Team:Leicester/August2012

(9:30 am) Several members of the team are given wrong start times, so only 1 student arrived in the lab at 9:30, however with the work needed to be done all the rest of the team are quickly on their way.

(10:30 am) With everyone now in the lab it turns out a lot of the work planned for today has to wait until tomorrow. This is due to the ''Pseudomonas'' strains needed to be grown in a rich luria broth before we can spin it into a pellet and then run the DNA extraction.

(11:40 am) With all the bacteria placed in the 15ml corning tubes, and placed in the orbital shaker all of today's lab work is complete. Now the team is going to finish the recording for the rockethub video as some scenes need to be retaken, then do some individual research/work.

(13:30 pm) After consulting with a supervisor and having a long meeting over lunch the team has decided several directions that is needed to go in. One member is testing the cooling times of a water bath that will be used in the hybridizing process of making our DNA libraries, and to start selecting out of the DNA genes that are in both our Pseudomonas and the NB26 strain that definitely degrades polystyrene. A couple of members are looking through protocol and methods to use with the DNA extraction.

(9:30 am) An early start finishing all the protocol and work needed to start making the DNA libraries.

(10:00 am) ''E. coli'' is placed into 7ml of LB media and put into the warm room to grow overnight and be used as the test tomorrow to check the DNA extraction process before using the ''Pseudomonas'' species.

(11:30 am) The protocol for tomorrow's practicals is determined, for the test of the DNA extraction, as well as dilutions to check the growth so there is a measurable amount that the ''Pseudomonas'' can be compared to, so in future to measure the amount of ''Pseudomonas'' the team has it can simply be spectroscopically analyzed.

(4:00 pm) Made the ''E. coli'' into a 50ml broth to grow overnight for the dilutions and spectrophotometry.

(9:00 am) Action stations. All lab work is go. Today there are 2 experiments going: the DNA extraction test and the dilutions to test the method works. Once these are done, the team knows what works and doesn't work for the real experiments on ''Pseudomonas'' early next week.

(10:30 am) The team splits into 2 groups and goes to do the tasks.

The half doing the dilutions to make the growth curve left our dedicated bit of lab space and headed into one of the supervisor's labs with a good spectrophotometer and space to work with the bacteria.

Protocol:

1. Take a reading of the overnight broth.

2. Innoculate a new conical flask of 49.9ml luria broth, with 0.1ml of overnight culture.

3. Put 1ml of culture into a spectrophotometer and take a reading at 600nm. Record this as time = 0. Start the timer.

4. At same time, take an aliquot of 100ul and put in eppendorf marked as time 0, 10^-1 dilution. Add 900ul of buffer and mix, then take 100ul from this solution and add to next eppendorf, marked time 0, 10^-2 dilution and so on to 10^-9.

5. Pipette 100ul of dilutions 10^-4 to 10^-9 onto similarly labelled pre-prepared agar plates and spread them.

6. Repeat step 2 every 40 minutes and step 4 every 2 hours (3 divisions of E. coli) until the end of time.

7. Leave plates to grow, then count the number of colonies growing on the most concentrated plate where colonies are distinguishable. Multiply up to the true concentration, then multiply by 10. This is colonies/ml.

8. Draw graph to see correlation and check against known correlation to see if it has worked.

(16:30 pm) The dilutions and CFU count part of the experiment is finished, there is 6 hours of readings for the CFU count as well as plates for 0, 2 and 4 hours.

No entry for this date.

The only thing needed to be done today is help the technician gave the team. This involved producing ''E. coli'' overnight cultures for the DNA extraction and digest.

(9:30 am) Today the team is going to extract the genome and start the DNA digest of the ''E. coli'' to test the DNA extraction kit and procedure that the team has identified to use.

This is a big step that if works, can then be applied to the ''Pseudomonas'' strains that are growing. So that once the NB26 strain arrives it can be compared straight away to give an idea which genes could be involved in the degradation of polystyrene and to help start narrowing our search.

The overnight cultures of E. coli were then analysed using the spectrophotometer to give an initial bacterial cell count before the digest.

(12:30pm) The results for Friday's experiment is back. Unfortunately the data that was collected is not enough to create a graph to simply show us what the bacteria cell count is from reading an absorbance.

The new protocol for today's experiment that will tell the team this data is:

1. Take a reading of the overnight broth.

2. Inoculate 49.9ml of broth with 0.1ml of the overnight bacteria colony. Mix, start timer, and immediately do 3 and 4.

3. Put 1ml of culture into a spectrophotometer and take a reading at 600nm. Record this as time = 0. Start a timer.

4. At same time, take an aliquot of 100ul and put in eppendorf marked as time 0, 10^-1 dilution. Add 900ul of buffer and mix, then take 100ul from this solution and add to next eppendorf, marked time 0, 10^-2 dilution and so on to 10^-7.

5. Pipette 100ul of dilutions 10^-5 to 10^-7 onto similarly labelled pre-prepared agar plates and spread them.

6. Repeat steps 3-5 every 40min (1 doubling of E. coli) (labelling time appropriately) until the end of time.

7. Leave plates to grow, then count the number of colonies growing on the most concentrated plate where colonies are distinguishable. Multiply up to the true concentration, then multiply by 10. This is colonies/ml.

8. Draw graph to see correlation and check against known correlation to see if it has worked.

(13:30pm) After finally finishing all the reading up and gathering of ingredients, the DNA extraction process is finally started. Protocol is as mentioned in the QIAGEN Genomic DNA Handbook.

Almost as soon as it was started the first few sections were complete and the cells needed to be left in a 37oC water bath for a while so the team members had to wait again. And then had to wait again after adding different buffer while the cell extract was left at 50oC.

(15:00) The current step is using the genomic tip protocol to extract DNA. Unfortunately, the flow rate is very slow so this may take a while until the DNA can be washed and eluted.

(17:30) Today's refinement of the growth curve experiment worked. Well at least the protocol did, the actual experiment failed but after talking to the supervisor in a group meeting, the team realized what went wrong so it would work tomorrow. Just before finishing, 3ml of luria broth was inoculated with a single colony of ''E. coli'' as well as the plates being made up.

(8:00 am) A very early start for part of the group working on fixing the dilutions experiment. In for 8am, and started at 8:30 for a long day's practical.

(14:30 pm) The final set of plates and spectrophotometry readings have been taken. Now they can grow overnight to see if it works.

(9:30 am) The plates had grown, but unfortunately they had all grown a ridiculous amount. It turns out that the luria broth had been contaminated with some bacteria. The group didn't realize this as it was thought some of the nutrients had suspended like what had happened to our minimal media beforehand. This means another experiment must be done to see if it can finally be done right.

(11:30 am) The final dilutions experiment was started, but it needed time to grow out of lag phase. Just before lunch it still hadn't started to grow so the group was starting to despair, but after a long lunch break it had finally started to grow.

(14:30 pm) The final series of plating and spectrophotometry has started, only time will tell if it is finally right.

(11:00 am) It worked! The final dilutions experiment came back with close to expected results so the plates could be counted and a graph made to show the cell count against absorbance.

While the lab leader was away the iGEM team carried on with business as usual.

However it was a different kind of business as the rest of the group decided to work on the Rockethub video, as it was getting late in the time the group had left to complete the video, so there is spare time to edit and so forth.

No entry for this date.

No entry for this date.

(11:00 am) Continuation of the DNA extraction. Finishing plating up all the CSE kits onto minimal media and polystyrene mix.

(12:00 pm) All the CSE kits are plated and incubating in the warm room ready to be analysed and hopefully come up with a positive result.

(16:00 pm) After the iGEM Weekly meeting, the overnight cultures were prepared ready for starting the next Genomic tip, while the supervisor and a couple of members prepared the lab ready for tomorrow after the leak.

(11:00 am) The group running the DNA extraction had a busy day ahead. First of all setting up to run the gel tomorrow, as well as finishing off the genomic tip number 2 prep. This included a team member and the supervisor trying to improvise a method to generate more pressure on the tip to produce a rate of 20-40 drips per min, as it was taking in excess of 24 hours for 10ml to flow through the column. This step was necessary as protocol says for slow rates to use a adaptor that would apply the pressure. As the team didn't have an adaptor, or syringe plunger that was the correct size, an improvisation was made, testing the used column in different ways to apply the pressure. Methods tried were adding a cut down syringe to the top of the column which then could accommodate a plunger, and using a oversized plunger rubber then pressing down with a thumb pushing into the top of the column to create the pressure needed. The second method was used this time to finish off the column as there was only about 2ml to run through. After this the samples were prepared to be loaded onto the gel tomorrow.

(13:00 pm) Once the column was finished, the eluted DNA was separated equally into 24 eppendorf tubes and span for 11 minutes at 13,000G. This was an alteration to the protocol by QIAGEN as it stated at least 5000G in the falcon tubes. However the centrifuge in the iGEM lab can't run this fast with the 50ml falcon tubes, so the separation was needed for the DNA to be span faster. 5000G was the minimum speed so they were span at the max for the centrifuge, making sure the hinge of the eppendorfs was pointing outwards so the pellet could easily be found.

(13:15 pm) After the centrifugation there was no large visible pellet, and but the group proceeded as if there was one on the orientated side of the eppendorf away from the hinge. After a second spin to remove more liquid, 500 micro litre of the 70% ethanol was added to wash the DNA of any salts using the same pippette tip transferring it between 5 of the tubes at a time as the total volume of ethanol to be used was 4ml. The supernatant was then removed and the eppendorf tubes were then allowed to air dry for 20 minutes.

(14:00 pm) The DNA was then re-suspended in 50 micro litre per eppendorf in TE buffer ( PH 8.0 ), placing all of the eppendorf tubes in the 55 degrees hot block for the next hour. This is the dissolving stage to re-suspend the DNA.

(15:00 pm) Once this was finished the DNA was recombined into a single falcon tube and the aliquots were prepared for the Gel electrophoresis.

For the samples, there is a 4x dilution of each aliquot, as well as the pure DNA, just in case there is a large amount of genomic DNA in the samples. These are stored in the 5 degrees room ready for the morning.

(11:00 am) The group running the experiment for the rate of doubling within ''P. aeruginosa'' was started, the protocol is as follows.

1. Inoculate 49.5ml broth with 0.5ml of concentrated strain to give a 1% dilution (stock 1). Leave in warm room for 135min.

2. Take 5ml of stock 1 and inoculate into 35ml of broth. Start timer, take spectrophotometer reading at 600nm (zeroed with broth) of 1ml of both stock 1 and the further 8 fold dilution (stock 2).

3. After 5 mins, take a further reading of stock 2. Repeat for 135min, at which point the spec reading should equal the stock 1 reading at time zero (three doublings at 45minutes each).

(11:30 am) After about 30 minutes the readings where going all over the place, almost randomly. So the group decided to edit the protocol slightly. The reasoning for this is thought to be because the group is taking too much of the stock out so the bacteria doesn't have time to recuperate the numbers.

1. Take 5ml of stock 1 and inoculate into 35ml of broth. Start timer, take spectrophotometer reading at 600nm (zeroed with broth) of 1ml of both stock 1 and the further 8 fold dilution (stock 2).

2. After 20 mins, take a further reading of stock 2. Repeat for 135min, at which point the spec reading should equal the stock 1 reading at time zero (three doublings at 45minutes each).

(13:45 pm) This took the group nicely to lunch, with good results, so the growth curve experiment could be done tomorrow as the ''Pseudomonas'' has a doubling time of about 35 minutes.

(15:00 pm) The afternoon was taken up by labelling plates and eppendorfs, as well as melting agar, then producing the plates. This took a few hours, by which point the group decided it was time to go home and start fresh tomorrow.

(9:00 am) Chris loaded the dye upon the gel electrophoresis and it is currently running the aliquots taken along the genome extraction of E.coli to make sure we have been doing it correctly. There seems to be very low yield from the maxi prep so are trouble shooting the problems with the tip e.t.c and altering some of the steps from the prescribed QIAGEN genome extraction kit.

(11:15 am) Boiling the RNase for 10 minutes to make sure that it re-conforms to the RNase rather than DNase which is possible after a long period of time. This may have been the case with the previous 2 genomic tips, so trying this to see if we can gain a higher yield this time. Gel is still running and is now about half way. Will is now using the nanodrop spectrophotometer to see if there is DNA in the aliquots and the pure DNA elution.

(12:00 am) Genomic tip 2 gel results were blank, (image to follow) so we're thinking it was the RNase as there was no DNA in even the aliquot 1 from the gel. Markers and our mini prep showed the DNA ran as such. Now we are preparing the cultures Chris made two nights ago for another Maxi prep with the E.coli, however with the boiled RNase and other alterations to the method. to start we are pelleting the bacteria, OD600 3.25 scaled from a 10x dilution, so we have 2.6x10^9 cells per ML, the max for the prep is 1x10^11 cells so we are using 28ML of our culture, working out at 7.28x10^10 cells which is in the limit. the cultures have been balanced equally and are now spinning in the centrifuge at 2600G which is as high as the centrifuge will go with this size falcon tubes, as this is slightly under the 3000G recommended, we are spinning for longer to maximize the size of the pellet. Once the supernatant has been removed, we will re-spin to make sure any remaining liquid has drained to the bottom to then pipette this off to make sure there is no supernatant left.

(14:30 am) Lysate is now in the 50 degree incubation stage to digest the proteins from the solution so that they can flow through the column. This has now been going for 45 minutes and has yet to become as clear as before, due to this we are going to incubate for another 30 min then spin at 4 degrees for 20 minutes which maybe due to having cells that are intact. We then want the clear supernatant to go into the tip. While Will is doing this, Nathan has made up more of the 0.5% TBE buffer solution for the gel tank while Chris is making the agarose and preparing the gel tray, This was done by following the GENIE video which can be seen on youtube at ([http://www.youtube.com/watch?v=wXiiTW3pflM]) the agarose is currently in the Hybridiser cooling to 60 degrees so it can then have the Ethidium Bromide added and be poured into the gel tray. Results from the Nano Drop Spectrophotometer were 2.5ng per micro litre ( from read out), A260 = 0.051 A280 = 0.021 Ratio = 2.43 which is quite high as it should be between 1.7 and 1.9 which means that we may have had DNA with a mixture of RNA but running the gel shows that there was no bands of DNA so it was most likely digested... Hopefully the boiling of the RNase to get it to refold should fix this problem as well as doing the other additional steps Dr Dalgleish suggested.

(16:15 am) The cell lysate had still yet to become clear after the further incubation, so we span for what ended up being 35 minutes at max speed for the 50ml falcon tube centrifuge. There then became a large fluffy mass of protein and cells that was at the bottom ( however not forming a pellet) which is making it hard to remove the supernatant that contains the DNA. We are now trying to remove this by passing the lysate through a 4 micron syringe filter

(17:15 am) Protein mass was removed and the lysate was passed through the genomic tip. The flow rate was much faster than the other two preps, being within the 20-40 drops per min as stated by the kit, with a slight positive pressure from time to time. We ran through the kit, and have ended up getting to the precipitation stage.

(09:00 am) The other half of the team doing the growth curve experiment also started early. However after arriving and realizing that an overnight culture was not made, the experiment could not be carried out today. This meant that there wasn't much for the group to do. So the protocol was checked through to make sure it was correct and that the group knew what was happening.

(14:00 pm) An overnight culture was produced and the group headed home with nothing else to do, to have a relaxing afternoon in the sun.

(11:15 am) Eluted DNA from yesterday is now spinning down the centrifuge, we separated the eluted DNA equally into 24 eppendorf tubes and span for 11 minutes at 13,000G . This was an alteration to the protocol by QIAGEN as it stated at least 5000G in the falcon tubes, however as our centrifuge can't do this with the 50ml falcon tubes we separated it into eppendorf tubes which could then be span faster. 5000G was the minimum so we span them at the max for the centrifuge, making sure the hindge was pointing outwards so to know where to look for the pellet. After this there was no large visible pellet however there was at least something this time that looked like a pellet orientated on side of the eppendorf away from the hinge. After a second spin to remove more liquid, we then added 500 micro litre of the 70% ethanol to wash the DNA of any salts using the same 500 micro litre transferring it between 5 of the tubes at a time as the total volume of ethanol to be used was 4ml. The supernatant is then removed and the eppendorf tubes are then allowed to air dry for 20 minutes or until there is no liquid (Before the addition of the TE buffer).

(09:00 am) An early start for this half of the team. The overnight culture had grown so the 1st experiment with ''Pseudomonas'' to create the growth curve could be done.

(14:00 pm) The experiment was complete, all the plates happily in the warm room and the lab bench cleaned up. This meant another fairly early finish for the group.

(11:30 am) Not much to do today with most of the group were at Google in London, giving a presentation on the iGEM project.

However that being said, the remainder of the group was just left to count colonies of the previous days' work. There was an explosion of colonies, so the experiment would have to be repeated on Tuesday, allowing the overnight broth to be made on Monday.

(14:00 pm) As well as running the DNA prepared yesterday. This caused a bit of the problem as the gel was such a low percentage it broke very easily, but eventually it was set and it could be run. As it was early afternoon, the group decided to run the gel for 2 hours to make sure it separated properly.

No entry for this date.

No entry for this date.

(09:00 am) As the overnight culture could not be left over the weekend (grows too much - the Psuedomonas produces pigments which alter the absorbance values) the group doing the growth curve experiment spent most of the day doing the final edits and check throughs of the Rockethub video and website.

This process takes a while to check all spelling mistakes as well as editing the grammer ready for it to be published. The final parts of the video, namely the rewards were also stiched in, and the audio was smoothed out to produce a good quality sound from start to finish.

(16:30 pm) The iGEM weekly meeting took place, and the supervisors present looked through the Rockethub site, as well as watching the video before giving the go ahead for it to be published.

(17:30 pm) The overnight culture for tomorrows growth curve experiment was produced, ready to start first thing in the morning.

will and Chris: yesterdays preparations for our mini prep allowed us to get into full swing with lab work. As working to extract the genome from aueroginosa we had to work in a different lab that was certified to handle pathogenic organisms. (9:30) moved all equipment necessary into other lab, set up water baths for the incubation’s at 37 and 65 degrees that will be needed later in the day. spinning down our aueroginosa to get a pellet of cells we re suspended them in p1 buffer before adding the NaCl and lysozyme to lyse the cells. incubated at 37 degrees for 30 minutes the solution should go clear and viscous. solution has gone clear and viscous... success. Addition of 10% SDS and proteinase K to the solution, this will strip the DNA of bound proteins and remove secondary and tertiary structures with in the proteins. incubation for another 30 minutes to allow the reagents to act on the DNA in solution.The addition of preheated CTAB, as a cationic surfactant, acts as a buffer for our DNA extraction and later when running our gel prevents the generation of fuzzy bands. Another incubation period is required for the reagents to react. After this the cholorophorm:isoamylalcohol isolates nucleic acids (RNA and DNA) in a separate layer after they have been centrifuged at 13000 rpm for 10 minutes. The visible barrier between the two layers or interface, separates the nucleic acids in the top layer dissolved in aqueous solution and the lipids and proteins dissolved in phenol and chloroform in the bottom layer. The top layer is the area we want to extract and transfer to another tube. This process is tricky as it is hard but also important to not disturb the inter phase layer and thus we must prevent the top and bottom layers remixing. We removed as much as possible by hand, but being unable to remove all of the top layer it was decided to repeat the chloroform extraction step/remix, re add chloroform:isoamylalcohol and re-centrifuge. After this we removed all the remaining top layer supernatant and proceeded with the next step. The addition of the isopropanol acts as as a way to precipitate the DNA out of solution into a pellet by centrifugation as DNA is insoluble in the isopropanol. The isoproponal can then be removed and air drying the pellet will ensure complete removal of the isopropanol. The re suspension in TE buffer will stabilize the DNA in solution, ready to run our gel. but before our gel is run a nano drop will be performed to ascertain the nucleic acid concentration and absorbance values at 260 and 280 NM plus an absorbance ratio calculated from these values.

(09:00 am) The protocol was changed slightly to compensate for the exubberant growth of the ''Pseudomonas''. The dilutions being used to plate out now go down to 10^-8 rather than -7. So the protocol is as follows:

1. Take a reading of the overnight broth.

2. Inoculate 49.9ml of broth with 0.1ml of the overnight bacteria colony. Mix, start timer, and immediately do 3 and 4.

3. Put 1ml of culture into a spectrophotometer and take a reading at 600nm. Record this as time = 0. Start a timer.

4. At same time, take an aliquot of 100ul and put in eppendorf marked as time 0, 10^-1 dilution. Add 900ul of buffer and mix, then take 100ul from this solution and add to next eppendorf, marked time 0, 10^-2 dilution and so on to 10^-8.

5. Pipette 100ul of dilutions 10^-6 to 10^-8 onto similarly labelled pre-prepared agar plates and spread them.

6. Repeat steps 3-5 every 40min (1 doubling of E. coli) (labelling time appropriately) until the end of time.

7. Leave plates to grow, then count the number of colonies growing on the most concentrated plate where colonies are distinguishable. Multiply up to the true concentration, then multiply by 10. This is colonies/ml.

8. Draw graph to see correlation and check against known correlation to see if it has worked.

(10:00 am) As this growth curve experiment gets through a lot of plates, some more agar had to be melted and plated up, while all the eppendorfs were marked ready to start the experiment.

(11:00 am) Finally ready to start the experiment again.

(15:00 pm) The experiment was completed with good results for the Absorbance values of the ''Pseudomonas'', hopefully it worked this time.

(9:00) will: went to enquire about using the nano drop, asked DR Dalgleish for assistance and instead showed me how to use it, resulting in me now being proficient in use of the nano drop, although a supervisor is required to watch over me using this delicate piece of equipment. Having run the nano drop our results look very promising, our A260/A280 ratios are a little high averaging 2.10, perhaps due to RNA contamination. But the RNA can be removed later by an Rnase treatment if it is very contaminating. A gel will be run to ascertain the amount of RNA contamination. Our absorbency curves were text book examples of what you expect when looking for DNA which was very pleasing.

(10:30) will: the samples were prepared. Each sample was 15 micro litres in size with concentration of 200 ng of DNA in total. With the varying DNA concentrations in each of our 5 preps, ascertained form the nano drop, the amount of sample loaded into each well varied and as a result the distilled water added also varied, this was to ensure that equal volumes over all were added into each well to be run. The samples were loaded by Luke. The size marker we are using is lambda Hind 111 (23kb). Due to the high molecular weight of DNA we aren’t expecting our sample to run down the gel very far. The presence of RNA should appear as a blob at the bottom of the gel, if there is a lot then we now there is very heavy contamination and the RNA can be removed and the gel re run. Alternatively if there is contamination but it is very slight then we can remove the RNA when we perform our DNA digest. If there is no contamination from RNA then our high readings on A260/A280 ratio will have some other explanation.

(13:46) gel finished running, the bands are visible but faint on the photo. There seems to be no contamination from RNA, therefore the next plan of action is to get a higher concentration genome extraction yield, using the following protocol:

CTAB

need to take the DNA which is ~500 micro litres in TE, add equal volume of isopropanol mix thoroughly but gently. spin for 10 min at 13,000 RMP / as hard as possible, hopefully there will be a pellet of something. pipette of supernatant not disturbing the pellet. Re-spin to get as much of the isopropanol off, then air dry. then resuspend in 100TE to the first tube to dissolve the pellet. when this has dissolved, take this and add it to the next tube, each time making sure the pellet has dissolved, mix, tap, but don't pipette, need to get the pellet into solution before you go into the next tube. carry on through the 5 tubes, until you have all of the pellets resuspended in the same volume of liquid.

spec on the nano drop to check the concentration. blank = TE then run on gel .

(15:20) Scraped a colony from C.S.E 01#502 onto a slide and examined it under a microscope and as it surrounded polystyrene beads it was intriguing. Strategised plan is too plate out onto 2x luria agar and 2xminimal media plates 2x 5% sprinkled poly plates. The plates will be inoculated and one 5% sprinkled poly, one minimal media and one luria agar placed in the 37 degree room. And the other three inoculated plates left at room temperature. We will see in the morning which has grown better.

(16:40) Chris had made a new 1% agarose gel, using the award winning GENIE vid available at [http://www.youtube.com/watch?v=wXiiTW3pflM] . Once this had set, it was then loaded into the gel tank and filled with 0.5X TBE buffer solution. We were getting low on this solution so diluted some 10X TBE into 2litres of 0.5X TBE and one litre of 1X TBE. The samples were then prepared with 3 micro litres of 5% loading die, and pipetted by Chris into the gel which is currently running. the lane organization was

x

15 micro litre marker

x

5 micro litre 1kb DNA ladder from ThermoFisher Scientific

x

15 micro litre Sample DNA

x

5 micro litre 1kb DNA ladder from ThermoFisher Scientific

x

15 micro litre marker

x

x

x

x

(17:23)

Starting to plate out the 01#502 onto the three different types of media to be placed in the two different conditions. Fingers crossed tomorrow we have our 'positive' growing well to then use this. As well as that, we are going to photograph the 01#502 plate to see if we can get a detailed photo from the microscope. Chris has taken one with his phone at the moment which is ok, however i think we can get much better resolution with a actual microscope camera.

(10:00 am) After a successful previous day of experiment the group running the growth curve experiment arrived to check for colonies on the plates, and it was clear there was error. Most of the 10^-7 had more cells than -6 as well as massive spreading problems that continued to make an uneven spread. This formed massive groups of colonies, that are unable to be counted easily.

(11:00 am) After discussion in the lab and with our supervisor the group headed down to the supervisors lab to retrieve a plate spinner that would give much better coverage with spreading.

(11:30 am) Another set of plates needed to be made, as well as more eppendorfs required to make the dilutions.

(14:00 pm) After everything was ready, and a quick bite for lunch the experiment was reran with the plate spinner, finishing just at 6. The protocol was slightly altered again for this experiment, as follows:

1. Take a reading of the overnight broth.

2. Inoculate 49.9ml of broth with 0.1ml of the overnight bacteria colony. Mix, start timer, and immediately do 3 and 4.

3. Put 1ml of culture into a spectrophotometer and take a reading at 600nm. Record this as time = 0. Start a timer.

4. At same time, take an aliquot of 100ul and put in eppendorf marked as time 0, 10^-1 dilution. Add 900ul of buffer and mix, then take 100ul from this solution and add to next eppendorf, marked time 0, 10^-2 dilution and so on to 10^-8.

5. Create a further dilution for the 10^-6 to 10^-8 of 100uL into 200uL of luria broth.

6. Pipette the 300ul of dilutions 10^-6 to 10^-8 onto similarly labelled pre-prepared agar plates and spread them.

7. Repeat steps 3-5 every 40min (1 doubling of E. coli) (labelling time appropriately) until the end of time.

8. Leave plates to grow, then count the number of colonies growing on the most concentrated plate where colonies are distinguishable. Multiply up to the true concentration, then multiply by 10. This is colonies/ml.

9. Draw graph to see correlation and check against known correlation to see if it has worked.

Need to do a CTAB for ''p.Aeruginosa''

(9:07) Chris has put the gel is back in the tank after being in the cold room wrapped all night and is running it at 100 volts. Will is currently preparing for the next CTAB extraction by getting the reagents ready. Phil is currently looking over the CFU counts from yesterday which there seems to be a problem with... ( very few colonies), wondering if this is a problem with the technique, or in the calculation of the doubling time, either way, it isn' working correctly so need to try and trouble shoot. Will is now melting agar for making new plates for another CFU of ''p.Aeruginosa'' and is going to do a sectro reading for the overnight culture of ''p. aeruginosa''making sure we get a significant reading ( between 0.05 and 0.3 ) and then scaling up to the OD600 for 1ml of culture.

(9.40) spectro reading came in after scaling up at 5.7 which is quite high, however we won't know how many cells we have until we can get the CFU to work however it is many more cells than before, so fingers crossed we can get some chromosomal DNA out this time. Luke is currently looking at the enzyme modification ***** INSERT TEXT HERE LUKE****

Yesterday's experiment failed, the Pseudomonas decided not to grow at all this time apart from the 240 mins -6, and -7 plates. Now running a plate test to see if the failed yesterday experiment was down to faulty agar or just the cells where diluted out as the optical density wasn't that high.

(10:50) The ''P.Aeruginosa'' cells now span down and the supernatant has been removed, re span, and all liquid taken off. These were then resuspended in 250 micro litre of P1 by Will, and the 15 micro litre 5M NaCl and 20 micro litre 10mg/ml lysozyme added. There were a large number of cells of a redish appearance when we first centrifuged. The stage we are at now is the 37 degree incubation to lyse the cells. After this stage we can decontaminate the sides of the ependorphs and bring them back into our lab. However, as the next stage is also 37 degee for 30 minutes, we may leave them in the class 2 lab until after this stage. Gel has finished running and Chris has Transaluminated it to get the photograph, (using the one downstairs ) image to follow. bands are more spread out now, have wrapped the gel back up in cling film and placed it in the 5 degree room in case we need it again later.

(14:10) CTAB experiment isn;t going to plan, Think we have got far to many cells. chris removed the very viscous supernatant into fresh tubes and then the cells that were left in the other tube were resuspended in double quantities of the step 1 CTAB protocol reagents ( 500 micro litre P1 buffer, 30 micro litre 5M NaCl 40 micro litre lysosome) We then realised that luke put in the 40 micro litre of lysosome, however our conc was 100mg/ml rather than 10mg/ml so this was a 10 fold excess... knowing this it is probably the case that the lysosome is denatured so we are now using fresh in the new CTAB prep will is doing the supernatant was also diluted so all 12 tubes are the same conc. Luke has put in fresh lysosome to the 12 tubes to hope this helps with the prep

From yesterday's positive find on the 01#502 CSE kit on the microscope we plated it out on the minimal media and LA in 37 degrees and room temp. The bacteria on the LA has grown well with quite a few single colonies ( photo to follow)the colonies from the 37 degree room are more round, with the room temp more spread out on the plate in streaks however looks to have grown maybe better at room temp? so might be an idea to have three different temperatures. the minimal media plates don't seem to have growth but we now have bacteria to work with.

PROTOCOL FOR TESTING THE 01#502 POSITIVE BACTERIA

take a single colony of the bacteria from the LA plate, grown in the 37 degree room as these are more single colonies. Streak it out onto another plate of LA so we have a fresh colony.

this single colony will then be used tomorrow to repeat the experiment with a definite single colony.

From the 37 degree LA plate, take a single colony and streak it onto each of these plates in triplicate for the three different temperatures: Luria Agar, Minimal Media (made from the paper's instruction, see earlier in the WIKI ), Minimal Media with 5% sprinkled Polystyrene.

To make the 5% poly Minimal Media: measure out 0.50 grams of the raw polystyrene sugar on a 2DP balance. Place a Petri dish onto the balance ( after removing the polystyrene) and Zero the balance. With this then poor 9.5 grams of 60 degrees Celsius Minimal Media which should be kept in a Hybridisor at 60 degrees prior to pouring. As soon as the media has been poured sprinkle the polystyrene sugar evenly over the surface of the dish to try and ensure a even distribution, this will then sink to just below the surface. Note, when streaking be careful not to gouge the surface as the beads are very close if not at the surface.

one of each of these plates, ( one LA, one MM, one MMPoly) then needs to be placed into the 37 degree warm room, 5 degree cold room and the remaining 3 placed in the lab at room temperature overnight.

(17:30) by this time, Luke and Will were almost at the isopropanol stage of the CTAB extractions, which ended up in us being a little late out of the lab. Chris helped out by doing some of the somewhat tricky removal of the supernatant at the Chloroform stage, as well as pouring 6 Minimal Media plates ready to plate out the 01#502 today to grow over the long weekend in different conditions. As well as that Chris prepared a new gel ready for morning, which Will poured while Chris was removing supernatant. Phil poured 20 new LA plates ready for today doing CFU counts on p.aeruginosa so we can find out the amount of cells for our OD600 readings, as well as making a new 10ml overnight p.aeruginosa. Dr Badge then prepared two plates of the 01#502 CSE Kit, streaking onto LA placing them one in 37 degree one at the bench so we had a fresh definitely single colony plate of cells. Had a problem with the minimal media agarose as it was a bit hot when Chris put the agarose in so took a while to get this into the solution

Luke has been working on modelling mutagenesis of toluene 2,3-dioxygenase for a couple of weeks now. He's identified 4 base mutations that would theoretically allow polystyrene to fit into the enzyme's active site, one of which is found as a natural amino acid variation in other similar mono/dioxygenases. He's been in contact with Professor Emma Raven, an dioxygenase expert and will hopefully hear back about whether the mutations are likely to work. His results should be put in the modelling section shortly..

(09:00 am) The group running the growth curve experiment was now down to 1 member as the others had headed off home to see parents etc. The last member came into the lab expecting to find good results with the new spreading technique. However there was another problem. This time nothing grew apart from 2 of the plates at 240 minutes, and these still only had double figures of colonies.

(10:30 am) After a long meeting with a supervisor, it was decided to run an experiment to see if the agar plates were broken somehow or if the broth was just too diluted. This is done by making a new plate, and taking one of the used plates and streaking 500uL of the overnight culture onto them. This would grow enough by the end of the day to prove which circumstance had happened.

(11:00 am) The tedious task of remaking all the plates and labelling the eppendorgs was undertaken again so the experiment could be rerun.

(14:00 pm) In the afternoon there was no tasks to be done so the group went to the computer lab and worked on the wiki, and looked at a couple of research papers to pass the time.

(17:30 pm) The plates had both grown indicating that the broth was just too dilute. This meant the experiment could be reran tomorrow making sure that it wasn't too dilute. This was done by realtering the protocol to make the lowest dilution at 10^=7 again:

1. Take a reading of the overnight broth.

2. Inoculate 49.9ml of broth with 0.1ml of the overnight bacteria colony. Mix, start timer, and immediately do 3 and 4.

3. Put 1ml of culture into a spectrophotometer and take a reading at 600nm. Record this as time = 0. Start a timer.

4. At same time, take an aliquot of 100ul and put in eppendorf marked as time 0, 10^-1 dilution. Add 900ul of buffer and mix, then take 100ul from this solution and add to next eppendorf, marked time 0, 10^-2 dilution and so on to 10^-7.

5. Create a further dilution for the 10^-5 to 10^-7 of 100uL into 200uL of luria broth.

6. Pipette the 300ul of dilutions 10^-5 to 10^-7 onto similarly labelled pre-prepared agar plates and spread them.

7. Repeat steps 3-5 every 40min (1 doubling of E. coli) (labelling time appropriately) until the end of time.

8. Leave plates to grow, then count the number of colonies growing on the most concentrated plate where colonies are distinguishable. Multiply up to the true concentration, then multiply by 10. This is colonies/ml.

9. Draw graph to see correlation and check against known correlation to see if it has worked.

Still no gas.... Been about 2 weeks now... ceiling is holding out this week however!

(8:30) came in early as it was a late finish yesterday and today is a Friday... meaning there is a lot to do today ready for the Bank holiday weekend... More so with there only being 4 members in the lab... We've just put all the isopropanol-supernatent mix from the DNA extractions from yesterday into a centrifuge ( 13,000G for 10 minutes) to spin down the precipitated DNA ready to air dry. After the air drying and resuspending in TE we want to run our slow gel asap so Dr Badge is going to put them in the Vacuum dryer to speed things up. tubes are now out of the centrifuge, and Luke is taking of the supernatant.

(9:00) will to prep 10 tubes of 1ml culture of p.aeruginosa, 4 for the robot ( :D ) 6 for the CTAB for the 4 robot ones ( DNA Extraction Robot), use 250 micro litre of TE buffer for the resuspension rather than the P1 buffer, add lysosyme 2 micro litres of 100mg/ml leave out the 5M NaCl salts and give 30 min at 37 degrees. Robot takes about 40 minutes, so will run this on the Fast Gel at about 11:00.. will is also doing 6 tubes of CTAB extraction again today to see if a lower OD600 culture will work better. Today's culture is Od600 2.48 scaled up from a 10X dilution.

(9:34) Luke is spinning the tubes again to remove the rest of the supernatant, Will is preparing the cultures and Chris is writing this... Now Chris is going to prepare a new electrophoresis gel for the fast gel in the longer gel tray ready to run at 11:00am ( Long, fast, hard run) hopefully with the robot DNA as well as the CTAB's from yesterday. the slow gel will be ran earlier and for longer using the shorter Gel prepared yesterday ( need to check on which length gel to use for which... ) <\p>

(10:20) Chris has made the agarose gel for electrophoresis according to the GENIE video, which is now in the hybridiser cooling down to 60 degrees. Gel tray has been prepped. Luke has put the DNA (hopefully) extracted yesterday using a vac line to dry, and Will is getting on with extracting DNA using the CTAB method in the other lab. as its now 10:20 doubt the short, soft and slow gel will be running by 11:00 as the DNA resuspention takes about a hour..

(11:00) Chris has now poured the gel and it is in the 5 degree room setting. Luke has resuspended the DNA in 100 micro litre of TE buffer and the tubes are now in the 55 degree hot block to resuspend for a hour- two hours. ( from QIAGEN protocol) this then pushes the slow gel back to 12:00.. however it means they still get about 5.5 hours. However the robot is running and now only has 44 minutes left so we should be able to get the robot DNA on the Fast long gel as well as the slow short get. Still no sign of Phil.. will is now adding in the RNase ( step we have added to the CTAB protocol at the same time as the protease K)the SDS has also been put in and now he is at the next 37 degree for 30 min stage. <\p>

(13:15) Unfortunately when will poured the gel last night there were a lot of bubbles... so we have had to re melt the gel ( which luke did) the gel has been re poured and set. Chris has prepared the samples and is now loading up the gel for the fast electrophoresis after we used a nanodrop spectrometer to find out the conc of DNA in our tubes from extraction yesterday: Wills extraction had a DNA conc (in nanograms/microlitre) of 65.2 and a 260nm/260nm ratio of 1.46. The extraction Luke messed up had no DNA in it, and the one he didn't mess up clocked in at an impressive conc of 1755.2 (which could easily just be down to RNA still present or other things) and a ratio of 1.94.

Loading order of fast gel - started at 13:20 at 100 Volts

x,x,Marker,6,5,6a,marker,pa1,pa2,pa3,pa4,x,x,x volumes of DNA in all but 6a were 12 micro litres, 6a was 1 micro litre after the high nanodrop reading. Chris spotted each well with a small volume of loading die to make each of the wells more visible.

(13:30) Luke is now loading the slow Gel, as it is a bit late, we will run at 80 volts for 4 hours... Just recieved a call from Mick about Monday, we now have a table at the event at the alotments, need to arrive between 9-10. Will is having problems removing the chlorophorm top bit from his CTAB prep, so is going to add in 250 micro litres to dilute what DNA is left, after centrifuging for 2 min, vortex gently, centrafuge for 10 minutes, and try take it off again.

Loading order for slow gel - started 13:40 at 80 volts

x,x,Marker,6,5,6a,Marker,x,pa1,pa2,pa3,pa4,x,x volumes of DNA in all but 6a were 12 micro litres, 6a was 1 micro litre after the high nanodrop reading. Luke also spotted each well with a small volume of loading die to make each of the wells more visible.

Time for some lunch for Chris and Luke, while Will is doing his next stage. <\p>

(17:00) Just finished our gel electrophoresis- our DNA extraction has worked this time, using both the CTAG method from yesterday, and Promega Maxwell DNA extractor machine thingy, so we're feeling relieved

need to boil the PBS as it is cloudy which is bad and cool it to room temp. after this we need to dispurse a single colony into a volume of PBS so to make sure we are putting equal amount of cells onto each plate. using 9 plates. 3 of each media, 3 of each temp. Repeating with TE just in case the PBS is contaminated badly...

(12:30 pm) After agreeing to come in later so the last member could go into town, the growth curve experiment was ready to be reran again.

(13:00 pm) A prompt start at 1 meant the experiment would be finished at 5. With only packing up and clearing the lab space to go.

(17:30 pm) The experiment was finished, and hopefully this was the last time it was needed to be ran for ''Pseudomonas''. As next Monday is a bank holiday the team is not allowed in labs as no supervisors will be working. This meant there is a 3 day gap inbetween plating the bacteria and looking at the results. To slow the growth then and not just have an explosion on the plates, it was decided to leave them in room temperature over the weekend rather than take them to the warm room.

No entry for this date.

No entry for this date.

Bank holiday in the UK, so the university was closed and no supervisors were in labs. The remainder of the team (from both sides of the experiment) attended an event in the Aylstone Leisure Centre in Leicester to publicise the project and teach people a little more about polystyrene.

Have taken photos of the CSE 502 replate, and now have colonies growing well on LA, and nothing on mm still, currently we also have no colonies growing on the MMP plates, however this was expected as they are meant to grow really slow on poly. Chris has now done a Gram stain test on the 01#502 which is inconclusive at the moment as we think there were to many cells as it has turned black. (WP00694) This morning, Will made a 0.7% agarose electrophoresis gel which luke then loaded as follows. started the run at 10:50 at 40volts x h3 6 5 6a x x h3 pa1 pa2 pa3 pa4 x x gel has been ran, and looks good! (photo to follow) Chris has prepared some cultures of 01#502 ready for tomorrow, as we need to culture them on antibiotic plates, as well as start a CTAB and 16s to find out what the bacteria is... fingers crossed we get some growth on the mmp plates soon as well. change the conc of enzyme rather than the time, need a ZERO control ( Sal3A1 digest tomorrow) images to follow.

(09:00 am) The surviving member arrived fresh and early after the day advertising iGEM to the local community. The morning was started by going to see the ''Pseudomonas'' plates made on Friday, Friday, Friday oooh, and the plates look great!

(09:45 am) The plates had been counted, the data collected and tabulated. Then taken to the computer room to provide a graph with excel so the growth curve can be made easily. The result of this showed a good curve that can now be used for all future ''Pseudomonas'' experiments.

(11:00 am) With nothing particularly left to do, the rest of the day was filled with administration tasks. This included sorting out the finance spreadsheet, working on the wiki, as well as planning the next few days work with the 01#502 positive bacteria.

(9:00 ) Chris re did the Gram stain, resulting in the same results as yesterday.. to be conclusive still need to do oil immersion. however the 40x looked exactly the same however the bacteria were more spread out. Luke is modeling with the toluene-2,3-dioxygenase enzyme.

(10:00) Chris is working out what we need to do next with the supervisors and has put the gel from yesterday into the tank to run for a bit longer at 40 volts.

(11:30) Chris made overnight cultures of the 01#502 of the single cell. however we need to do a multi cell plate and culture. Phil is making more MM broth while Will was organising for the PCR and antibiotic test plates.

( 14:50) Chris stopped the Gel and took a photo, the bands had moved more so, resulting in now the H3 markers being much more separated. From this however we have learnt that we should heat the H3 markers first as Lambda markers have tails on them which anneal if they are left and not heated before using. then 3rd lane in which was a CTAB 6 prep seemed t run very strangely, with very high molecular weight DNA in comparison to the other lanes

(16:40) Luke started the Sau3A1 prep while will was making the Gel for the electrophoresis we are wanting to run over night at 20 volts. Chris is streaking the 01#502 onto LA to keep the culture fresh as well as making a few different multi cell plates. Chris also made three

overnight cultures of the bright (now) orange culture, which are now in the shaker to grow at room temp.

(17:45) Sau3A1 prep is now finished, and will is putting it into the gel tank. Chris has now done the oil immersion of the second gram stain and it is definitely gram positive ( photo to follow)

Sau3A1 prep. one unit will digest 1 microgram of DNA in one hour at 37 degrees in 50 micro litres. going to use 14.24 micro litres of our DNA for one micro gram. worked out from 70ng/ul add in EDTA to chilate the Mg+ io, and or chill the reaction suddently from 37 to iced water. Take a alequat out into EDTA and 10 micro litre aliquot, 700 Ng, will use 100 micro litres of the robot prep one Micro litre of EDTA 3micro litre Loading dye 6 micro litres of TE .5M EDTA 10mM MgCl in 1x buffer

(16:00) take 107.4 micro litre of the DNA from the Robot prep mixed with 15 micro litre of the NE buffer1, 1.5 micro litre of BSA, 2 micro litre (8 units) of Sau3A1 made up to a total volume of 150 micro litre with distilled water. This is the reaction mix with it being active as soon as the Sau3A1 has been added so this must be at the end of the reaction. the reaction conditions are 37 degrees, taking out a 10 microlitre aliquot every 5 minutes for a hour to create a time course for the enzyme. Each of the aliquots is made up to 20 micro litre by adding in 1 micro litre of EDTA 0.5M 3 micro litre of Loading dye and 6 micro litre of TE . keep everything on ice until Sau3A1 is added, pippet up and down a few times, then take the time 0 recording

1/5 dilution of the Robot DNA Nano Drop reading was 14.9ng/ml so at 1x it would be 74.5ng/ml

(9:00) The Gel was stopped at 8am then at 9, Luke and will exposed the gel (photo to follow) as we thought it was a bit long doing it over night we ran it at 10volts, however the DNA didn't migrate very far, Because of this chris put the gel back into the tank and ran it at 40 volts for 5 hours. with a much better image. Will has OD600 the overnight culture, reading at 0.807 at a x10 dilution as we have a VERY dense culture...

(9:30)Chris, Emily and Luke took photos of the plates that were growing from the 01#502 as well as some other plates.

(10:00) after much deliberation, we decided to run the PCR over night tonight rather than tomorrow so that we can do the CTAB sooner as we will then know what the bacteria is.

(12:00) preparing for the PCR, Dr Badge made up some dNPT's for us to use in the reaction, while Chris was working out the amounts to put in each of the PRC eppendorph and was learning how to do the PCR and use the PCR hood. This took a fair amount of time making it a late lunch.

(14:20) Chris stopped the Gel and exposed it luckily in just in time as the bands were very close to the end of the gel. (image to follow ) from this we have realised we need to re-run the experiment as the 10minute lane didn't have any DNA and the 5 minute lane was very digested. therefore luke is re-running the experiment with only 4 units of Sau3A1 and more EDTA incase it was the stopping procedure that didn't work, as from 30-60 the DNA was almost all digested.

(16:00) Luke is preparing for the Sau3A1 digest, Will is now doing the Boilate, and serial dilutions of the 01#502 protocol. take 1000Ul of PBS in a screw cap eppendorph with enough bacteria to make the solution cloudy, making sure to keep the bacteria and tubes next to the flame. Before this step, we boiled the tubes for 2 minutes to make sure that the outside was sterile. Boil the tubes for 10 minutes, then centrifuge for 5 minutes at 13,000G. The supernatant now has DNA in it ready for the serial dilutions.

For the PCR we are to dilute the bacterial DNA down so we have less in each as we don't know the amount in ng exactly of DNA or the amount of cells precisely. This means that we need to do serial dilutions from not diluted to x10^-4 a 10,000 x dilution. Protocol. Take 100ul of the supernatant into another eppendorph and dilute with 900ul of PBS, repeating this step 4 times to get a series of x10 dilutions down to x10^-4

(16:40) Chris is now re-doing the biolate as will made a error and is now preparing the gel for running the Sau3A1. as always its getting close to the end of the day and there is lots to do still

(17:30) Dr Badge made up the master mix for the PCR experiment in the PCR hood containing:

114ul PCR clean H2O

40ul HF buffer

4ul dNTPs

10ul Primer A 28f AAGAGTTTGATCCTGGCTCAGA

10ul Primer B 519R GWATTACCGCGGCKGCTG

Template DNA to be added after as it is not PCR clean

2ul DNA Pol

these reagents were added then as the DNA Pol was in glycerol the tube was mixed and span for a second to remove bubbles. dNTPs cannot be freeze thawed so whatever was left was thrown. After this, in the hood Chris took 18ul aliquots of the master mix into 9 separate PCR eppendorphs and prepared the -ve control while in the PCR hood with the PCr clean H2O. The tubes were then taken to the bench where the DNA and diluted bacteria were added, and the +ve and -ve controls ( see gel lane organization) all samples were added at 2ul to make a final volume of 20ul. While Chris was doing this Dr Badge programmed the PCR block, named iGEM16S as follows:

98 degrees C - 5 min

''98 degrees C - 30 seconds''

''50 degrees C - 30 seconds''

''72 degrees C - 2 minutes''

72 degrees C - 5 minutes

15 degrees C - Forever ( this is for the end of the reaction)

At the same time Luke was re running the Sau3A1 digest, using the same protocol as Wednesday the 29th of August

(9:00) Chris Thawed the Sau3A1 Samples, ready to be loaded and put the pre made gel into the gel tank. Nathan has been clearing the iGEM email account, and putting some of the CSE kit data into the Google Map that can be seen on the CSE page of the Blog. Will has been making a 2% gel for the PCR electrophoresis. Phil has been preparing for another CFU of the 01#502 single colony, as there were to many cells to count on the plates from yesterday.

(10:00) Chris has loaded the Sau3A1 gel and set it running at 80Volts for 4 hours with the 1KB gene ruler from Thermofisher Scientific, 2% gel is in the hybridiser cooling down, ( Gels made in accordance to the GENIE How to make a Gel video accessible at ******** ).

(10:30) Will is making up some more TBE buffer for the gel tanks, while Chris is getting ready to load the PCR products onto the gel and Phil is getting ready to run his CFU. Nathan is sending out some emails to people who have bought CSE kits to get them returned to us to be cultured.

(11:16) Started PCR Gel at 120V, lane organization below, Loaded 5ul of loading dye into each sample to make 25ul... however upon trying to take out 25ul using the p200 it was very difficult with less than 25ul being able to be removed each time.. therefore Chris loaded 20ul of each of the samples into the gel, after spotting the wells.

(13:00) PCR gel was stopped at 12:46 and photo taken with the transiluminator after it had ran at 120volts for a hour and a half.

Lane organization

x

1 +ve control 10ng p.aeruginosa DNA from the maxwell prep

2 +ve control 10ng p.aeruginosa DNA from the maxwell prep

marker 100bp Thermo scientific

3 Neat 0 dilution cells

4 x10^-1 dilution

5 x10^-2 dilution

6 x10^-3 dilution

7 x10^-4 dilution

8 -ve control, No DNA PCR clean H2O

9 -ve control, No DNA Distilled bench H2O

Marker 100bp thermo scientific

x

x

The gel has now been put back in the Gel tank and is running for another hour to make the large bands in lanes 4-7 separate more from the bacground, to allow the gel extraction to be easier.

(13:44) Nathan is doing the honourable job of racking tips ready to be autoclaved and is now giving the lab a good tidy. Will is preparing for the gel extraction and emptying the autoclave bags to keep the lab tidy while Chris is righting the Wiki waiting for the gel to finish running.

(14:00) PCR Gel has been finished and transiluminated. (immage to follow) and the bands are now much more separated. Chris and Dr Badge then iluminated the gel in the dark room and cut out the sections of gel where the DNA was at the highest concentration at the 500bp marker points, be that Dr Badge doing the p.Aeruginosa +ve control and Chris, the four diluted cell DNA mixes, making sure not to get to much agarose. After the gel was cut, Chris then weighed the samples to make sure we knew how much was in each eppendorph to know how much QG buffer to add in the gel extraction. At this point Will then has continued to do the gel extraction.

(14:40) Sau3A1 gel has now finished so Chris transiluminated it ( immage to follow) and realised it was running for a bit to long with the smallest fragment of the ladder not being visible, the run was much better than last time however with much large DNA fragments. However after talking to Dr Dalgleish Chris is to run this experiment again at room temp ( 20 degrees) so that the fragments are larger still, making sure this time that there is a non digested DNA sample loaded onto the gel which has been incubated under the same conditions. Nathan has been advertising the Rockethub platform getting the word of our project spread a it wider by the method of social media, hopefully we will get some donations shortly, if you are reading this and would like to visit our rockethub, here is the link! spread the word http://www.rockethub.com/projects/9444-bacteria-taking-on-polystyrene-can-we-do-it .

(16:00) Will is almost at the end of the gel extraction prep, Nathan is looking through the deadline tasks for the competition, and Chris is about to start the preparation for the Sau3A1 prep. this time however we will run at 20 degrees, and for a shorter period of time, be that 30 minutes, taking a sample every 5.

(17:00) After a few calculation problems we decided to leave the Sau3A1 prep to Monday when Luke is back and can help with the procedure. Chris and Dr Badge went to the microscope room and are taking photos of the 01#502 CSE mmp and mm plate to look for signs of growth on the plates. Will is making a new 2% electrophoresis gel for running some of the gel extraction products on to make sure we have extracted DNA ready for sequencing of the 16S next week. Nathan is setting up minimal media broth (NO CARBON) with 5% polystyrene as the carbon source, and is putting the single colony of the 01#502 into one of the tests and some of the multi colony original LA replate into under the same conditions.
protocol
Take two sterile 50ml falcon tubes, at this point lable the tubes with what you are to put into each, as well as the date. weigh out two lots of 0.5 grams of the sugar poly on the 2d.p balance and place one lot of poly into each falcon tube.
Take the minimal media broth (NO CARBON) from the hybridiser, and make sure that the salts are still in solution. If they are not, mix on the magnetic shaker with heat to get the salts back into the solution, making sure that it is
uniform before using the solution.
Once the solution is ready ( Should be colourless with no floating particles) you can then take 9.5ml of solution and add this to each of the falcon tubes.
you can now add your bacteria using a sterile loop next to a flame current, or in a red flow hood. For the single colony make sure you take a isolated colony without disturbing any of the others on the plate and put it into the broth making sure to mix thoroughly so that the bacteria are suspended in the broth. For the multi colony take a sample from a rich area on the plate with a sterile loop, making sure you get the same quantity of bacteria however of the potentially different species that are on the plate, suspending the cells in the other falcon tube in the same way.
once you have the bacteria suspended in the two falcon tubes, seal the lid with some tape to make sure it doesn't come loose on the shaker and place the tubes in the shaker to grow. start the shaker and note the time.

(17:45) Chris and Dr Badge saw some what look like bacteria colonies on the poly plate left at room temp on the 01#502 be them very small but they were there. (image to follow) the (potentially) bacteria on the plate seem to be at higher concentrations around the polystyrene beads which is hopefully great news! to rule out it being a flow problem with the PBS or H2O or a evaporation problem leaving behind crystals Will set up a 5% poly plate under the same conditions as the 01#502 to be left until after the weekend to look at these to see what the marks on the plate are like from just this and no bacteria to compare. The stroke of genius from Luke of doing split plates for all with a gap in the middle for the 01#502 conditions test was very useful when taking the photos as it showed no bacteria in the center of the plate meaning that the colonies were from the PBS or H2O 01#502 mixtures rather than contaminates with the PBS / H2O no bacteria test ruling out contamination from those.