We have submitted three T7Lac promoter parts to the registry. The followings show the sequences of these constructs.
( BBa_K613007 ) Wildtype: TAATACGACTCACTATAGGGAGAGGAATTGTGAGCGGATAACAA
( BBa_K921000 ) Mutant I: TAATGCGACTCACTATAGGACAATTGTGGGCGGACAACAATTCCAA
( BBa_K921001 ) Mutant II: TAATACGACTCACTACAGGGCGGAATTGTGAGCGGATAACAATTCCAA
( BBa_K921002 ) Mutant III: CAATCCGACTCACTAAAGAGAGAATTGTGAGCGGATAACAATTCCAA

Characteristics of our hybrid T7Lac promoters

Predicted Strength

Expected promoter strength of the mutants (relative to BBa_K613007):
Mutant I: <100%
Mutant II: ~100%
Mutant III: ~50%

Expected LacI leaky expression of different mutants:
Mutant I: More than average
Mutant II: Average
Mutant III: Average

Promoters were rationally designed to have the previously described characteristics according to the reported findings by Ikeda et al.^[1], Sadler et al.^[2], Gilbert et al.^[3]. Mutant 1 has mutations in the recognition site and the initiation site that have been previously shown to decrease initiation frequency. Mutant II was designed to have a melting box mutation, which prevents the DNA from melting, to start transcription. The overall effect of this mutation was not known but the hypothesis was that transcription strength would be exceed the wild type. Mutant III contains mutations described by Ikeda et al, which are associated with class II promoters. The mutations that are associated with this class of T7 promoters affect how well the polymerase clears the promoter sequence. This mutant is expected to produce much less protein than the wild type.

The lac operators in these promoters were rationally designed as well, according to the finding of Sadler et al and Gilbert et al. The promoters were designed to have a nearly palindromic sequence as described by Sadler et al to increase lacI repressor affinity. Mutant I includes mutations that have been shown to favor lacI repressor binding. Mutants II and III contain mutations in the lac operator but are not expected to have increased performance in vivo.

Click here to see our results discussion.

Measured Strength

We have measured both RNA and protein expression levels of the designed T7Lac promoters using fluorogen-activated biosensors (see details in Methods & Results ). These experimental results were analyzed using a mathematical model that we developed in MATLAB (see details in Model ). Based on the analysis, we obtained the following properties of the new T7Lac promoters with respect to the wild-type T7Lac promoter.

Table 1: Table 1: Relative transcription and translation rate constants of three T7Lac promoters as compared to the wildtype T7Lac promoter

Promoter	Mutant I	Mutant II	Mutant III
Transcription Strength	97%	72%	127%
Translational Efficiency	169%	90%	160%
RNA degradation constant	.01204	.01204	.01204
Protein degradation constant	1.61	1.61	1.61

Discussion

BBa_K921000

The design of Mutant I (BBa_K921000) was based on random mutations throughout the promoter region including the recognition site, initiation site, and the lac operator. This promoter was expected to have a lower affinity to the T7 RNAP and therefore have a lower RNA and protein expression rates. The mutant I (BBa_K921000) promoter produces less RNA, but more protein than the wild type promoter (Bba_K613007). We hypothesize that the difference between prediction and experimental results is due to cellular adaptation to metabolic burden.


BBa_K921001
The design of this mutant T7Lac promoter (BBa_K921001) was based on random mutations throughout the promoter including the recognition site, melting box, initiation site, and the lac operator. This promoter was expected to exhibit a significantly lower initiation frequency due to the T->C mutation in the melting box. RNA polymerase denatures DNA at the melting box to initiate transcription. The melting box TATA can be found in all T7 promoters. Thymine and adenine have lower melting temperatures and are easily melted. Guanine and cytosine form an extra hydrogen bond and cause base stacking, which increases their melting temperature, making it more difficult for RNAP to initiate transcription. This mutation was rationally made to decrease an initiation frequency, resulting in a weaker T7Lac promoter. Indeed, mutant II (BBa_K921001) of this set of T7Lac promoters produces less protein than the wildtype T7Lac promoter (BBa_K613007).


BBa_K921002
The design of this mutant T7Lac promoter (BBa_K921002) was based on a different class of T7 promoters, which are weaker than the wildtype T7Lac promoter (BBa_K613007). Therefore, this promoter was expected to produce less protein than the wildtype promoter. However, this mutant promoter produces more RNA and protein than the wildtype promoter in our experiments.

---

Citations:

Ikeda RA. The efficiency of promoter clearance distinguishes T7 class II and class III promoters. J Biol Chem. 1992 Jun 5;267(16):11322-8.

Gilbert, Walter, and Allan Maxam. "Result Filters." National Center for Biotechnology Information. U.S. National Library of Medicine, n.d. Web. 03 Oct. 2012. .

Sadler, J. R. "A Perfectly Symmetric Lac Operator Binds the Lac Repressor Very Tightly." Proceedings of the National Academy of Sciences 80.22 (1983): 6785-789. Print.