Team:LMU-Munich/Bacillus BioBricks

From 2012.igem.org

Revision as of 13:58, 22 September 2012 by Jara (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

The LMU-Munich team is exuberantly happy about the great success at the World Championship Jamboree in Boston. Our project Beadzillus finished 4th and won the prize for the "Best Wiki" (with Slovenia) and "Best New Application Project".

[ more news ]

BBB banner.jpg

Bacillus BioBricks

We will create a toolbox of Bacillus BioBricks to contribute to the registry.

This BacillusBioBrickBox contains Bacillus specific:

Vectors	Promoters	Reporters	Affinity tags

pSB_Bs1C pSB_Bs4S pSB_Bs2E pSB_Bs1C-lacZ pSB_Bs3C-luxABCDE pSB_Bs4S-P_Xyl pSB_Bs0K-P_spac	Pveg PliaI PlepA Anderson	mkate2 luc lacZ	Flag His cMyc Strep HA

Bacillus Vectors

Here is a list of all the vectors we cloned and used. Please note that pMAD is not in a BioBrick standard, but it is a useful tool to knock out genes in Bacillus subtilis.

For the use of our vectors, please see our Protocols page. A general introduction to Bacillus subtilis and its integrative vectors can be found here. All vectors have ampicillin as E. coli resistance and RFP in the multiple cloning site as selection marker.

Name BioBrick	E. coli res.	B. subt. res.	Insertion locus	Description	Derived from	Reference
pSB_Bs1C [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823023 (BBa_K823023)]	Amp	Cm	amyE	empty	pDG1662	[http://www.ncbi.nlm.nih.gov/pubmed/8973347 Guérout-Fleury et al.]
pSB_Bs4S [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823022 (BBa_K823022)]	Amp	Spec	thrC	empty	pDG1731	[http://www.ncbi.nlm.nih.gov/pubmed/8973347 Guérout-Fleury et al.]
pSB_Bs2E [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823027 (BBa_K823027)]	Amp	MLS	lacA	empty	pAX01	[http://www.ncbi.nlm.nih.gov/pubmed/11274134 Härtl et al.]
pSB_Bs1C-lacZ [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823021 (BBa_K823021) ]	Amp	Cm	amyE	with lacZ reporter gene	pAC6	[http://www.ncbi.nlm.nih.gov/pubmed/11902727 Stülke et al.]
pSB_Bs3C-luxABCDE [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823025 (BBa_K823025)]	Amp	Cm	sacA	with luxABCDE reporter cassette	pAH328	[http://www.ncbi.nlm.nih.gov/pubmed/20709900 Schmalisch et al.]
pSB_Bs4S-P_Xyl [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823024 (BBa_K823024)]	Amp	Spec	thrC	with Xylose-inducible promoter	pXT	[http://www.ncbi.nlm.nih.gov/pubmed/11069659 Derré et al.]
pSB_Bs0K-P_spac [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823026 (BBa_K823026)]	Amp	Kan	replicative	with IPTG inducible promoter	pDG148	[http://www.ncbi.nlm.nih.gov/pubmed/11728721 Joseph et al.]
Sporovector [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823054 (BBa_K823054)]	Amp	Spec	thrC	to create Sporobeads	pSB_Bs4S

Here you can find the respective vector maps:

The number in the vector's name codes for the insertion locus and the following letter for the Bacillus subtilis resistance gene according to the following table:

Number	Insertion locus	Letter	Resistance
0	replicative	C	Chloramphenicol
1	amyE (amylase)	E	MLS (Erythromycin + Lincomycin)
2	lacA (β-galactosidase)	K	Kanamycin
3	sacA (sucrase)	S	Spectinomycin
4	thrC (threonine C)

The concentrations of the antibiotics and the insertion tests can be found in our Protocol section.

Bacillus Promoters

To get a set of promoters with different strength we characterized several promoters in B. subtilis. They can be divided in three different groups: the constitutive promoters from the [http://partsregistry.org/Part:BBa_J23100 Anderson collection] from the Partsregistry, the constitutive promoters P_liaG, P_veg and P_lepA from B. subtilis, and the inducible promoters P_liaI and P_xyl-XylR from B. subtilis. For the characterization of the different promoters we used the two reporter vectors pSB_Bs3C-luxABCDE and pSB_Bs1C-lacZ as well as the reporters lacZ, luc and mKate2 in BioBrick standard.

Anderson promoters

The first group of promoters evaluated are the promoters of the [http://partsregistry.org/Part:BBa_J23100 Anderson collection] which we call Anderson promoters. They have already been measured in Escherichia coli where they all showed a constitutive behavior with a different strength. In this project, eleven Anderson promoters were characterized in B. subtilis. Therefore we used the reporter vector pSB_Bs3C-luxABCDE from the BioBrickBox were they showed quiet a low activity in B. subtilis (see Data). To confirm this result some Anderson promoters were also evaluated in the reporter vector pSB_Bs1C-lacZ(see Data).

J23100 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823004 BioBrick:BBa_K823004])
J23101 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823005 BioBrick:BBa_K823005])
J23102 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823006 BioBrick:BBa_K823006])
J23103 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823007 BioBrick:BBa_K823007])
J23106 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823008 BioBrick:BBa_K823008])
J23107 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823009 BioBrick:BBa_K823009])
J23113 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823010 BioBrick:BBa_K823010])
J23114 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823011 BioBrick:BBa_K823011])
J23115 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823012 BioBrick:BBa_K823012])
J23117 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823013 BioBrick:BBa_K823013])
J23118 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823014 BioBrick:BBa_K823014])

Constitutive promoters from B. subtilis

The second group of promoters charaterized are constitutive promoters from B. subtilis. We evaluated the promoters P_liaG, P_veg and P_lepA. Therefore we used the reporter vectors pSB_Bs3C-luxABCDE and pSB_Bs1C-lacZ as well as the BioBrick reporters lacZ, luc and mKate2.

P_liaG ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823000 BioBrick:BBa_K823000])

P_liaG is a weak, constitutive promoter from B. subtilis. It is responsible for the transcription of the last four genes of the liaIHGFSR locus and therefore for the production of the components of the LiaRS system, which is important for the detection of cell wall antibiotics [http://www.ncbi.nlm.nih.gov/pubmed?term=Journal%20of%20Bacteriology%2C%20188%20%2814%29%3A%205153%E2%80%935166: (Jordan et al., 2006)]. P_liaG was evaluated with the reporter vectors pSB_Bs3C-luxABCDE and pSB_Bs1C-lacZ as well as the reporter BioBrick lacZ. This promoter showed a much higher activity than the Anderson promoters which was still weak in comparison to the other evaluated Bacillus promoters (see Data).

P_veg ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823003 BioBrick:BBa_K823003])

P_veg is known to show a strong constitutive activity during the vegetative growth phase and sporulation phase. This promoter is important for the transcription of the veg gene, which plays an important role during sporulation [http://www.ncbi.nlm.nih.gov/pubmed?term=J.%20Biochem.%2C%20133%20%284%29%3A%20475%E2%80%93483: (Fukushima et al., 2003)]. P_veg was measured by using the reporter vector pSB_Bs1C-lacZ as well as the reporter BioBrick lacZ. This promoter was the strongest of our evaluated promoters (see Data).

P_lepA ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823002 BioBrick:BBa_K823002])

P_lepA is constitutive promoter which is important for the transcription of a bicistronic operon. One of the expressed proteins is the protein PlepA [http://www.ncbi.nlm.nih.gov/pubmed?term=Microbiology%2C%20142%3A%201641%E2%80%931649: (Homuth et al., 1996)]. This protein plays an important role during the translation as it can move the mRNA-tRNA complex one step back in the ribosome which is expected to improve the fidelity of translation [http://www.ncbi.nlm.nih.gov/pubmed?term=Cell%2C%20127%20%284%29%3A%20721%E2%80%93733: (Qin et al., 2006)]. This promoter was evaluated with the reporter vector pSB_Bs3C-luxABCDE as well as the reporter BioBricks luc and mKate2. The activity of this promoter is between the activity of the strongest promoter P_veg and the weak Bacillus promoter P_liaG (see Data).

Inducible promoters from B. subtilis

The last group of promoters consists of two inducible promoters of B. subtilis , P_liaI and P_xyl-XylR. They are useful to decide when to turn on gene expression because these promoters need an inducer to start transcription. They are evaluated with the reporter vectors pSB_Bs3C-luxABCDE and pSB_Bs1C-lacZ and the BioBrick reporters lacZ, luc and mKate2.

P_liaI ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823001 BioBrick:BBa_K823001])

P_liaI is an inducible promoter from B. subtilis which is induced by antibiotics that interact with the lipidII cycle, e.g. bacitracin. If the cell senses stress there is a phosphorylation of the two proteins LiaS and LiaR. LiaR binds to the operator of the promoter and induces the transcription. When the promoter is turned on the two proteins LiaI and LiaH are expressed which play an important role in the stress response [http://www.ncbi.nlm.nih.gov/pubmed?term=Journal%20of%20Bacteriology%2C%20188%20%2814%29%3A%205153%E2%80%935166: (Jordan et al., 2006)]. This promoter is evaluated with the reporter vectors pSB_Bs3C-luxABCDE and pSB_Bs1C-lacZ as well as the reporter genes lacZ, luc and mKate2. The induction was measured with different concentrations of bacitracin (see Data).

P_Xyl-XylR ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K8230015 BioBrick:BBa_K823015])

P_Xyl-XylR is a inducible promoter from B. subtilis which is induced by xylose. XylR is constitutively expressed, and is the repressor of P_Xyl in absence of the sugar Xylose. In presence of Xylose, XylR leaves the operator and the P_Xyl is active [see e.g. [http://www.ncbi.nlm.nih.gov/pubmed/2544559 Kreuzer et al.]. This promoter was evaluated with the BioBrick reporter lacZ (see Data).

Bacillus Reporters

We designed some reporters that are commonly used in B. subtilis or are codon optimized versions of popular reporter genes. All reporters have a modified iGEM Freiburg standard ([http://partsregistry.org/Help:Assembly_standard_25 RCF 25]) pre- and suffix for assembly of in-frame fusion proteins. Our prefix also includes the B. subitlis optimized RBS.

prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

GFP ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823039 BioBrick:BBa_K823039])

We took a gfp derivate of the Bacillus subtilis plasmids pGFPamy and added the BioBrick compatiple pre- and suffix of the Freiburg standard (Assembly 25).

mKate ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823029 BioBrick:BBa_K823029])

We synthesized this rfp derivate with a codon-optimized version for the use in B. subtilis with pre- and suffix of the Freiburg standard

LacZ ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823019 BioBrick:BBa_K823019])

lacZ under the control of Pspac in pSB_Bs0K-P_spac. Plate induced with IPTG

This lacZ gene is derived from the Bacillus reporter vector pAC6. It is constructed in the Freiburg Standard (Assembly 25) for in-frame fusion proteins. It also includes a Shine-Dalgarno Sequence optimized for Bacillus subtilis translation.

luc ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823028 BioBrick:BBa_K823028])

We synthesized this luciferase for luminescence assays with luciferin as substrate.

Affinity Tags

3x Flag - tag [http://partsregistry.org/Part:BBa_K823034 (BioBrick:BBa_K823034)]

HA - tag [http://partsregistry.org/Part:BBa_K823035 (BioBrick:BBa_K823035)]

cMyc - tag [http://partsregistry.org/Part:BBa_K823036 (BioBrick:BBa_K823036)]

His - tag [http://partsregistry.org/Part:BBa_K823037 (BioBrick:BBa_K823037)]

Strep - tag [http://partsregistry.org/Part:BBa_K823038 (BioBrick:BBa_K823038)]

Project Navigation


Bacillus Intro	Bacillus BioBrickBox	Sporobeads	Germination STOP

Retrieved from "http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks"