Team:WHU-China/Project

From 2012.igem.org

Revision as of 07:13, 25 September 2012 by Shinkwee (Talk | contribs)

  •

                Project Description

                The utmost purpose of our project is to emancipate people from obesity. It can be achieved by genetically modifying a resident intestinal microbe, such as E.coli, to create a novel beneficial bacterial which is competent to eliminate the excessive absorption of calorie.

                Fatty acids are our primary targets. To prevent the over in-take and accumulation of fatty acids, we will try to engineer microbes that can metabolize the excessive fatty acids in diet efficiently and effectively before they are absorbed by the host. To achieve this, we will overexpress the enzymes responsible for fatty acids degradation under the control of a natural sensor for concentration of fatty acids-- FadR, a repressor for the genes involved in fatty acids degradation. A constitutive promoter will be fused to the original binding site of FadR. If such a promoter is placed upstream of the target genes, they can only express when the FadR senses the high concentration of fatty acids and slides off the site on DNA. The gene expression will solely respond to concentration of fatty acids.

                Also, since the glucose can be transformed into fatty acids in our body, we will try to transform the glucose into polymers, such as cellulose, which cannot further be degraded and absorbed by the host. Instead of contributing to the formation of fatty acids, the glucose is turned into a healthier substance. The polymers made from the glucose may facilitate the growth of other intestinal microbes which have been proved to be beneficial for maintaining a normal weight. Enzymes responsible for cellulose synthesis are accessible from other species of bacteria and can be implanted into E.coli. To sense the glucose concentration and respond exclusively to it, we choose CRP as a regulator. Specifically, we will change this activator into a repressor by overlapping its binding site downstream the constitutive promoter instead of in front of it. Then the relative gene can only be activated when the CRP cannot bind the site on DNA at high glucose concentration. This synthetic promoter may have broad applications. For example, it can be used in gene therapy for diabetes.

                Another problem we will try to tackle is the survival and the colonization of the bacteria in intestine. One commonly accepted theory is that a species introduced to a new enviornment gets the chance of surviving and even being dominant if it can utilize an energy resource that cannot be used by any other species. According to the theory, the unmatchable ability of the E.coli to utilize the fatty acids as its carbon sources can already partially fulfill the goal. The adhesion to intestinal cells is another factor for its survival other than the energy requirement. We will try to increase the adhesion ability of the E.coli by enhancing its production of c-di-GMP, a second massager which has been reported to increase adhesion of bacteria.

                Biological safety should be paid equal attention in the progress of designing novel probiotic. To prevent the uncontrolled reproduction of the modified E.coli in the intestine, we have designed a death system to wipe out the GMOs at will. It is designed to exploit the natural sensor for the signal molecule xylose to regulate its target, the endonuclease responsible for killing the cell quietly without setting off any immunological reaction. Also, Horizontal gene transfer will also trigger the death of the recipient.

                To sum up, we not only propose a novel and interesting way to tackle the obese problems but also create the biological sensors for fatty acids and glucose which have broad applications in detection and therapy of related diseases.

                Background

                Obesity: a serve global problem

                Obesity refers to a health condition that body fat is accumulated to some extent. According to WHO, body mass index (BMI) is an index of weight-for-height that is commonly used to classify obesity in adults. It is a risk factor for various diseases, such as cardiovascular diseases (mainly heart disease and stroke), type 2 diabetes, musculoskeletal disorders (especially osteoarthritis), some cancers (endometrial, breast, and colon).



                As it is shown in figure 1 and 2, a large amount of people from all over the world are overweight in both developed countries and developing contries and it is and will become more and more serve.



                Figure 1(from reference [4]): Past and projected prevalence of overweight (BMI ≥25 kg/m²)

                Figure 2: Prevalence of obesity in different countries.
                (Picture from The Wellington Grey blog)

                The Cause of Obesity

                Obesity is most commonly caused by a combination of excessive food energy intake, lack of physical activity, and genetic susceptibility, although a few cases are caused primarily by genes, endocrine disorders, medications or psychiatric illness.

                However, the problem of obesity emerged globally only several decades ago. Since the change of genome of a species requires a long time, the outbreak of obesity is unlikely to be caused by changes in human genome. For most individuals, controlling food intake and doing physical activity in a proper way are effective strategies to lose weight. But for some people whose health condition or current life pace keeps them away from systemic and regular exercise and dieting, modulate the composition of microorganisms in intestine might act as an alternative.

                Reports by Gordon have shown that, apart from human genome, the collective genome of microorganisms (microbiome) in human intestine is associated with our obesity [1]. Furthermore, microbiome is able to be changed through control of food intake [1].

                Two groups of beneficial bacteria are dominant in the human gut, the Bacteroidetes and the Firmicutes. The relative proportion of Firmicutes is increased in obese people by comparison with lean people [2].

                Figure 3: How excess of energy contributes to obesity

                Pertinent study by Gordon attested their initial hypothesis that changes in microbial component have a causal relationship with obesity, thus might have potential therapeutic implications [2] [3]. Colonization of germ-free mice with an ‘obese microbiota’ results in a significantly greater increase in total body fat than colonization with a ‘lean microbiota’ [3].
                Figure from reference [3]


                Present strategies to lose weight

                Dieting, excercise, Drugs and surgery and major ways to lose weight. However, they all have many drawbacks. Dieting may cause nutritional imbalance and can be a heavy mental burden since the person may not be able to enjoy the food he want. Excercise requires regular time and is ineffective in many cases. Drugs and surgery may have many side effects and are many times costly.

                Our idea

                Previous situations and insights construct our theoretical fundament. We try to utilize synthetic biology to provide a cheap, convient, effective and safe approach for treating obesity. Instead of passive alternation of microbiota, we are trying to construct an engineered E.coli----- E.coslim to positively change microbiota in intestine. As Figure 3 shown, we place E.coslim in the role of sensing and consuming excessive energy, thus leads to the double effects: lowering the proportion of Firmicutes and increasing that of Bacteroidetes, and decreasing the energy available in one’s intestine.

                To achieve these two goals, we designed four devices, fatty acids consumption, cellulose synthesis, colonization and death device of E.coslim.

                References


                [1] Ruth E. Ley1, Peter J. Turnbaugh1, Samuel Klein1 & Jeffrey I. Gordon1 Microbial ecology: Human gut microbes associated with obesity. Nature 444, 1022-1023 (21 December 2006)
                [2] Peter J. Turnbaugh1, Ruth E. Ley1, Michael A. Mahowald1, Vincent Magrini2, Elaine R. Mardis1,2 & Jeffrey I. Gordon1 An obesity-associated gut microbiome with increased capacity for energy harvest. Vol 444|21/28 December 2006| doi: 10.1038/nature05414
                [3] Ley RE. Obesity and the human microbiome. Curr Opin Gastroenterol. 2010 Jan; 26(1):5-11.
                [4] Y Claire Wang et.al. Health and economic burden of the projected obesity trends in the USA and the UK. Lancet. 2011

                Promoter Design

                ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc

                Fatty Acid Degradation Device

                Purpose

                To help people lose weight without the need of food restriction, we designed a genetically modified E.coli that can sense and degrade excessive fatty acids intake by the host. We hope that, together with other two devices we designed, we can introduce our E.coslim as resident in intestine to consume the excessive calories intake by the host and regulate intestinal microbiota.

                Outline

                Genes that are responsible for degradation and transportation of fatty acids (FAs) from E.coli K12 and from Salmonella enterica LT2 were cloned. Also, a promoter that can that can be regulated soley by fatty acids was also designed. By placing those fatty acids degradation genes downstream of the artificially designed promoter that can sense the concentration of FAs, we hope to create a device that to degrade FAs only when the concentration of FAs is high.

                dddd ddddd ddddd dddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd dddddvdddd ddddd ddddddddd ddddd ddddd dddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd dddddvdddd ddddd ddddddddd ddddd ddddd dddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd dddddvdddd ddddd ddddddddd ddddd ddddd dddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd dddddvdddd ddddd ddddddddd ddddd ddddd dddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd dddddvdddd ddddd ddddd

                Device II: Cellulose Synthesis

                Outline

                Cellulose is an essential material for keeping intestine peristalsis without producing energy, as prebiotics, feeding vegetarian bacteria flora (including Bacteroides, whose appropriate amount has proved important to prevent obesity[1]) of intestine as well. Thus, cellulose help people keep slim and healthy.

                The developing device aims at transforming glucose into cellulose, thus producing cellulose as well as reducing energy intake. To achieve this goal, we cloned genes of enzymes responding to cellulose synthesis from the Escherichia coli str. DH5α, constructing functional expressional elements with these genes respectively downstream of promoter activated by glucose. In this way, cellulose synthetase complex is built artificially under regulation of glucose, repressed under low concentration of glucose and activated under high concentration of glucose.

                In the future, this device can be integrated to the assembled “E. coslim”, activated when excess glucose is sensed in intestine, converting to cellulose.

                The same as device I (fatty acid metabolism), on one hand,we divide our work into two parallel sections. “Function” section includes a series of molecular biological manipulation on four genes of the cellulose synthetase complex and another two genes responding to producesubstrates for cellulose synthesis. On the other hand, the design, construction and function tests of glucose-activated promoter belong to “regulation” section.

                Description

                Genes to be Cloned

                4 genes, bcsA, bcsB, bcsZ and bcsC,from the rdar morphotype bacterium,are involved in cellulose biosynthesis.

                • BcsA is considered to be the catalytic subunit
                • BcsB can be activated the soon it binds to c-di-GMP
                • BcsZ encodes endo-1,4-D-glucanase which belongs to glycosyl hydrolase family Ⅷ. Activation of BcsZ is required for optimal synthesis and membrane translocation of cellulose
                • Although bcsC is transcribed constitutively, cellulose synthesis occurs only in the circumstances of AdrA
                • AdrA ,a diguanylate cyclase (DGC), cyclizestwo GTPs into c-di-GMP. In turn, the activity of cellulose synthase can be increased when binds to c-di-GMP. For more information of c-di-GMP, click Here
                • GalU catalyzes the addition of UTP to α-D-glucose 1-phosphate to yield UDP-D-glucose, which is the substrate for cellulose synthase complex
                • GalF is a predicted subunit of a GalU/GalF protein complex involved in colanic acid building blocks biosynthesis

                Indirect Regulation Pathway Design

                In a cell, total amount of ATP, ADP and AMP remains constant. Low glucose concentration results in high activity of adenylate cyclase converting ATP into cAMP, who binds and converts cAMP receptor protein (abbreviated as CRP) to DNA-binding configuration. Conversely, when glucose concentration gets high, more ATP and less cAMP will be produced, resulting in low DNA-binding activity of CRP.

                We embed gene cI of lambda phage downstream promoter PcstA (BBa_K118011) activated by the binding of CRP, and genes of cellulose synthesis respectively downstream the promoter BBa_R0051 repressed by protein cI. In this way ,we construct an indirect regulation pathway with sensus glucose, transcription activator CRP and transcription repressor cI. If the device works as supposed, cellulose production will be increased following the elevation of glucose concentration, and vice versa. For more information, click Here.

                Direct Regulation Pathway Design

                Although the indirect regulation pathway was tested effective, we went on attempting a more compact and widely useful direct regulation design. Hence we modified a constitutive promoter (BBa_J23119) to CRP repressible ones. We have established a new technical standard for our strategy of repressible promoter design (for more information, click on Standard), but we shall focus on the design itself now.

                We designed promoter Pcar(BBa_K861171) based on promoter BBa_J23119, inserting CRP-binding site to overlap on six base pairs with promoter -10 region. Since steric hindrance of CRP dimer blocks the function of -10 region, genes downstream will be repressed when glucose concentration is low. That is, most CRP appears in DNA-binding configuration. The repressive effect is undermined when glucose concentration increases. Accordingly, we changed CRP from an activator to a repressor, simplifying the device with potential advantages of higher sensibility and efficiency. As experimental results show, promoter Pcar works as we expect. For more information, please click Here.

                Progress

                Clone of genes

                As for the genes that we cloned, there is no difference between E. Coli str. K12 MG1655 and more available DH5α.we purified and amplified these genes from genome of Escherichia coli str. DH5α?using PCR. The primers contain standard restriction enzyme cutting sites. The sequences of the primers used are as below:

                • bcsA Antisense CCTGCAGTACTAGTATCATTGTTGAGCCAAAGCCTG
                  Sense CGAATTCTTCTAGAGATGAGTATCCTGACCCGGTGG
                • bcsB Antisense CCTGCAGTACTAGTATTACTCGTTATCCGGGTTAAGAC
                  Sense CGAATTCTTCTAGAGATGAAAAGAAAACTATTCTGGATTTG
                • bcsZ Antisense CCTGCAGTACTAGTATTAGTGTGAATTTGCGCATTCCTGG
                  Sense CGAATTCTTCTAGAGATGAATGTGTTGCGTAGTGGAATCG
                • bcsC Antisense CCTGCAGTACTAGTATTACCAGTCGGCGTAAGGTATCA
                  Sense CGAATTCTTCTAGAGATGCGCAAATTCACACTAAACATATTC
                • galF Antisense CCTGCAGTACTAGTATTATTCGCTTAACAGCTTCTCG
                  Sense CGAATTCTTCTAGAGATGACGAATTTAAAAGCAGTTATACC
                • galU Antisense CCTGCAGTACTAGTATTACTTCTTAATGCCCATCTCTTCT
                  Sense CGAATTCTTCTAGAGATGGCTGCCATTAATACGAAAG
                Then the genes were digested with restriction enzymes and assembled to RBS (BBa_B0030) and terminator (BBa_B0024).

                Construction of the plasmid expressing cellulose synthetase controlled by promoter we designed

                All coding sequences were assembled to RBS and terminator, afterwards, they were embedded downstream the promoter Pcar, which can be activated at high glucose concentration. If you want to know it for details, please click Here.
                The biobricks constructed were showed as bellow:

                All new composite parts mentioned above were transformed to competent cells of Escherichia coli str. DH5α. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.

                Detection of Cellulose Synthesis

                To detect the cellulose synthesis, we used cellulase to degrade cellulose in the cell culture. Then total reducing sugar in the culture was measured. So the difference of total reducing sugar between culture before and after treated with cellulase represents the total cellulose synthetised by the cell. For detailed information, please click Here.

                Results

                Clone of genes

                The gene bcsA is 2619bp, bcsB is 2340bp, bcsZ is 1107 bp, bcsC is 3474bp, galU is 909bp and galF is 894 bp. After PCR amplification, DNA fragments were examined by agarose gel electrophoresis.All genes proved correct. Then the genes were digested with restriction enzymes and embedded into plasmid backbone pSB1A2. To confirm the accuracy of sequences, positive clones were sent for sequencing after transformation. And the results showed that no mutation existed in genes.

                Detection of Cellulose Synthesis

                aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
                aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
                aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
                aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
                aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
                aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
                aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

                Retrieved from "http://2012.igem.org/Team:WHU-China/Project"