2 when light-activated towards TrpR, triggering its activation.

TrpR

Dimerizes and bind the TrpO sequence: CGTACTAGTTAACTAGTACG

LOV2

Saturates at 20 mW/cm^-2 irradiance at 470 nm according to Strickland 2008.

LOV2 photoproduct from phot1 has a half life of 30-40 s in Arabidopsis and rize. LovTAP has LOV2 from phot1 in Avena sativa. [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC161699/table/TII/]

VP16

[http://pubs.acs.org/doi/full/10.1021/bi0482912|Paper] stating that the part of VP16 we used (456-490) behaves as transcriptional activator.

{{:Team:EPF-Lausanne/Template/Footer}