Team:Carnegie Mellon/Bio-Overview
From 2012.igem.org
Revision as of 20:44, 15 September 2012 by Enpederson (Talk | contribs)
Promoter variants
The BioBricks are T7/Lac promoters that are mutated from both the T7 promoter and in the lac operator, which offers unique functionality in cells. This year, we are submitting a total of 4 BioBricks to the Registry of Standard Biological Parts.T7
The T7 promoter comes from the T7 phage and is a class of very strong promoters. T7 promoters can only be expressed in strains of bacteria with the gene that codes for T7 RNA polymerase (the unique polymerase that binds to the T7 promoter). The T7 promoters come in different classes, and each class corresponds to a different level of expression. The commonly used T7 promoter is the class I variant because of its ability to produce a high amount of protein. The T7 promoter has 3 distinct regions: the recognition site, the melting box and the initiation site. The recognition site is the specific region that the T7 promoter binds to. The melting box is highly conserved, consisting of TATA. The melting box allows the T7 RNAP to open the two strands of DNA and start adding NTPs to build mRNA. The last region is called the initiation site; this is where the first nucleotide of the mRNA is added. Most prokaryotic RNAPs favor the addition of adenine to start transcription but T7 RNAP differs in that it favors the addition of guanine. As a result, most T7 promoters have a poly-G region of 3-5 nucleotides to increase the chance of initiation. BBa_K613007 is a classic example of a T7 lac promoter but let's analyze the T7 region.
BBa_K613007:TAATACGACTCACTATAGGGAGAGGAATTGTGAGCGGATAACAA
T7 region:
TAATACGACTCAC - Recognize
TATA - Melt
GGGAGA - Initiate Transcription