Team:Trieste/parts
From 2012.igem.org
Revision as of 01:37, 27 September 2012 by Drikicmarija (Talk | contribs)
Parts Overview
More
List of the Submitted Parts
Click on the code of each part to have more information about the Biobrick, its construction, the results obtained and the relative link to the Registry.
Name | Type | Description | ||
BBa_K875001 | Regulatory | T5 Cumate Operator | ||
BBa_K875002 | Regulatory | T5 Lac Operator | ||
BBa_K875003 | Composit | CymR | ||
BBa_K875004 | Composit | T5LacO-LPP-OmpA-scFv | ||
BBa_K875005 | Composit | T5LacO-LPP-OmpA-SIP | ||
BBa_K875006 | Composit | T5LacO-LPP-PelB-scFv | ||
BBa_K875007 | Composit | T5 LacO-LPP-PelB-SIP | ||
BBa_K875008 | Coding | IPTG inducible Tse2 toxin | ||
BBa_K875009 | Coding | LL 37 - Cathelicidin | ||
BBa_K875020 | Composit | β-Glucosidase |
Primers
Name | Seq 5'--> 3' | PCR Notes |
---|---|---|
Vr | ATTACCGCCTTTGAGTGAGC | 95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞ |
Vf2 | TGCCACCTGACGTCTAAGAA | 95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞ |
GlmSTn7Fw | GCATGTGGAAGAGGTGATTG | 95° 5' | 30x (93° 30'' | 53.8° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
GlmSTn7Rev | ACTTTATTGTTCGCCCACA | 95° 5' | 30x (93° 30'' | 53.8° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
B0015XhoRev | ACTCGAGATTACTAGTTATAAACGCAGAAAGGCCCACCC | 95° 5' | 30x (93° 30'' | 58° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
B0015EcoFw | CGAATTCATCAGATCTCCAGGCATCAAATAAAACGAAAGG | 95° 5' | 30x (93° 30'' |58° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
T5EcoFw | CGAATTCATGAGATCTAAATCATAAAAAATTTATTTGCT | 95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
T5XhoRev | TCTCGAGTTAGGATCCTTTCTCCTCTTTCTCTAGTAATA | 95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |