"

From 2012.igem.org

Fatty acids sensor PfadR

Design of PfadR promoter

Fatty acid sensor has already been tried by iGEM2006 Tokyo Alliance (BBa_J54222, BBa_J54224.)Yet their design failed to give desirable function. To design promoter that can under the sole regulation of fatty acid concentration. Double FadR binding sites from promoter of FadL are place and overlap downstream of constitutive promoter J23110 (TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCTATACTCTCGCCACTGGTCTGATTTCTAAGA).

Experiment

We test the function of PfadR in low copy number plasmid pSB6A1. Also, FadR was overexpressed to prevent leaky expression of the promoter.
Specifically, bacteria with BBa_K861061 in pSB6A1 was vortex in M9 medium with oleic acid as sole carbon source for 24 hours. Oleic acid was emulsified with 10% Triton X100 with volume 1:1. Then various volume of mixture is added to M9 medium with 0.2% triton X100. We vortex E.coli Dh5 &alpha in the medium for 24h and using plate reader to see its OD600 and fluorescence. For more details, please see our Protocol website.